Starting /dee2/code/volunteer_pipeline.sh SRR11389751 current disk space = 1547266465792 free memory = 1599288812 SRR11389751 SRAfilesize 09b0108b0b61160257481f99365c3de5 SRR11389751.sra SRR11389751.sra file validated SRR11389751 is paired end SRR11389751 is conventional basespace SRR11389751 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389751_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.78225 32.0 32.0 32.0 32.0 32.0 2 30.752 32.0 32.0 32.0 32.0 32.0 3 30.76275 32.0 32.0 32.0 32.0 32.0 4 30.89825 32.0 32.0 32.0 32.0 32.0 5 30.77975 32.0 32.0 32.0 32.0 32.0 6 34.011 36.0 36.0 36.0 32.0 36.0 7 33.97725 36.0 36.0 36.0 32.0 36.0 8 33.95525 36.0 36.0 36.0 32.0 36.0 9 33.9335 36.0 36.0 36.0 32.0 36.0 10-11 34.010125 36.0 36.0 36.0 32.0 36.0 12-13 34.047625 36.0 36.0 36.0 32.0 36.0 14-15 33.899874999999994 36.0 36.0 36.0 32.0 36.0 16-17 33.89125 36.0 36.0 36.0 32.0 36.0 18-19 33.997125 36.0 36.0 36.0 32.0 36.0 20-21 33.971625 36.0 36.0 36.0 32.0 36.0 22-23 34.041624999999996 36.0 36.0 36.0 32.0 36.0 24-25 33.90075 36.0 36.0 36.0 32.0 36.0 26-27 33.807874999999996 36.0 36.0 36.0 32.0 36.0 28-29 33.593 36.0 36.0 36.0 29.5 36.0 30-31 33.791250000000005 36.0 36.0 36.0 32.0 36.0 32-33 33.444375 36.0 36.0 36.0 26.5 36.0 34-35 33.6725 36.0 36.0 36.0 29.5 36.0 36-37 33.904695783892954 36.0 36.0 36.0 32.0 36.0 38-39 33.92034839686947 36.0 36.0 36.0 32.0 36.0 40-41 33.939252336448604 36.0 36.0 36.0 32.0 36.0 42-43 33.88567458312279 36.0 36.0 36.0 32.0 36.0 44-45 33.829711975745326 36.0 36.0 36.0 32.0 36.0 46-47 33.75846387064174 36.0 36.0 36.0 32.0 36.0 48-49 33.78410813542193 36.0 36.0 36.0 32.0 36.0 50-51 33.808868115209705 36.0 36.0 36.0 32.0 36.0 52-53 33.92129863567458 36.0 36.0 36.0 32.0 36.0 54-55 33.5378398251134 36.0 36.0 36.0 27.0 36.0 56-57 33.593126105635584 36.0 36.0 36.0 29.5 36.0 58-59 33.55144084934277 36.0 36.0 36.0 27.0 36.0 60-61 33.52857865452707 36.0 36.0 36.0 27.0 36.0 62-63 33.65494561092841 36.0 36.0 36.0 27.0 36.0 64-65 33.45140470766894 36.0 36.0 36.0 24.0 36.0 66-67 33.59021149401707 36.0 36.0 36.0 27.0 36.0 68-69 33.50296998483451 36.0 36.0 36.0 27.0 36.0 70-71 33.458824256634884 36.0 36.0 36.0 27.0 36.0 72-73 33.4241883942189 36.0 36.0 36.0 24.0 36.0 74-75 33.3270635300544 36.0 36.0 36.0 24.0 36.0 76 33.04455081001473 36.0 36.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 39.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 4.0 23 13.0 24 8.0 25 22.0 26 36.0 27 56.0 28 98.0 29 120.0 30 176.0 31 232.0 32 279.0 33 451.0 34 881.0 35 1584.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.939393939393945 14.494949494949495 11.843434343434343 39.72222222222222 2 24.034334763948497 14.163090128755366 36.00100984599848 25.801565261297654 3 21.13102751830346 22.746781115879827 22.999242615501135 33.12294875031558 4 27.720272658419592 27.06387275940419 19.16182782125726 26.05402676091896 5 26.93764200959354 30.01767230497349 21.48447361777329 21.56021206765968 6 22.045454545454547 31.262626262626263 24.267676767676768 22.424242424242426 7 17.899520323150718 24.816965412774554 35.470840696793736 21.812673567280992 8 20.52511991921232 23.0497349154254 30.522595304216104 25.902549861146174 9 21.93890431709164 21.004796768492806 30.67407220398889 26.38222671042666 10-11 23.643019439535472 28.616510982075233 22.456450391315325 25.28401918707397 12-13 