Starting /dee2/code/volunteer_pipeline.sh SRR11389753 current disk space = 1547262689280 free memory = 1603496828 SRR11389753 SRAfilesize fb4c3ac1289bcd597df1b95253933c72 SRR11389753.sra SRR11389753.sra file validated SRR11389753 is paired end SRR11389753 is conventional basespace SRR11389753 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389753_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.6535 32.0 32.0 32.0 32.0 32.0 2 30.57075 32.0 32.0 32.0 32.0 32.0 3 30.6225 32.0 32.0 32.0 32.0 32.0 4 30.61825 32.0 32.0 32.0 32.0 32.0 5 30.71425 32.0 32.0 32.0 32.0 32.0 6 33.658 36.0 36.0 36.0 32.0 36.0 7 33.709 36.0 36.0 36.0 32.0 36.0 8 33.732 36.0 36.0 36.0 32.0 36.0 9 33.7395 36.0 36.0 36.0 32.0 36.0 10-11 33.72225 36.0 36.0 36.0 32.0 36.0 12-13 33.83225 36.0 36.0 36.0 32.0 36.0 14-15 33.636625 36.0 36.0 36.0 32.0 36.0 16-17 33.679625 36.0 36.0 36.0 32.0 36.0 18-19 33.768 36.0 36.0 36.0 32.0 36.0 20-21 33.694375 36.0 36.0 36.0 32.0 36.0 22-23 33.723875 36.0 36.0 36.0 32.0 36.0 24-25 33.667875 36.0 36.0 36.0 32.0 36.0 26-27 33.52825 36.0 36.0 36.0 29.5 36.0 28-29 33.422 36.0 36.0 36.0 32.0 36.0 30-31 33.376999999999995 36.0 36.0 36.0 27.0 36.0 32-33 33.39875 36.0 36.0 36.0 29.5 36.0 34-35 33.498374999999996 36.0 36.0 36.0 32.0 36.0 36-37 33.98066649707454 36.0 36.0 36.0 32.0 36.0 38-39 33.861231238870516 36.0 36.0 36.0 32.0 36.0 40-41 33.81989315695752 36.0 36.0 36.0 32.0 36.0 42-43 33.772195370134824 36.0 36.0 36.0 32.0 36.0 44-45 33.918850165352325 36.0 36.0 36.0 32.0 36.0 46-47 33.83032307300941 36.0 36.0 36.0 32.0 36.0 48-49 33.813252686449395 36.0 36.0 36.0 32.0 36.0 50-51 33.6822810030717 36.0 36.0 36.0 32.0 36.0 52-53 33.70363182303101 36.0 36.0 36.0 32.0 36.0 54-55 33.5751209574739 36.0 36.0 36.0 26.5 36.0 56-57 33.591348626701176 36.0 36.0 36.0 29.5 36.0 58-59 33.48451323354087 36.0 36.0 36.0 24.0 36.0 60-61 33.38752869166029 36.0 36.0 36.0 24.0 36.0 62-63 33.40606909940717 36.0 36.0 36.0 21.0 36.0 64-65 33.48434648021829 36.0 36.0 36.0 27.0 36.0 66-67 33.316663412365 36.0 36.0 36.0 21.0 36.0 68-69 33.34009270200582 36.0 36.0 36.0 21.0 36.0 70-71 33.44465466015098 36.0 36.0 36.0 24.0 36.0 72-73 33.329918362776056 36.0 36.0 36.0 24.0 36.0 74-75 33.497547500101305 36.0 36.0 36.0 27.0 36.0 76 32.85634328358209 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 69.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 3.0 24 16.0 25 17.0 26 42.0 27 58.0 28 83.0 29 137.0 30 181.0 31 211.0 32 327.0 33 468.0 34 863.0 35 1523.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.450267107606205 17.934367845331977 11.701857033833631 39.91350801322819 2 22.56423301958789 16.331722208089545 37.267870770796236 23.836174001526327 3 21.36860849656576 22.742304757059273 23.60722462477741 32.28186212159756 4 26.710760620707198 28.440600356143474 19.409819384380565 25.438819638768763 5 24.599338590689392 30.933604680742814 22.411600101755276 22.055456626812518 6 22.250574126052562 31.28349068639959 25.5677468742026 20.89818831334524 7 18.595777155939963 24.01424573899771 36.98804375476978 20.40193335029255 8 18.2396336809972 23.429152887306028 32.33273976087509 25.998473670821674 9 20.707199185957773 21.114220300178072 32.51081149834648 25.667769015517678 10-11 22.38616128211651 30.51386415670313 23.047570592724497 24.052403968455863 12-13 22.907657084711268 23.912490460442633 26.952429407275503 26.227423047570593 14-15 