Starting /dee2/code/volunteer_pipeline.sh SRR11389754 current disk space = 1547239460864 free memory = 1598146360 SRR11389754 SRAfilesize 9df274a9e03faf439fe076ef9c5b0ffe SRR11389754.sra SRR11389754.sra file validated SRR11389754 is paired end SRR11389754 is conventional basespace SRR11389754 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389754_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.74925 32.0 32.0 32.0 32.0 32.0 2 30.71775 32.0 32.0 32.0 32.0 32.0 3 30.74325 32.0 32.0 32.0 32.0 32.0 4 30.82925 32.0 32.0 32.0 32.0 32.0 5 30.8375 32.0 32.0 32.0 32.0 32.0 6 34.06475 36.0 36.0 36.0 32.0 36.0 7 34.1645 36.0 36.0 36.0 32.0 36.0 8 33.98525 36.0 36.0 36.0 32.0 36.0 9 34.03275 36.0 36.0 36.0 32.0 36.0 10-11 34.0235 36.0 36.0 36.0 32.0 36.0 12-13 34.048125 36.0 36.0 36.0 32.0 36.0 14-15 34.01075 36.0 36.0 36.0 32.0 36.0 16-17 33.967625 36.0 36.0 36.0 32.0 36.0 18-19 34.00375 36.0 36.0 36.0 32.0 36.0 20-21 33.929125 36.0 36.0 36.0 32.0 36.0 22-23 33.921499999999995 36.0 36.0 36.0 32.0 36.0 24-25 33.9075 36.0 36.0 36.0 32.0 36.0 26-27 33.823 36.0 36.0 36.0 32.0 36.0 28-29 33.603625 36.0 36.0 36.0 32.0 36.0 30-31 33.689125000000004 36.0 36.0 36.0 32.0 36.0 32-33 33.600625 36.0 36.0 36.0 32.0 36.0 34-35 33.70075 36.0 36.0 36.0 32.0 36.0 36-37 34.186565272496836 36.0 36.0 36.0 32.0 36.0 38-39 34.1467680608365 36.0 36.0 36.0 32.0 36.0 40-41 34.106083650190115 36.0 36.0 36.0 32.0 36.0 42-43 33.98212927756654 36.0 36.0 36.0 32.0 36.0 44-45 34.03903675538656 36.0 36.0 36.0 32.0 36.0 46-47 34.075918884664134 36.0 36.0 36.0 32.0 36.0 48-49 34.00773130544994 36.0 36.0 36.0 32.0 36.0 50-51 34.0126925978012 36.0 36.0 36.0 32.0 36.0 52-53 34.032724505327245 36.0 36.0 36.0 32.0 36.0 54-55 33.806924388403424 36.0 36.0 36.0 29.5 36.0 56-57 33.80964467005076 36.0 36.0 36.0 29.5 36.0 58-59 33.72794167040254 36.0 36.0 36.0 27.0 36.0 60-61 33.67796828102544 36.0 36.0 36.0 27.0 36.0 62-63 33.80248060064545 36.0 36.0 36.0 29.5 36.0 64-65 33.60057498976593 36.0 36.0 36.0 27.0 36.0 66-67 33.64654337085602 36.0 36.0 36.0 27.0 36.0 68-69 33.57614368622784 36.0 36.0 36.0 27.0 36.0 70-71 33.579928373695225 36.0 36.0 36.0 27.0 36.0 72-73 33.605775492596806 36.0 36.0 36.0 27.0 36.0 74-75 33.57045562823312 36.0 36.0 36.0 27.0 36.0 76 33.015536187949984 36.0 36.0 36.0 21.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 55.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 6.0 23 7.0 24 11.0 25 12.0 26 25.0 27 50.0 28 82.0 29 101.0 30 162.0 31 235.0 32 270.0 33 429.0 34 822.0 35 1732.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.263624841571612 21.749049429657795 10.316856780735108 39.670468948035484 2 24.94296577946768 17.0595690747782 38.09885931558936 19.898605830164765 3 19.543726235741445 23.193916349809886 24.816223067173638 32.44613434727503 4 23.979721166032952 29.911280101394173 21.140684410646386 24.96831432192649 5 24.030418250950568 32.167300380228134 22.56020278833967 21.24207858048162 6 20.503048780487802 33.079268292682926 26.448170731707314 19.96951219512195 7 16.476552598225602 25.50063371356147 37.6425855513308 20.380228136882128 8 19.138149556400506 23.219264892268697 32.77566539923954 24.866920152091254 9 20.05069708491762 22.281368821292777 32.80101394169835 24.866920152091254 10-11 21.685678073510772 31.97718631178707 