24.009088613986368 22.21661196667508 24.993688462509468 28.780610956829083 14-15 22.835142640747286 25.47336531178995 25.725826811411263 25.9656652360515 16-17 25.170411512244385 24.993688462509468 23.794496339308253 26.041403685937897 18-19 25.220903812168643 25.460742236808887 23.643019439535472 25.675334511486998 20-21 24.90532693764201 24.6528654380207 24.715980812926027 25.725826811411263 22-23 25.66271143650593 25.738449886392324 24.18581166372128 24.413027013380457 24-25 23.680888664478665 25.19565766220651 25.19565766220651 25.927796011108306 26-27 23.89548093915678 24.690734662963898 24.678111587982833 26.735672809896492 28-29 25.044180762433726 25.47336531178995 23.83236556425145 25.65008836152487 30-31 25.132542287301185 25.35975763696036 24.387780863418328 25.11991921232012 32-33 23.794496339308253 26.306488260540267 24.917950012623074 24.9810653875284 34-35 24.9810653875284 25.725826811411263 23.945973239081038 25.347134561979303 36-37 24.715980812926027 24.57712698813431 24.021711688967432 26.685180509972227 38-39 25.18303458722545 23.718757889421862 24.93057308760414 26.16763443574855 40-41 24.753725688305128 24.88002020712301 24.336953776206112 26.02930032836575 42-43 24.103082364830723 24.204143506821627 25.03789792824659 26.654876200101064 44-45 24.4188984335523 24.608388074785246 24.74734714502274 26.225366346639717 46-47 24.722081859525012 24.519959575543204 24.608388074785246 26.14957049014654 48-49 24.54522486104093 24.772612430520464 24.027286508337546 26.654876200101064 50-51 25.0 23.332491157150077 25.517938352703386 26.14957049014654 52-53 25.593734209196562 23.913592723597777 23.496715512885295 26.995957554320366 54-55 24.535691724573596 23.840808591282375 24.965255843335438 26.658243840808595 56-57 25.132676269901438 23.995451099317666 24.728329542582763 26.14354308819813 58-59 23.445399393326593 24.595551061678464 25.303336703741152 26.65571284125379 60-61 25.26555386949924 23.014668689934243 24.860900354071827 26.858877086494687 62-63 23.842651151024537 24.98102706804958 24.63951429294207 26.53680748798381 64-65 26.094659579853204 23.89268539610225 24.538091622374083 25.474563401670462 66-67 23.838460564628434 23.82580073427016 24.711988859349283 27.623749841752122 68-69 24.12308471571483 23.13536786121312 25.49069266810181 27.250854754970245 70-71 25.19006588950836 24.13836796756209 24.37911809427268 26.29244804865687 72-73 25.324675324675322 23.52941176470588 23.771326712503182 27.37458619811561 74-75 25.506779433481004 21.425694724124046 25.399382467445296 27.668143374949654 76 28.09278350515464 0.0 34.09425625920471 37.812960235640645 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 39.0 1 19.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 7.0 19 11.5 20 13.5 21 20.0 22 19.5 23 15.5 24 12.0 25 10.5 26 11.5 27 16.0 28 21.5 29 21.0 30 22.5 31 31.5 32 50.0 33 61.0 34 52.5 35 58.0 36 87.0 37 105.0 38 115.0 39 139.5 40 149.0 41 161.5 42 177.5 43 177.5 44 202.5 45 202.0 46 179.5 47 182.5 48 171.0 49 140.5 50 124.0 51 118.5 52 114.5 53 113.0 54 105.5 55 103.5 56 115.0 57 138.0 58 148.0 59 136.5 60 132.5 61 131.0 62 122.5 63 112.0 64 90.0 65 86.0 66 103.0 67 103.5 68 88.0 69 75.5 70 58.5 71 50.5 72 50.0 73 40.5 74 41.0 75 40.0 76 33.0 77 21.5 78 12.5 79 14.0 80 12.5 81 9.0 82 8.5 83 7.5 84 4.5 85 2.0 86 1.