22.95853472398881 25.17171203256169 26.710760620707198 25.158992622742304 16-17 22.742304757059273 26.151106588654287 24.99364029509031 26.11294835919613 18-19 23.212922920376496 25.324344950394302 25.680488425337067 25.78224370389214 20-21 23.009412363266343 26.50725006359705 26.023912490460443 24.459425082676166 22-23 22.805901806156196 26.59628593233274 26.023912490460443 24.573899771050623 24-25 23.212922920376496 25.553294327143224 25.082676163826 26.151106588654287 26-27 22.97125413380819 25.985754261002292 25.298906130755533 25.744085474433987 28-29 23.58178580513864 25.03179852454846 25.337064360213684 26.049351310099212 30-31 22.7168659374205 26.850674128720424 26.176545408293055 24.255914525566013 32-33 23.263800559654033 25.248028491477996 25.85856016280845 25.629610786059526 34-35 24.116001017552787 26.456372424319515 24.726532688883236 24.701093869244467 36-37 23.8616128211651 25.273467311116764 26.03663190027983 24.82828796743831 38-39 22.81862121597558 25.14627321292292 25.540574917323838 26.494530653777666 40-41 23.390994657847877 25.69320783515645 25.883998982447213 25.03179852454846 42-43 24.395828033579242 25.324344950394302 24.2686339353854 26.01119308064106 44-45 22.99669295344696 25.375222589671843 25.69320783515645 25.93487662172475 46-47 23.60722462477741 25.14627321292292 25.71864665479522 25.527855507504455 48-49 23.02506042488233 25.632871135987788 25.213077216639107 26.12899122249078 50-51 22.890953047461508 24.59600458073546 25.88115536327777 26.631887008525258 52-53 22.77530235518778 25.70337364735837 25.270528325907065 26.250795671546783 54-55 23.771326712503182 24.713521772345302 25.40106951871658 26.11408199643494 56-57 22.89570864637718 24.65299885394117 27.04698841207182 25.40430408760983 58-59 22.601605300038223 25.67206013504905 25.519174417123203 26.207160147789526 60-61 22.87681713848508 24.674827850038255 25.88625350675848 26.562101504718182 62-63 22.80321387578115 25.69825277388088 26.106363984185695 25.392169366152277 64-65 23.573707721761327 23.714103382259093 26.573069559668156 26.139119336311424 66-67 22.889257887341934 24.319836505300803 26.46570443223911 26.325201175118153 68-69 23.270681498529598 24.702723436900655 25.904615778033502 26.121979286536252 70-71 23.46168606882436 25.64922604579762 25.278239733913267 25.610848151464754 72-73 24.065480794019077 23.962361433359114 25.483372003093578 26.488785769528228 74-75 24.333514689880303 22.007616974972795 27.135473340587595 26.5233949945593 76 26.119402985074625 0.0 38.09701492537314 35.78358208955224 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 69.0 1 34.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 2.0 18 6.0 19 9.5 20 10.5 21 14.0 22 16.0 23 12.0 24 8.0 25 8.0 26 15.0 27 25.0 28 27.5 29 32.5 30 42.5 31 45.5 32 51.0 33 61.0 34 71.5 35 91.0 36 114.5 37 133.5 38 149.0 39 165.0 40 175.5 41 168.5 42 166.0 43 186.5 44 205.5 45 203.5 46 199.0 47 190.5 48 180.0 49 160.5 50 136.5 51 125.5 52 116.5 53 109.5 54 101.0 55 98.5 56 102.5 57 115.0 58 116.5 59 117.0 60 119.0 61 106.0 62 103.5 63 86.5 64 62.5 65 57.5 66 57.5 67 63.5 68 63.0 69 55.0 70 45.0 71 39.0 72 38.0 73 40.5 74 38.5 75 29.0 76 22.5 77 19.0 78 13.0 79 8.0 80 6.0 81 4.0 82 3.5 83 2.5 84 2.5 85 3.0 86 3.0 87 3.0 88 2.