23.510773130544994 22.826362484157162 12-13 21.318124207858048 25.25982256020279 26.89480354879594 26.527249683143218 14-15 21.432192648922687 27.0595690747782 26.856780735107733 24.651457541191384 16-17 22.00253485424588 26.831432192648926 26.311787072243348 24.85424588086185 18-19 21.394169835234475 26.61596958174905 26.806083650190114 25.183776932826362 20-21 22.281368821292777 26.38783269961977 26.692015209125476 24.638783269961976 22-23 22.712294043092523 26.29911280101394 26.43852978453739 24.55006337135615 24-25 21.837769328263626 26.932826362484157 26.565272496831433 24.664131812420788 26-27 22.027883396704688 27.19898605830165 27.046894803548792 23.726235741444867 28-29 22.471482889733842 27.50316856780735 25.335868187579212 24.689480354879596 30-31 22.395437262357415 27.313054499366284 26.121673003802282 24.169835234474018 32-33 22.458808618504435 26.59062103929024 26.400506970849175 24.55006337135615 34-35 23.244613434727505 26.73003802281369 26.375158428390368 23.650190114068444 36-37 23.586818757921417 26.349809885931556 25.513307984790874 24.55006337135615 38-39 22.85171102661597 26.641318124207856 25.779467680608363 24.727503168567807 40-41 22.015209125475284 26.717363751584283 26.88212927756654 24.38529784537389 42-43 24.20785804816223 26.489226869455006 25.437262357414447 23.865652724968314 44-45 22.6489226869455 25.627376425855513 26.514575411913814 25.20912547528517 46-47 22.864385297845374 26.28643852978454 25.475285171102662 25.373891001267427 48-49 21.673003802281368 26.61596958174905 26.096324461343475 25.614702154626105 50-51 23.06326866996323 26.30911626727526 26.23304171421326 24.394573348548242 52-53 23.769660071029932 25.684931506849317 25.672247590055807 24.87316083206494 54-55 22.77340776452677 26.74448109616849 25.01903070286729 25.46308043643745 56-57 22.96954314720812 25.97715736040609 26.446700507614214 24.606598984771573 58-59 22.24479431183342 27.51396648044693 25.58405281868969 24.657186389029963 60-61 22.78095238095238 26.234920634920634 25.93015873015873 25.053968253968257 62-63 22.499046650565653 25.5878988178467 26.909876700139822 25.00317783144782 64-65 23.257884028484234 25.050864699898273 27.27619532044761 24.41505595116989 66-67 23.438096449930015 25.117699452856595 25.88115536327777 25.563048733935616 68-69 22.433121019108277 25.987261146496817 27.121019108280255 24.45859872611465 70-71 23.147557709475834 26.19563831143987 25.915061854355308 24.741742124728987 72-73 23.178553104155977 25.79527963057979 25.47460236018471 25.551564905079527 74-75 23.14764737696052 23.039480800432667 27.217414818820984 26.59545700378583 76 25.956801818870783 0.0 38.044713906782874 35.998484274346346 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 61.0 1 30.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 3.0 18 8.0 19 14.5 20 14.5 21 14.5 22 24.0 23 22.0 24 16.0 25 19.5 26 25.5 27 34.5 28 35.5 29 36.0 30 47.0 31 51.0 32 66.5 33 90.5 34 105.0 35 119.5 36 141.0 37 166.5 38 175.5 39 179.5 40 179.0 41 171.0 42 166.5 43 173.0 44 188.5 45 193.0 46 187.5 47 180.5 48 182.5 49 168.5 50 147.0 51 137.5 52 119.5 53 109.5 54 107.0 55 105.0 56 94.5 57 93.5 58 101.0 59 99.5 60 81.5 61 68.5 62 70.0 63 73.0 64 69.5 65 62.0 66 59.0 67 57.0 68 56.0 69 54.0 70 47.0 71 37.0 72 30.5 73 22.0 74 19.0 75 17.0 76 16.5 77 15.5 78 12.0 79 12.0 80 10.5 81 8.0 82 4.0 83 1.5 84 2.5 85 2.0 86 1.5 87 2.0 88 1.