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0 2 0.975 3 0.975 4 0.975 5 0.975 6 1.0 7 0.975 8 0.975 9 0.975 10-11 0.975 12-13 0.975 14-15 0.975 16-17 0.975 18-19 0.975 20-21 0.975 22-23 0.975 24-25 0.975 26-27 0.975 28-29 0.975 30-31 0.975 32-33 0.975 34-35 0.975 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 39.0 36 0.0 37 0.0 38 0.0 39 2.0 40 0.0 41 1.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 1.0 55 0.0 56 0.0 57 1.0 58 0.0 59 2.0 60 0.0 61 1.0 62 0.0 63 2.0 64 0.0 65 1.0 66 1.0 67 0.0 68 1.0 69 1.0 70 2.0 71 11.0 72 14.0 73 64.0 74 263.0 75 877.0 76 2716.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.075 #Duplication Level Percentage of deduplicated Percentage of total 1 97.18643176439653 92.4 2 2.208782540099921 4.2 3 0.2103602419142782 0.6 4 0.15777018143570865 0.6 5 0.1051801209571391 0.5 6 0.05259006047856955 0.3 7 0.026295030239284777 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.05259006047856955 1.225 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 39 0.975 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 10 0.25 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 7 0.17500000000000002 No Hit GTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTA 6 0.15 No Hit ATTTTTTCTCTTTTTATTTTGTTTCTTTTTATTTAGACCTTCTTCATATT 6 0.15 No Hit CCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATTT 5 0.125 No Hit CAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGG 5 0.125 No Hit CAACAGATCAATCCAGATCAGTGAGCTGCTGTTTAGGCCTTGCCGGACTCCTCGCAGCCTGGAGGCTTGAAGGCG 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 5 0.125 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389751 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389751_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.181 32.0 32.0 32.0 21.0 32.0 2 29.7605 32.0 32.0 32.0 14.0 32.0 3 29.69025 32.0 32.0 32.0 14.0 32.0 4 29.8425 32.0 32.0 32.0 21.0 32.0 5 29.708 32.0 32.0 32.0 21.0 32.0 6 32.55875 36.0 36.0 36.0 14.0 36.0 7 33.04575 36.0 36.0 36.0 21.0 36.0 8 32.9025 36.0 36.0 36.0 21.0 36.0 9 32.90575 36.0 36.0 36.0 21.0 36.0 10-11 32.738375000000005 36.0 36.0 36.0 17.5 36.0 12-13 32.88975 36.0 36.0 36.0 17.5 36.0 14-15 32.85725 36.0 36.0 36.0 17.5 36.0 16-17 32.758125 36.0 36.0 36.0 17.5 36.0 18-19 32.6845 36.0 36.0 36.0 17.5 36.0 20-21 32.811375 36.0 36.0 36.0 14.0 36.0 22-23 32.563375 36.0 36.0 36.0 14.0 36.0 24-25 32.720749999999995 36.0 36.0 36.0 14.0 36.0 26-27 32.613875 36.0 36.0 36.0 14.0 36.0 28-29 32.679249999999996 36.0 36.0 36.0 14.0 36.0 30-31 32.577 36.0 36.0 36.0 14.0 36.0 32-33 32.45525 36.0 36.0 36.0 14.0 36.0 34-35 32.53075 36.0 36.0 36.0 14.0 36.0 36-37 32.72058080808081 36.0 36.0 36.0 14.0 36.0 38-39 32.9054292929293 36.0 36.0 36.0 14.0 36.0 40-41 32.74355735219808 36.0 36.0 36.0 14.0 36.0 42-43 32.87288349759919 36.0 36.0 36.0 14.0 36.0 44-45 32.615617892342684 36.0 36.0 36.0 14.0 36.0 46-47 32.653651756381095 36.0 36.0 36.0 14.0 36.0 48-49 32.529441496082896 36.0 34.0 36.0 14.0 36.0 50-51 32.68625221127117 36.0 36.0 36.0 14.0 36.0 52-53 32.619408642911296 36.0 36.0 36.0 14.0 36.0 54-55 32.509662676860174 36.0 36.0 36.0 14.0 36.0 56-57 32.597067745197165 36.0 36.0 36.0 14.0 36.0 58-59 32.3646017699115 36.0 32.0 36.0 14.0 36.0 60-61 32.40956235770301 36.0 34.0 36.0 14.0 36.0 62-63 32.352859311740886 36.0 32.0 36.0 14.0 36.0 64-65 32.18126582278481 36.0 34.0 36.0 14.0 36.0 66-67 32.09750730758405 36.0 32.0 36.0 14.0 36.0 68-69 32.141767714192255 36.0 32.0 36.0 14.0 36.0 70-71 32.187712724252904 36.0 32.0 36.0 14.0 36.0 72-73 32.12140127065891 36.0 32.0 36.0 14.0 36.0 74-75 32.11990280371055 36.0 32.0 36.0 14.0 36.0 76 31.48900293255132 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 40.