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.725 2 1.725 3 1.725 4 1.725 5 1.725 6 2.025 7 1.725 8 1.725 9 1.725 10-11 1.725 12-13 1.725 14-15 1.725 16-17 1.725 18-19 1.725 20-21 1.725 22-23 1.725 24-25 1.725 26-27 1.725 28-29 1.725 30-31 1.725 32-33 1.725 34-35 1.725 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 69.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 1.0 49 0.0 50 1.0 51 1.0 52 1.0 53 0.0 54 0.0 55 0.0 56 1.0 57 0.0 58 3.0 59 2.0 60 0.0 61 0.0 62 1.0 63 1.0 64 3.0 65 0.0 66 3.0 67 2.0 68 1.0 69 1.0 70 1.0 71 15.0 72 28.0 73 72.0 74 234.0 75 879.0 76 2680.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.25 #Duplication Level Percentage of deduplicated Percentage of total 1 97.0026525198939 91.425 2 2.2281167108753315 4.2 3 0.5305039787798408 1.5 4 0.10610079575596816 0.4 5 0.02652519893899204 0.125 6 0.02652519893899204 0.15 7 0.02652519893899204 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02652519893899204 0.3 >50 0.02652519893899204 1.725 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 69 1.725 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 12 0.3 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 7 0.17500000000000002 No Hit CTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCA 6 0.15 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 5 0.125 TruSeq Adapter, Index 1 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389753 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389753_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.1805 32.0 32.0 32.0 21.0 32.0 2 29.824 32.0 32.0 32.0 21.0 32.0 3 29.906 32.0 32.0 32.0 21.0 32.0 4 29.7325 32.0 32.0 32.0 21.0 32.0 5 29.794 32.0 32.0 32.0 21.0 32.0 6 32.958 36.0 36.0 36.0 21.0 36.0 7 32.9415 36.0 36.0 36.0 21.0 36.0 8 33.008 36.0 36.0 36.0 21.0 36.0 9 33.05275 36.0 36.0 36.0 21.0 36.0 10-11 32.841375 36.0 36.0 36.0 17.5 36.0 12-13 32.888374999999996 36.0 36.0 36.0 17.5 36.0 14-15 32.93675 36.0 36.0 36.0 21.0 36.0 16-17 32.817375 36.0 36.0 36.0 21.0 36.0 18-19 32.795125 36.0 36.0 36.0 14.0 36.0 20-21 32.753 36.0 36.0 36.0 14.0 36.0 22-23 32.570499999999996 36.0 36.0 36.0 14.0 36.0 24-25 32.676249999999996 36.0 36.0 36.0 14.0 36.0 26-27 32.7015 36.0 36.0 36.0 14.0 36.0 28-29 32.61725 36.0 36.0 36.0 14.0 36.0 30-31 32.56675 36.0 36.0 36.0 14.0 36.0 32-33 32.567750000000004 36.0 36.0 36.0 14.0 36.0 34-35 32.6475 36.0 36.0 36.0 14.0 36.0 36-37 33.14776195320448 36.0 36.0 36.0 14.0 36.0 38-39 33.1194232245813 36.0 36.0 36.0 14.0 36.0 40-41 33.13965911981684 36.0 36.0 36.0 14.0 36.0 42-43 33.04986008649199 36.0 36.0 36.0 14.0 36.0 44-45 32.92928008140423 36.0 36.0 36.0 14.0 36.0 46-47 33.09615873823454 36.0 36.0 36.0 21.0 36.0 48-49 32.595724757149895 36.0 36.0 36.0 14.0 36.0 50-51 32.738392050499414 36.0 36.0 36.0 14.0 36.0 52-53 32.964351515462695 36.0 36.0 36.0 14.0 36.0 54-55 32.64718614718615 36.0 36.0 36.0 14.0 36.0 56-57 32.75638963036704 36.0 36.0 36.0 14.0 36.0 58-59 32.71922478937063 36.0 36.0 36.0 14.0 36.0 60-61 32.64154552410099 36.0 34.0 36.0 14.0 36.0 62-63 32.55962325442802 36.0 32.0 36.0 14.0 36.0 64-65 32.44509619071176 36.0 34.0 36.0 14.0 36.0 66-67 32.46618748443945 36.0 32.0 36.0 14.0 36.0 68-69 32.36955441732955 36.0 32.0 36.0 14.0 36.0 70-71 32.451725312007795 36.0 32.0 36.0 14.0 36.0 72-73 32.28366468584758 36.0 32.0 36.0 14.0 36.0 74-75 32.45380891538898 36.0 32.0 36.0 14.0 36.0 76 31.36747905559787 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 68.