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.375 2 1.375 3 1.375 4 1.375 5 1.375 6 1.6 7 1.375 8 1.375 9 1.375 10-11 1.375 12-13 1.375 14-15 1.375 16-17 1.375 18-19 1.375 20-21 1.375 22-23 1.375 24-25 1.375 26-27 1.375 28-29 1.375 30-31 1.375 32-33 1.375 34-35 1.375 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.012695188523549577 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.012751849018107626 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 55.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 3.0 51 0.0 52 0.0 53 0.0 54 2.0 55 0.0 56 0.0 57 1.0 58 1.0 59 0.0 60 1.0 61 3.0 62 1.0 63 0.0 64 2.0 65 0.0 66 3.0 67 2.0 68 2.0 69 2.0 70 2.0 71 13.0 72 18.0 73 60.0 74 262.0 75 928.0 76 2639.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.875 #Duplication Level Percentage of deduplicated Percentage of total 1 97.99217731421122 93.95 2 1.5384615384615385 2.9499999999999997 3 0.2607561929595828 0.75 4 0.10430247718383312 0.4 5 0.02607561929595828 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.05215123859191656 0.44999999999999996 >10 0.0 0.0 >50 0.02607561929595828 1.375 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 55 1.375 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 9 0.22499999999999998 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 9 0.22499999999999998 No Hit ATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTTCTCTTTTTATTTTGTTTCTTTTTATTTAGACCTTCTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389754 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389754_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.38675 32.0 32.0 32.0 32.0 32.0 2 30.04975 32.0 32.0 32.0 21.0 32.0 3 29.9885 32.0 32.0 32.0 21.0 32.0 4 30.036 32.0 32.0 32.0 21.0 32.0 5 30.119 32.0 32.0 32.0 21.0 32.0 6 33.08325 36.0 36.0 36.0 21.0 36.0 7 33.36775 36.0 36.0 36.0 21.0 36.0 8 33.23825 36.0 36.0 36.0 21.0 36.0 9 33.34525 36.0 36.0 36.0 21.0 36.0 10-11 33.209625 36.0 36.0 36.0 21.0 36.0 12-13 33.30825 36.0 36.0 36.0 21.0 36.0 14-15 33.2495 36.0 36.0 36.0 21.0 36.0 16-17 33.201625 36.0 36.0 36.0 21.0 36.0 18-19 33.11625 36.0 36.0 36.0 21.0 36.0 20-21 33.114375 36.0 36.0 36.0 21.0 36.0 22-23 33.051 36.0 36.0 36.0 21.0 36.0 24-25 33.05275 36.0 36.0 36.0 21.0 36.0 26-27 33.058125000000004 36.0 36.0 36.0 21.0 36.0 28-29 33.056375 36.0 36.0 36.0 21.0 36.0 30-31 33.051500000000004 36.0 36.0 36.0 17.5 36.0 32-33 32.95075 36.0 36.0 36.0 14.0 36.0 34-35 32.905125 36.0 36.0 36.0 14.0 36.0 36-37 33.394069944247335 36.0 36.0 36.0 24.0 36.0 38-39 33.37138874809934 36.0 36.0 36.0 24.0 36.0 40-41 33.36720729853016 36.0 36.0 36.0 21.0 36.0 42-43 33.23834262544349 36.0 36.0 36.0 17.5 36.0 44-45 33.176507856056766 36.0 36.0 36.0 17.5 36.0 46-47 33.216294982260514 36.0 36.0 36.0 21.0 36.0 48-49 32.91763811454638 36.0 36.0 36.0 14.0 36.0 50-51 33.140179055175906 36.0 36.0 36.0 21.0 36.0 52-53 33.21019269776876 36.0 36.0 36.0 21.0 36.0 54-55 32.96611747622473 36.0 36.0 36.0 17.5 36.0 56-57 33.02029426686961 36.0 36.0 36.0 17.5 36.0 58-59 32.92742672052366 36.0 36.0 36.0 14.0 36.0 60-61 32.79932820693237 36.0 34.0 36.0 14.0 36.0 62-63 32.77722891496219 36.0 32.0 36.0 14.0 36.0 64-65 32.77169972915259 36.0 34.0 36.0 14.0 36.0 66-67 32.829804125606046 36.0 32.0 36.0 14.0 36.0 68-69 32.64174557470018 36.0 32.0 36.0 17.5 36.0 70-71 32.84131889379955 36.0 32.0 36.0 17.5 36.0 72-73 32.58023991480749 36.0 32.0 36.0 14.0 36.0 74-75 32.71710225503985 36.0 32.0 36.0 14.0 36.0 76 31.80838095238095 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 54.