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 8.0 16 8.0 17 7.0 18 6.0 19 8.0 20 9.0 21 13.0 22 20.0 23 34.0 24 35.0 25 74.0 26 73.0 27 113.0 28 128.0 29 178.0 30 255.0 31 284.0 32 376.0 33 522.0 34 856.0 35 953.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.7661188369153 21.34007585335019 10.442477876106194 33.45132743362832 2 31.648129423660265 22.295247724974722 27.856420626895854 18.200202224469162 3 25.233644859813083 26.471331144228337 22.78353119474615 25.511492801212427 4 30.18438999747411 28.946703713058852 17.832786057085123 23.036120232381915 5 29.772727272727273 30.454545454545457 19.116161616161616 20.656565656565657 6 22.550505050505052 35.25252525252525 19.747474747474747 22.449494949494948 7 24.36868686868687 18.484848484848484 32.44949494949495 24.6969696969697 8 24.343434343434346 20.833333333333336 25.353535353535356 29.46969696969697 9 25.88383838383838 22.22222222222222 25.227272727272727 26.666666666666668 10-11 27.65151515151515 28.257575757575758 19.141414141414142 24.949494949494948 12-13 28.271854471955532 22.119757453259222 22.599797877716018 27.008590197069225 14-15 26.480616239424172 24.40964768278823 23.17211769162773 25.937618386159865 16-17 27.146112939984807 23.297037224613824 22.296783995948342 27.260065839453024 18-19 26.38888888888889 23.775252525252526 23.535353535353533 26.300505050505052 20-21 27.419762446297703 24.07126611068992 23.287844326509983 25.2211271165024 22-23 28.226214574898783 24.11437246963563 22.355769230769234 25.303643724696357 24-25 26.531127667634802 24.28336911226165 24.093951256471776 25.09155196363177 26-27 27.057782273359464 24.415223163484637 22.64508787457327 25.881906688582628 28-29 26.590765338393425 24.313725490196077 22.30234029095509 26.793168880455408 30-31 25.39462053289557 25.381992675842906 23.235256976891023 25.988129814370502 32-33 26.874366767983787 24.531408308004053 22.821681864235053 25.772543059777103 34-35 27.90991902834008 24.000506072874494 22.849190283400812 25.240384615384613 36-37 26.792261980022758 25.186496396510304 22.569224933619928 25.452016689847014 38-39 25.518462316641376 24.14011127971674 23.96307536671725 26.378351036924634 40-41 26.784586228679725 23.651295009475678 22.64055590650663 26.92356285533797 42-43 27.543926178738467 24.699785109341423 22.500316015674375 25.25597269624573 44-45 27.641557128412536 24.443882709807887 22.7376137512639 25.176946410515672 46-47 26.889057366691937 24.273439474349253 22.378064190042963 26.459438968915844 48-49 26.65571284125379 24.380687563195146 23.748736097067745 25.214863498483314 50-51 26.34904587387843 24.402881334512827 23.05067610261595 26.197396688992796 52-53 26.130907252969422 24.740965377811474 22.870861763962598 26.257265605256507 54-55 27.224469160768454 24.418604651162788 23.407482305358947 24.949443882709808 56-57 27.025316455696203 24.50632911392405 23.658227848101266 24.81012658227848 58-59 26.804905803514984 24.731318750790237 22.51864963965103 25.945125806043745 60-61 26.508920663039355 24.19334429963305 23.53536631658864 