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 0.0 12 1.0 13 0.0 14 2.0 15 10.0 16 8.0 17 7.0 18 6.0 19 7.0 20 8.0 21 10.0 22 18.0 23 27.0 24 29.0 25 52.0 26 84.0 27 88.0 28 138.0 29 163.0 30 192.0 31 250.0 32 332.0 33 497.0 34 807.0 35 1194.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.626272912423623 24.745417515274948 11.838085539714868 32.79022403258656 2 31.67006109979633 22.5050916496945 27.978615071283098 17.846232179226067 3 24.46592065106816 27.339776195320447 22.965412004069176 25.228891149542214 4 27.698574338085542 31.084521384928713 18.482688391038696 22.734215885947044 5 29.50152594099695 31.71414038657172 19.506612410986776 19.277721261444558 6 21.5412004069176 35.12207527975585 21.515768056968465 21.820956256358087 7 22.100712105798575 18.209562563580874 35.09664292980671 24.593082400813834 8 23.54887983706721 21.766802443991853 25.814663951120163 28.869653767820775 9 25.279755849440487 22.380467955239062 26.246185147507628 26.09359104781282 10-11 27.362930924818723 27.222999618369165 21.434931942500953 23.979137514311155 12-13 26.31310555838858 21.519632840387555 25.025497195308517 27.141764405915346 14-15 25.844271696189626 24.518924429718364 25.11787944437365 24.518924429718364 16-17 26.71872999615926 24.79836128536679 23.863781846114453 24.61912687235949 18-19 25.967413441955195 24.834521384928717 24.198065173116092 25.0 20-21 26.698161389172625 25.10214504596527 23.876404494382022 24.32328907048008 22-23 26.34608006138893 25.348510039647014 23.916101803299654 24.389308095664408 24-25 25.891492613346916 25.509424350483954 24.17218543046358 24.426897605705552 26-27 25.947187141216993 25.475188161755323 24.097461410894248 24.480163286133436 28-29 25.52103311596983 25.26531134126071 23.130034522439587 26.083621020329883 30-31 27.122100433341828 25.490695895997963 22.71221004333418 24.674993627326025 32-33 25.765534913516973 26.021780909673286 23.830877642536834 24.3818065342729 34-35 26.47548329279222 24.81116374343874 24.491102291639997 24.222250672129046 36-37 25.536261491317667 25.42134831460674 24.297752808988765 24.744637385086822 38-39 25.91362126245847 25.159723996933298 24.086378737541526 24.8402760030667 40-41 27.74382480264833 24.06417112299465 23.618538324420676 24.57346574993634 42-43 25.17527087316762 26.093052899936264 24.25748884639898 24.47418738049713 44-45 26.580826109127997 25.12748597654258 24.23508414074452 24.056603773584907 46-47 25.51539832018325 25.617205395775006 23.924662764062102 24.942733519979637 48-49 26.305041480536058 24.35226547543076 24.19910657306956 25.143586470963626 50-51 26.122448979591837 25.535714285714285 23.877551020408163 24.46428571428571 52-53 25.62404482934284 24.89811512990321 24.57972491085074 24.89811512990321 54-55 26.598596043395023 26.07530312699426 23.203573707721763 24.122527121888957 56-57 25.918341226161523 26.19992320491489 23.6912837578395 24.190451811084092 58-59 27.574326910807706 24.741610310067628 23.440091871889752 24.24397090723491 60-61 25.178936605316977 25.191717791411044 24.220347648261757 25.408997955010225 62-63 25.928762926081962 24.79254436358994 24.16698582918422 25.11170688114388 64-65 26.038994356080043 24.576706003078503 24.01231400718317 25.371985633658284 66-67 25.201793721973093 25.035233824471494 25.137732222934016 24.625240230621394 68-69 25.987472836507735 25.89799309727726 24.824236226511566 23.290297839703438 70-71 26.356192425793246 25.102354145342886 23.490276356192428 25.051177072671443 72-73 24.65894465894466 25.74002574002574 25.637065637065636 23.963963963963963 74-75 26.08576891559683 22.903578257306748 26.39989074023491 24.610762086861513 76 27.80320366132723 0.0 35.507246376811594 36.689549961861175 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 69.0 1 34.