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 5.0 15 4.0 16 6.0 17 3.0 18 5.0 19 7.0 20 7.0 21 10.0 22 19.0 23 24.0 24 29.0 25 47.0 26 69.0 27 79.0 28 108.0 29 163.0 30 188.0 31 238.0 32 310.0 33 432.0 34 862.0 35 1329.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.216332741567335 27.567841744864317 10.068475779863048 33.1473497337053 2 32.031448135937104 21.607912756784174 30.35759573928481 16.003043367993914 3 22.453117080587937 28.71262037506336 23.66953877344146 25.164723770907248 4 25.862068965517242 32.4290060851927 18.81338742393509 22.89553752535497 5 27.293461733400914 33.730359858084135 19.842878864673086 19.133299543841865 6 21.16066903193107 35.55499239736442 22.149011657374558 21.135326913329955 7 22.529143436391283 19.26001013684744 35.80841358337557 22.402432843385707 8 21.122112211221122 22.72150291952272 27.31657781162732 28.839807057628843 9 23.82159148504815 22.883933096806892 27.977698935631018 25.316776482513937 10-11 27.01469842878865 28.10440952863659 20.7932083122149 24.087683730359856 12-13 25.77084126379901 23.017383580763862 25.479000126887453 25.732775028549675 14-15 24.403553299492387 25.97715736040609 25.076142131979694 24.543147208121827 16-17 25.89955499046408 24.933248569612207 25.111252383979654 24.055944055944057 18-19 25.412541254125415 26.199543031226202 24.777862401624777 23.61005331302361 20-21 25.49218849231551 25.7716245395656 24.946018036326688 23.790168931792202 22-23 25.492438683441353 26.36929724234337 24.297877748125558 23.840386326089718 24-25 25.34246575342466 25.405885337392185 24.65753424657534 24.594114662607815 26-27 25.406091370558375 26.053299492385783 23.997461928934012 24.543147208121827 28-29 25.552731893265566 26.11181702668361 23.621346886912324 24.7141041931385 30-31 24.927058226563492 26.893314727895472 24.16592667766079 24.013700367880247 32-33 24.901437110517612 26.122345160880073 25.84255373267201 23.133663995930306 34-35 25.623092573753816 25.69938962360122 24.61851475076297 24.059003051881994 36-37 25.02857142857143 25.371428571428574 24.914285714285715 24.685714285714287 38-39 24.61890243902439 26.82926829268293 25.114329268292686 23.4375 40-41 24.733637747336378 26.128868594622016 24.949264332825976 24.188229325215627 42-43 24.914372700748448 25.916529240137002 24.343524039071422 24.82557402004313 44-45 25.802359507801597 26.03069897247241 24.62260560700241 23.544335912723582 46-47 25.89727330374128 25.732403297400126 23.96956246036779 24.400760938490805 48-49 25.307936507936507 25.015873015873012 25.434920634920633 24.24126984126984 50-51 25.39057538422457 26.089165502349804 24.514162326940177 24.006096786485458 52-53 26.24572080639026 25.04120704957525 24.800304298212247 23.912767845822238 54-55 25.450850901701806 26.428752857505717 24.853949707899417 23.266446532893063 56-57 25.540574917323838 26.51996947341643 24.980920885270923 22.95853472398881 58-59 26.96557855963419 25.720817985520135 24.526863965451543 22.78673948939413 60-61 26.19471276054906 