25.76236872073896 62-63 26.530870445344128 24.822874493927124 23.785425101214575 24.86082995951417 64-65 27.19665271966527 23.468999619627233 22.670216812476227 26.664130848231267 66-67 26.472450918302727 25.066497783407222 22.78657378087397 25.67447751741609 68-69 26.50114010640993 24.258930833544465 23.929566759564224 25.310362300481376 70-71 26.263010916476265 24.96826605737497 23.22924600152323 25.53947702462554 72-73 25.383239652529383 24.10577414409811 24.68063362289218 25.830352580480326 74-75 26.7529665587918 20.927723840345198 24.959546925566343 27.359762675296658 76 28.079178885630498 0.0 33.54105571847507 38.379765395894424 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 40.0 1 20.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 1.0 9 0.5 10 0.0 11 1.0 12 2.0 13 1.0 14 0.5 15 0.5 16 0.5 17 2.0 18 5.5 19 8.5 20 7.0 21 7.0 22 8.0 23 8.0 24 10.0 25 10.0 26 8.0 27 9.5 28 17.0 29 21.5 30 22.0 31 24.0 32 34.0 33 43.5 34 49.5 35 65.0 36 81.0 37 91.5 38 100.5 39 115.5 40 137.0 41 138.0 42 132.5 43 151.5 44 174.5 45 168.0 46 165.5 47 167.5 48 151.5 49 140.0 50 127.5 51 127.5 52 131.5 53 129.5 54 127.5 55 117.5 56 118.5 57 123.5 58 122.0 59 133.5 60 143.5 61 143.5 62 140.0 63 118.5 64 99.5 65 105.5 66 99.5 67 88.5 68 96.5 69 88.5 70 71.5 71 69.5 72 72.0 73 63.5 74 52.0 75 48.0 76 37.5 77 33.0 78 23.5 79 11.5 80 10.5 81 7.5 82 7.0 83 7.5 84 6.0 85 5.0 86 3.0 87 1.0 88 0.5 89 1.0 90 1.0 91 0.5 92 1.0 93 1.0 94 1.0 95 1.0 96 1.0 97 0.5 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 1.0999999999999999 3 1.0250000000000001 4 1.0250000000000001 5 1.0 6 1.0 7 1.0 8 1.0 9 1.0 10-11 1.0 12-13 1.05 14-15 1.0125 16-17 1.275 18-19 1.0 20-21 1.075 22-23 1.2 24-25 1.0125 26-27 1.1375 28-29 1.1875 30-31 1.0125 32-33 1.3 34-35 1.2 36-37 0.1388888888888889 38-39 0.15151515151515152 40-41 0.012632642748863063 42-43 0.03790750568612585 44-45 0.025271670457417232 46-47 0.0 48-49 0.025271670457417232 50-51 0.012635835228708616 52-53 0.0 54-55 0.012637432073802603 56-57 0.15166835187057634 58-59 0.012642225031605562 60-61 0.037945863900834806 62-63 0.0 64-65 0.16455696202531644 66-67 0.025326073192351528 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 40.0 36 0.0 37 0.0 38 0.0 39 2.0 40 0.0 41 1.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 1.0 55 0.0 56 0.0 57 1.0 58 0.0 59 2.0 60 0.0 61 1.0 62 0.0 63 2.0 64 0.0 65 1.0 66 1.0 67 0.0 68 2.0 69 1.0 70 12.0 71 9.0 72 20.0 73 67.0 74 258.0 75 851.0 76 2728.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.125 #Duplication Level Percentage of deduplicated Percentage of total 1 96.9250985545335 92.2 2 2.3915900131406045 4.55 3 0.39421813403416556 1.125 4 0.15768725361366623 0.6 5 0.07884362680683311 0.375 6 0.026281208935611037 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026281208935611037 1.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 40 1.0 No Hit GGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACA 6 0.15 No Hit TGTGAAGTATGGAAGGCGATCAAATTCGAGTTCGCGCCGGTAGATACTATCGATTAATAGATAAAACTAAATATG 5 0.125 No Hit CCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTT 5 0.125 No Hit AAATTATCCGAGCAGCTTGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1436621 spots for SRR11389751.sra Written 1436621 spots for SRR11389751.sra Read 1436621 spots for SRR11389751.sra Written 1436621 spots for SRR11389751.sra Read 