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 1.0 14 0.0 15 0.5 16 1.5 17 2.0 18 10.0 19 12.5 20 8.5 21 12.0 22 9.5 23 5.5 24 7.5 25 8.5 26 12.5 27 17.5 28 20.5 29 27.0 30 33.5 31 41.0 32 48.5 33 49.5 34 53.0 35 77.5 36 99.0 37 110.0 38 132.0 39 138.5 40 138.0 41 153.0 42 167.0 43 176.5 44 186.5 45 187.5 46 187.5 47 181.5 48 161.0 49 147.5 50 135.5 51 119.5 52 113.0 53 113.0 54 117.5 55 116.0 56 122.5 57 127.0 58 119.0 59 117.5 60 133.5 61 139.0 62 122.5 63 114.0 64 99.5 65 84.5 66 72.5 67 66.5 68 64.0 69 57.0 70 54.0 71 53.5 72 45.0 73 39.0 74 41.5 75 39.0 76 32.0 77 21.5 78 17.5 79 21.5 80 16.0 81 8.5 82 3.5 83 1.5 84 5.0 85 5.0 86 2.0 87 1.0 88 1.5 89 1.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 3.0 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7999999999999998 2 1.7999999999999998 3 1.7000000000000002 4 1.7999999999999998 5 1.7000000000000002 6 1.7000000000000002 7 1.7000000000000002 8 1.7999999999999998 9 1.7000000000000002 10-11 1.7375000000000003 12-13 1.95 14-15 1.9124999999999999 16-17 2.3625 18-19 1.7999999999999998 20-21 2.1 22-23 2.2624999999999997 24-25 1.8499999999999999 26-27 2.0125 28-29 2.2375 30-31 1.925 32-33 2.4375 34-35 2.3625 36-37 0.40691759918616477 38-39 0.470558311077197 40-41 0.10175527855507505 42-43 0.21622996692953447 44-45 0.22894937674891885 46-47 0.05087763927753752 48-49 0.3307467243353263 50-51 0.24176103830003814 52-53 0.03819223424570337 54-55 0.24191494779730072 56-57 0.5093594804533299 58-59 0.15288571792585043 60-61 0.22953328232593728 62-63 0.10202780257620202 64-65 0.49776643267389914 66-67 0.31928480204342274 68-69 0.0 70-71 0.0 72-73 0.05145356315924878 74-75 0.0 76 0.15232292460015232 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 68.0 36 0.0 37 0.0 38 1.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 1.0 49 0.0 50 1.0 51 1.0 52 1.0 53 0.0 54 0.0 55 0.0 56 1.0 57 0.0 58 3.0 59 2.0 60 0.0 61 0.0 62 1.0 63 1.0 64 3.0 65 0.0 66 2.0 67 2.0 68 1.0 69 0.0 70 6.0 71 12.0 72 12.0 73 81.0 74 278.0 75 896.0 76 2626.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.625 #Duplication Level Percentage of deduplicated Percentage of total 1 97.04095112285337 91.825 2 2.298546895640687 4.35 3 0.42272126816380445 1.2 4 0.13210039630118892 0.5 5 0.02642007926023778 0.125 6 0.05284015852047556 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02642007926023778 1.7000000000000002 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 68 1.7000000000000002 No Hit TATCGATTAATAGATAAAACTAAATATGAAGAAGGTCTAAATAAAAAGAA 6 0.15 No Hit GGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACA 6 0.15 No Hit GGCCGATCGAGGGCATCAAGAAGTTCGAGACCCTCTCATACCTGCCCCCTCTCTCCGTGGAGTCTCTCCTGAAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1892767 spots for SRR11389753.sra Written 1892767 spots for SRR11389753.sra Read 1892776 spots for SRR11389753.sra Written 1892776 spots for SRR11389753.sra Read 1892767 spots for SRR11389753.sra Written 1892767 spots for SRR11389753.sra Read 1892767 spots for SRR11389753.sra Written 1892767 spots for SRR11389753.sra Read 1892767 spots for SRR11389753.sra