25.34316217590239 25.495678698525676 22.96644636502288 62-63 25.798244498155455 25.849128609591652 25.353008523088665 22.999618369164228 64-65 25.643968375414435 25.261412904871207 25.694975771486867 23.39964294822749 66-67 25.111536010197575 26.15678776290631 24.48693435309114 24.24474187380497 68-69 24.9745287824758 26.00611309220581 25.31839021905247 23.70096790626592 70-71 25.60244804284075 25.513196480938415 25.959454290450086 22.92490118577075 72-73 25.972525356271664 25.266401335216333 25.343433046604186 23.417640261907817 74-75 24.56785082346536 22.92092010344358 27.085885395399483 25.425343677691576 76 27.61250953470633 0.0 36.65141113653699 35.736079328756674 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 58.0 1 30.0 2 1.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 1.0 11 1.5 12 2.0 13 2.5 14 2.0 15 1.5 16 3.0 17 4.5 18 7.0 19 11.0 20 13.5 21 15.5 22 16.0 23 11.5 24 8.0 25 13.0 26 21.0 27 24.5 28 24.0 29 21.5 30 33.0 31 55.0 32 66.0 33 65.5 34 72.0 35 86.5 36 97.5 37 117.5 38 135.5 39 151.0 40 155.0 41 162.0 42 181.5 43 183.5 44 172.5 45 166.5 46 173.0 47 179.5 48 165.0 49 150.0 50 156.0 51 146.0 52 130.0 53 121.0 54 109.5 55 113.0 56 122.5 57 110.0 58 94.0 59 107.0 60 107.0 61 90.5 62 88.0 63 85.0 64 81.0 65 80.5 66 79.5 67 71.5 68 63.5 69 61.5 70 52.5 71 43.5 72 43.0 73 42.5 74 34.5 75 25.5 76 23.5 77 19.0 78 15.0 79 13.0 80 8.5 81 5.0 82 3.5 83 2.0 84 1.0 85 2.5 86 4.0 87 3.0 88 1.5 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 1.425 3 1.35 4 1.4000000000000001 5 1.35 6 1.35 7 1.35 8 1.525 9 1.35 10-11 1.35 12-13 1.4874999999999998 14-15 1.5 16-17 1.6875 18-19 1.525 20-21 1.5875 22-23 1.6375000000000002 24-25 1.4500000000000002 26-27 1.5 28-29 1.625 30-31 1.4625000000000001 32-33 1.7125000000000001 34-35 1.7000000000000002 36-37 0.21540800810947794 38-39 0.25342118601115055 40-41 0.10136847440446022 42-43 0.11403953370501775 44-45 0.11403953370501775 46-47 0.0886974151039027 48-49 0.21540800810947794 50-51 0.21546261089987326 52-53 0.012677484787018255 54-55 0.1521683996956632 56-57 0.27904616945712835 58-59 0.10150996066489024 60-61 0.13961162584084275 62-63 0.10166476045240819 64-65 0.30511060259344014 66-67 0.21622996692953447 68-69 0.025464731347084286 70-71 0.025493945188017845 72-73 0.05132811497497754 74-75 0.027214587018641993 76 0.1142857142857143 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 54.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 2.0 51 0.0 52 0.0 53 0.0 54 2.0 55 0.0 56 0.0 57 1.0 58 1.0 59 0.0 60 1.0 61 4.0 62 1.0 63 0.0 64 2.0 65 0.0 66 2.0 67 2.0 68 2.0 69 1.0 70 5.0 71 11.0 72 25.0 73 81.0 74 257.0 75 921.0 76 2625.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.21474773609314 94.89999999999999 2 1.500646830530401 2.9000000000000004 3 0.15523932729624837 0.44999999999999996 4 0.1034928848641656 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0258732212160414 1.35 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 54 1.35 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 976993 spots for SRR11389754.sra Written 976993 spots for SRR11389754.sra Read 976993 spots for SRR11389754.sra Written 976993 spots for SRR11389754.sra Read 976993 spots for SRR11389754.sra Written 976993 spots for SRR11389754.sra Read 976993 spots for SRR11389754.sra Written 976993 