1436621 spots for SRR11389751.sra Written 1436621 spots for SRR11389751.sra Read 1436621 spots for SRR11389751.sra Written 1436621 spots for SRR11389751.sra Read 1436621 spots for SRR11389751.sra Written 1436621 spots for SRR11389751.sra Read 1436621 spots for SRR11389751.sra Written 1436621 spots for SRR11389751.sra Read 1436621 spots for SRR11389751.sra Written 1436621 spots for SRR11389751.sra Read 1436621 spots for SRR11389751.sra Written 1436621 spots for SRR11389751.sra Read 1436621 spots for SRR11389751.sra Written 1436621 spots for SRR11389751.sra Read 1436621 spots for SRR11389751.sra Written 1436621 spots for SRR11389751.sra Read 1436621 spots for SRR11389751.sra Written 1436621 spots for SRR11389751.sra Read 1436621 spots for SRR11389751.sra Written 1436621 spots for SRR11389751.sra Read 1436621 spots for SRR11389751.sra Written 1436621 spots for SRR11389751.sra Read 1436639 spots for SRR11389751.sra Written 1436639 spots for SRR11389751.sra Read 1436621 spots for SRR11389751.sra Written 1436621 spots for SRR11389751.sra Read 1436621 spots for SRR11389751.sra Written 1436621 spots for SRR11389751.sra Read 1436621 spots for SRR11389751.sra Written 1436621 spots for SRR11389751.sra Read 1436621 spots for SRR11389751.sra Written 1436621 spots for SRR11389751.sra Read 1436621 spots for SRR11389751.sra Written 1436621 spots for SRR11389751.sra Read 1436621 spots for SRR11389751.sra Written 1436621 spots for SRR11389751.sra SRR ids: ['SRR11389751.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__0_nh6bu SRR11389751.sra spots: 28732438 blocks: [[1, 1436621], [1436622, 2873242], [2873243, 4309863], [4309864, 5746484], [5746485, 7183105], [7183106, 8619726], [8619727, 10056347], [10056348, 11492968], [11492969, 12929589], [12929590, 14366210], [14366211, 15802831], [15802832, 17239452], [17239453, 18676073], [18676074, 20112694], [20112695, 21549315], [21549316, 22985936], [22985937, 24422557], [24422558, 25859178], [25859179, 27295799], [27295800, 28732438]] SRR11389751 file size 5456127 SRR11389751 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389751 SRR11389751_1.fastq SRR11389751_2.fastq Input file: SRR11389751_1.fastq Paired file: SRR11389751_2.fastq trimmed: SRR11389751-trimmed-pair1.fastq, SRR11389751-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 04:00:51 2024 >> started Sat Dec 7 04:01:16 2024 >> done (24.922s) 28732438 read pairs processed; of these: 1650 ( 0.01%) short read pairs filtered out after trimming by size control 446688 ( 1.55%) empty read pairs filtered out after trimming by size control 28284100 (98.44%) read pairs available; of these: 17425 ( 0.06%) trimmed read pairs available after processing 28266675 (99.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 471 0.00% 19 7 0.00% 20 694 0.00% 21 6 0.00% 22 838 0.00% 23 8 0.00% 24 895 0.00% 25 17 0.00% 26 920 0.00% 27 16 0.00% 28 708 0.00% 29 16 0.00% 30 608 0.00% 31 23 0.00% 32 453 0.00% 33 22 0.00% 34 347 0.00% 35 437 0.00% 36 1103 0.00% 37 535 0.00% 38 869 0.00% 39 746 0.00% 40 901 0.00% 41 946 0.00% 42 1094 0.00% 43 1223 0.00% 44 1390 0.00% 45 1527 0.01% 46 1709 0.01% 47 1984 0.01% 48 2049 0.01% 49 2248 0.01% 50 2506 0.01% 51 2735 0.01% 52 2930 0.01% 53 3222 0.01% 54 3489 0.01% 55 4114 0.01% 56 4760 0.02% 57 4944 0.02% 58 5214 0.02% 59 5793 0.02% 60 6227 0.02% 61 6458 0.02% 62 7031 0.02% 63 