Written 1892767 spots for SRR11389753.sra Read 1892767 spots for SRR11389753.sra Written 1892767 spots for SRR11389753.sra Read 1892767 spots for SRR11389753.sra Written 1892767 spots for SRR11389753.sra Read 1892767 spots for SRR11389753.sra Written 1892767 spots for SRR11389753.sra Read 1892767 spots for SRR11389753.sra Written 1892767 spots for SRR11389753.sra Read 1892767 spots for SRR11389753.sra Written 1892767 spots for SRR11389753.sra Read 1892767 spots for SRR11389753.sra Written 1892767 spots for SRR11389753.sra Read 1892767 spots for SRR11389753.sra Written 1892767 spots for SRR11389753.sra Read 1892767 spots for SRR11389753.sra Written 1892767 spots for SRR11389753.sra Read 1892767 spots for SRR11389753.sra Written 1892767 spots for SRR11389753.sra Read 1892767 spots for SRR11389753.sra Written 1892767 spots for SRR11389753.sra Read 1892767 spots for SRR11389753.sra Written 1892767 spots for SRR11389753.sra Read 1892767 spots for SRR11389753.sra Written 1892767 spots for SRR11389753.sra Read 1892767 spots for SRR11389753.sra Written 1892767 spots for SRR11389753.sra Read 1892767 spots for SRR11389753.sra Written 1892767 spots for SRR11389753.sra Read 1892767 spots for SRR11389753.sra Written 1892767 spots for SRR11389753.sra SRR ids: ['SRR11389753.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k4siq1ti SRR11389753.sra spots: 37855349 blocks: [[1, 1892767], [1892768, 3785534], [3785535, 5678301], [5678302, 7571068], [7571069, 9463835], [9463836, 11356602], [11356603, 13249369], [13249370, 15142136], [15142137, 17034903], [17034904, 18927670], [18927671, 20820437], [20820438, 22713204], [22713205, 24605971], [24605972, 26498738], [26498739, 28391505], [28391506, 30284272], [30284273, 32177039], [32177040, 34069806], [34069807, 35962573], [35962574, 37855349]] SRR11389753 file size 7171252 SRR11389753 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389753 SRR11389753_1.fastq SRR11389753_2.fastq Input file: SRR11389753_1.fastq Paired file: SRR11389753_2.fastq trimmed: SRR11389753-trimmed-pair1.fastq, SRR11389753-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 04:10:05 2024 >> started Sat Dec 7 04:10:33 2024 >> done (27.815s) 37855349 read pairs processed; of these: 2248 ( 0.01%) short read pairs filtered out after trimming by size control 803761 ( 2.12%) empty read pairs filtered out after trimming by size control 37049340 (97.87%) read pairs available; of these: 28344 ( 0.08%) trimmed read pairs available after processing 37020996 (99.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 780 0.00% 19 22 0.00% 20 1361 0.00% 21 8 0.00% 22 1559 0.00% 23 21 0.00% 24 1769 0.00% 25 26 0.00% 26 1662 0.00% 27 15 0.00% 28 1319 0.00% 29 23 0.00% 30 1042 0.00% 31 25 0.00% 32 682 0.00% 33 28 0.00% 34 545 0.00% 35 635 0.00% 36 2686 0.01% 37 827 0.00% 38 1773 0.00% 39 1070 0.00% 40 1525 0.00% 41 1290 0.00% 42 1633 0.00% 43 1701 0.00% 44 2080 0.01% 45 2189 0.01% 46 2258 0.01% 47 2592 0.01% 48 3084 0.01% 49 3120 0.01% 50 3508 0.01% 51 3893 0.01% 52 4303 0.01% 53 4486 0.01% 54 5181 0.01% 55 6361 0.02% 56 7387 0.02% 57 7753 0.02% 58 7679 0.02% 59 8307 0.02% 60 8801 0.02% 61 9013 0.02% 62 10035 0.03% 63 10733 0.03% 64 11971 0.03% 65 12771 0.03% 66 13836 0.04% 67 15340 0.04% 68 15991 0.04% 69 17394 0.05% 70 19647 0.05% 71 24318 0.07% 72 65481 0.18% 73 369048 1.00% 74 2613429 7.05% 75 16809752 45.37% 76 16923572 45.68% 