spots for SRR11389754.sra Read 976993 spots for SRR11389754.sra Written 976993 spots for SRR11389754.sra Read 976993 spots for SRR11389754.sra Written 976993 spots for SRR11389754.sra Read 976993 spots for SRR11389754.sra Written 976993 spots for SRR11389754.sra Read 976993 spots for SRR11389754.sra Written 976993 spots for SRR11389754.sra Read 976993 spots for SRR11389754.sra Written 976993 spots for SRR11389754.sra Read 976993 spots for SRR11389754.sra Written 976993 spots for SRR11389754.sra Read 976993 spots for SRR11389754.sra Written 976993 spots for SRR11389754.sra Read 976993 spots for SRR11389754.sra Written 976993 spots for SRR11389754.sra Read 977012 spots for SRR11389754.sra Written 977012 spots for SRR11389754.sra Read 976993 spots for SRR11389754.sra Written 976993 spots for SRR11389754.sra Read 976993 spots for SRR11389754.sra Written 976993 spots for SRR11389754.sra Read 976993 spots for SRR11389754.sra Written 976993 spots for SRR11389754.sra Read 976993 spots for SRR11389754.sra Written 976993 spots for SRR11389754.sra Read 976993 spots for SRR11389754.sra Written 976993 spots for SRR11389754.sra Read 976993 spots for SRR11389754.sra Written 976993 spots for SRR11389754.sra Read 976993 spots for SRR11389754.sra Written 976993 spots for SRR11389754.sra SRR ids: ['SRR11389754.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u3dlmg_o SRR11389754.sra spots: 19539879 blocks: [[1, 976993], [976994, 1953986], [1953987, 2930979], [2930980, 3907972], [3907973, 4884965], [4884966, 5861958], [5861959, 6838951], [6838952, 7815944], [7815945, 8792937], [8792938, 9769930], [9769931, 10746923], [10746924, 11723916], [11723917, 12700909], [12700910, 13677902], [13677903, 14654895], [14654896, 15631888], [15631889, 16608881], [16608882, 17585874], [17585875, 18562867], [18562868, 19539879]] SRR11389754 file size 3694924 SRR11389754 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389754 SRR11389754_1.fastq SRR11389754_2.fastq Input file: SRR11389754_1.fastq Paired file: SRR11389754_2.fastq trimmed: SRR11389754-trimmed-pair1.fastq, SRR11389754-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 04:21:37 2024 >> started Sat Dec 7 04:21:52 2024 >> done (15.422s) 19539879 read pairs processed; of these: 1134 ( 0.01%) short read pairs filtered out after trimming by size control 344400 ( 1.76%) empty read pairs filtered out after trimming by size control 19194345 (98.23%) read pairs available; of these: 26174 ( 0.14%) trimmed read pairs available after processing 19168171 (99.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1321 0.01% 19 5 0.00% 20 1464 0.01% 21 5 0.00% 22 1736 0.01% 23 17 0.00% 24 2063 0.01% 25 9 0.00% 26 2245 0.01% 27 24 0.00% 28 1676 0.01% 29 20 0.00% 30 1468 0.01% 31 36 0.00% 32 1008 0.01% 33 29 0.00% 34 752 0.00% 35 336 0.00% 36 1297 0.01% 37 408 0.00% 38 903 0.00% 39 547 0.00% 40 821 0.00% 41 725 0.00% 42 907 0.00% 43 893 0.00% 44 1096 0.01% 45 1236 0.01% 46 1270 0.01% 47 1560 0.01% 48 1719 0.01% 49 1887 0.01% 50 2084 0.01% 51 2409 0.01% 52 2497 0.01% 53 2796 0.01% 54 2967 0.02% 55 3806 0.02% 56 4103 0.02% 57 4362 0.02% 58 4824 0.03% 59 5125 0.03% 60 5789 0.03% 61 5939 0.03% 62 6612 0.03% 63 7145 0.04% 64 7784 0.04% 65 8346 0.04% 66 9221 0.05% 67 10298 0.05% 68 10787 0.06% 69 11600 0.06% 70 13106 0.07% 71 