7584 0.03% 64 8478 0.03% 65 9203 0.03% 66 10026 0.04% 67 10818 0.04% 68 11612 0.04% 69 12297 0.04% 70 14032 0.05% 71 17436 0.06% 72 46695 0.17% 73 265471 0.94% 74 1878616 6.64% 75 12410990 43.88% 76 13496609 47.72% 28284100 reads passed initial QC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=24 prefix-density=0.93 prefix-fanout=2.0 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=60.22 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.2 sequence=GTTCTCCTTCTAATGCAAACAGCACGCATTCAAGAGGAGAGAGAAATGAACAAGTGAGCAGAAGAACAAAGATGCCCGGATTCATCTCACAAATAACCGAGGGATATTACACAAACACCATCTTTAGTGTACAACACCAACTCCTCATCTCTGACTTTCACATGCAACATCTATCAGTCCTGACTCCTGACTCAATCTCGACACATGCAGCAGCATCCATCATCAACAATGACGTCGTCGGCCAAGCGCCTCAGCATAGAGCAGGCGCTGGAGCTTGCTAACTAAGCTCACTTGCCGGGG criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=18 prefix-density=0.72 prefix-fanout=2.5 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=8.23 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.6 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGCTCCTTTCCA SRR11389751 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 04:01:41 Started mapping on | Dec 07 04:01:41 Finished on | Dec 07 04:04:44 Mapping speed, Million of reads per hour | 556.41 Number of input reads | 28284100 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 22875019 Uniquely mapped reads % | 80.88% Average mapped length | 150.33 Number of splices: Total | 8731931 Number of splices: Annotated (sjdb) | 8368466 Number of splices: GT/AG | 8622551 Number of splices: GC/AG | 95908 Number of splices: AT/AC | 2039 Number of splices: Non-canonical | 11433 Mismatch rate per base, % | 0.59% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.01% Insertion average length | 1.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3548398 % of reads mapped to multiple loci | 12.55% Number of reads mapped to too many loci | 90757 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.20% % of reads unmapped: other | 1.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1860692 1860692 1860692 N_multimapping 3548398 3548398 3548398 N_noFeature 732590 22196823 987824 N_ambiguous 609364 4020 203143 UnstrandedReadsAssigned:21533065 PositiveStrandReadsAssigned:674176 NegativeStrandReadsAssigned:21684052 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389751 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389751-trimmed-pair1.fastq SRR11389751-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,284,100 reads, 24,768,788 reads pseudoaligned [quant] estimated average fragment length: 187.862 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,132 rounds 52973 SRR11389751.ke.tsv 35125 SRR11389751.se.tsv 88098 total ==> SRR11389751.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 749.204 0 0 PNS24247 1044 857.138 15.0069 0.911489 PNS24249 1928 1741.14 39.2209 1.17272 PNS24246 1044 857.138 15.0069 0.911489 PNS24248 1044 857.138 15.0069 0.911489 PNS24244 1471 1284.14 101.758 4.12541 PNS24243 293 118.472 0 0 KQK14069 1603 1416.14 942.072 34.6329 KQK14071 474 288.562 71.1277 12.8324 ==> SRR11389751.se.tsv <== BRADI_1g14170v3 1054 BRADI_1g53295v3 22 BRADI_1g59795v3 758 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 218 BRADI_1g74790v3 106 BRADI_1g09890v3 0 BRADI_1g77505v3 233 BRADI_1g48960v3 0 SRR11389751 completed mapping pipeline successfully