37049340 reads passed initial QC criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=23 prefix-density=0.75 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=7.54 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=1.0 sequence=ATAAAACCCCTCAATGTAACACAAATACAGAGTCTTGATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTT criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=25 prefix-density=0.83 prefix-fanout=2.0 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=26 fanout-score=28.76 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=7.0 sequence=AAGAAGAAGGTGCAGACCGAGTGCGCCTCCATGCCTTTCGATGACCAATGCGCCGTCTTGGAAAAGGAGGCCGTGAACGTGTCCCTCGAGAACCTCAAGACCTACCCGTTCGTCAAGGAAGGCGTCGCCAACGGAACCCTCAAGCTCGTGGGCGGCCACTACGACTTCGTCTCCGGCAAGTTCGACACATGGGAGCTCTAAGTCCTCTCATCCGGTTAACTCCTATACATACAACGTATACTTATACATACAGATATGGAGATGACCCTACAGATCGATCCATTGATGTGGATGCGATGCCATGGAGTATATGTACTCGCTATTTTCCAGTACTGCATGCCGGATGGCTCGATGTGAATTTGTAATAAGCAATAGAAGTTTCTACCATTTTCTGACGTGGGGTTGTACTTGTGATGCGTAATTTGGTCATCTTGTGACCAAAAGACATCAACTATATAATTATAA SRR11389753 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 04:11:02 Started mapping on | Dec 07 04:11:02 Finished on | Dec 07 04:16:18 Mapping speed, Million of reads per hour | 422.08 Number of input reads | 37049340 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 27842088 Uniquely mapped reads % | 75.15% Average mapped length | 150.31 Number of splices: Total | 11518692 Number of splices: Annotated (sjdb) | 11002036 Number of splices: GT/AG | 11362762 Number of splices: GC/AG | 137585 Number of splices: AT/AC | 3176 Number of splices: Non-canonical | 15169 Mismatch rate per base, % | 0.53% Deletion rate per base | 0.01% Deletion average length | 1.63 Insertion rate per base | 0.01% Insertion average length | 1.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 4966229 % of reads mapped to multiple loci | 13.40% Number of reads mapped to too many loci | 63500 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.55% % of reads unmapped: other | 0.73% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4241034 4241034 4241034 N_multimapping 4966229 4966229 4966229 N_noFeature 962812 27010895 1251021 N_ambiguous 844176 5839 326555 UnstrandedReadsAssigned:26035100 PositiveStrandReadsAssigned:825354 NegativeStrandReadsAssigned:26264512 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389753 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389753-trimmed-pair1.fastq SRR11389753-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,049,340 reads, 31,009,338 reads pseudoaligned [quant] estimated average fragment length: 183.731 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,228 rounds 52973 SRR11389753.ke.tsv 35125 SRR11389753.se.tsv 88098 total ==> SRR11389753.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 753.314 0 0 PNS24247 1044 861.269 19.3144 0.977465 PNS24249 1928 1745.27 126.257 3.15319 PNS24246 1044 861.269 19.3144 0.977465 PNS24248 1044 861.269 19.3144 0.977465 PNS24244 1471 1288.27 46.8001 1.58343 PNS24243 293 121.886 0 0 KQK14069 1603 1420.27 1143.88 35.1049 KQK14071 474 292.571 82.5156 12.2932 ==> SRR11389753.se.tsv <== BRADI_1g14170v3 1263 BRADI_1g53295v3 22 BRADI_1g59795v3 593 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 320 BRADI_1g74790v3 383 BRADI_1g09890v3 0 BRADI_1g77505v3 293 BRADI_1g48960v3 0 SRR11389753 completed mapping pipeline successfully