15934 0.08% 72 32195 0.17% 73 188622 0.98% 74 1410663 7.35% 75 8854571 46.13% 76 8531277 44.45% 19194345 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=25 prefix-density=0.56 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=122.40 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=15.8 sequence=AAAAAAAAAGATTGAGCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTTCTCTTTTTATTT criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=19 prefix-density=0.55 prefix-fanout=2.1 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGGCAAGGCCTAAGCAAGTTGATTTCTTATAATACAAGAACGGGTCACACCGATTTTATGTACCTTTTTCACACGTTTGTTTCATGTTGTATTTATGCATGTGATCTCTCCCAACAACCCGGATTAACTGTATTCATGAGTACTACTATTATAAGAGTACTACAACTATCGTTGGGAGAGGGGCATGTAATATAAACTCCGGTTATACATATTAAGATAAGTATATTTTGTAAAAGAATATCAAATTCGTCGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=11.69 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.4 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC SRR11389754 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 04:22:23 Started mapping on | Dec 07 04:22:23 Finished on | Dec 07 04:26:08 Mapping speed, Million of reads per hour | 307.11 Number of input reads | 19194345 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 14417352 Uniquely mapped reads % | 75.11% Average mapped length | 150.23 Number of splices: Total | 5170738 Number of splices: Annotated (sjdb) | 4895260 Number of splices: GT/AG | 5100114 Number of splices: GC/AG | 60444 Number of splices: AT/AC | 1632 Number of splices: Non-canonical | 8548 Mismatch rate per base, % | 0.50% Deletion rate per base | 0.01% Deletion average length | 1.65 Insertion rate per base | 0.01% Insertion average length | 1.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1919635 % of reads mapped to multiple loci | 10.00% Number of reads mapped to too many loci | 44636 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.61% % of reads unmapped: other | 1.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2857363 2857363 2857363 N_multimapping 1919635 1919635 1919635 N_noFeature 651413 13925073 814557 N_ambiguous 426634 2905 109520 UnstrandedReadsAssigned:13339305 PositiveStrandReadsAssigned:489374 NegativeStrandReadsAssigned:13493275 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389754 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389754-trimmed-pair1.fastq SRR11389754-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,194,345 reads, 15,014,435 reads pseudoaligned [quant] estimated average fragment length: 177.085 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,124 rounds 52973 SRR11389754.ke.tsv 35125 SRR11389754.se.tsv 88098 total ==> SRR11389754.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 760.017 0 0 PNS24247 1044 867.915 14.8499 1.49758 PNS24249 1928 1751.91 38.2086 1.90894 PNS24246 1044 867.915 14.8499 1.49758 PNS24248 1044 867.915 14.8499 1.49758 PNS24244 1471 1294.91 97.2417 6.57286 PNS24243 293 126.753 0 0 KQK14069 1603 1426.91 714.207 43.8096 KQK14071 474 299.227 16.8605 4.9319 ==> SRR11389754.se.tsv <== BRADI_1g14170v3 784 BRADI_1g53295v3 31 BRADI_1g59795v3 803 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 204 BRADI_1g74790v3 150 BRADI_1g09890v3 0 BRADI_1g77505v3 371 BRADI_1g48960v3 0 SRR11389754 completed mapping pipeline successfully