Starting /dee2/code/volunteer_pipeline.sh SRR11389755 current disk space = 1547124363264 free memory = 1601186844 SRR11389755 SRAfilesize e311fa251a67ccdf85ac5bb592e1e617 SRR11389755.sra SRR11389755.sra file validated SRR11389755 is paired end SRR11389755 is conventional basespace SRR11389755 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389755_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.546 32.0 32.0 32.0 32.0 32.0 2 30.53325 32.0 32.0 32.0 32.0 32.0 3 30.563 32.0 32.0 32.0 32.0 32.0 4 30.63925 32.0 32.0 32.0 32.0 32.0 5 30.666 32.0 32.0 32.0 32.0 32.0 6 33.80525 36.0 36.0 36.0 32.0 36.0 7 33.7635 36.0 36.0 36.0 32.0 36.0 8 33.64425 36.0 36.0 36.0 32.0 36.0 9 33.73375 36.0 36.0 36.0 32.0 36.0 10-11 33.804375 36.0 36.0 36.0 32.0 36.0 12-13 33.836375000000004 36.0 36.0 36.0 32.0 36.0 14-15 33.690875000000005 36.0 36.0 36.0 32.0 36.0 16-17 33.600875 36.0 36.0 36.0 32.0 36.0 18-19 33.743125 36.0 36.0 36.0 32.0 36.0 20-21 33.657125 36.0 36.0 36.0 32.0 36.0 22-23 33.690125 36.0 36.0 36.0 32.0 36.0 24-25 33.585125 36.0 36.0 36.0 32.0 36.0 26-27 33.530249999999995 36.0 36.0 36.0 29.5 36.0 28-29 33.44725 36.0 36.0 36.0 29.5 36.0 30-31 33.30725 36.0 36.0 36.0 24.0 36.0 32-33 33.409375 36.0 36.0 36.0 29.5 36.0 34-35 33.400625 36.0 36.0 36.0 27.0 36.0 36-37 34.06995675400661 36.0 36.0 36.0 32.0 36.0 38-39 33.910318580759835 36.0 36.0 36.0 32.0 36.0 40-41 33.81157760814249 36.0 36.0 36.0 32.0 36.0 42-43 33.91297709923664 36.0 36.0 36.0 32.0 36.0 44-45 33.80582622076204 36.0 36.0 36.0 32.0 36.0 46-47 33.86383303639603 36.0 36.0 36.0 32.0 36.0 48-49 33.75120895902265 36.0 36.0 36.0 32.0 36.0 50-51 33.725375413591244 36.0 36.0 36.0 29.5 36.0 52-53 33.711229946524064 36.0 36.0 36.0 32.0 36.0 54-55 33.59154570919277 36.0 36.0 36.0 29.5 36.0 56-57 33.613572701807996 36.0 36.0 36.0 27.0 36.0 58-59 33.50032184410836 36.0 36.0 36.0 27.0 36.0 60-61 33.44854814060112 36.0 36.0 36.0 24.0 36.0 62-63 33.60089171974522 36.0 36.0 36.0 27.0 36.0 64-65 33.48661066290422 36.0 36.0 36.0 27.0 36.0 66-67 33.35819663280917 36.0 36.0 36.0 21.0 36.0 68-69 33.39866820931677 36.0 36.0 36.0 24.0 36.0 70-71 33.46463045701218 36.0 36.0 36.0 27.0 36.0 72-73 33.31722519034948 36.0 36.0 36.0 24.0 36.0 74-75 33.193153977366464 36.0 36.0 36.0 20.5 36.0 76 32.868040491684745 36.0 36.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 69.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 2.0 23 7.0 24 5.0 25 16.0 26 31.0 27 59.0 28 95.0 29 151.0 30 170.0 31 225.0 32 297.0 33 475.0 34 869.0 35 1526.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.36895674300254 15.674300254452927 10.661577608142494 38.295165394402034 2 24.726532688883236 16.00101755278555 35.385398117527345 23.887051640803865 3 20.707199185957773 22.691427117781735 23.403714067667263 33.197659628593236 4 25.79496311371152 28.771305011447467 19.104553548715337 26.329178326125668 5 26.532688883235817 30.65377766471636 22.7168659374205 20.09666751462732 6 23.28836854161364 31.2802239755663 23.975566301857977 21.455841180962075 7 19.206308827270416 24.090562197914018 35.181887560417195 21.521241414398375 8 20.325616891376242 22.76774357669804 31.137115237852964 25.769524294072752 9 19.74052403968456 20.681760366319 32.84151615365047 26.73619944034597 10-11 22.983973543627574 29.776138387178836 22.538794199949123 24.701093869244467 12-13 24.395828033579242 22.424319511574666 25.75680488425337 27.423047570592722 14-15 23.11116764182142 25.06995675400661 26.36733655558382 25.451539048588145 16-17 23.772576952429407 24.599338590689392 25.79496311371152 25.83312134316968 18-19 23.187484100737727 24.28135334520478 25.744085474433987 26.787077079623504 20-21 24.090562197914018 25.502416687865683 25.184431442381072 25.222589671839224 22-23 24.052403968455863 24.980920885270923 25.705927244975836 25.260747901297382 24-25 23.390994657847877 25.71864665479522 25.019079114729077 25.87127957262783 26-27 23.187484100737727 26.201984227931824 25.248028491477996 25.362503179852453 28-29 24.751971508522004 25.197150852200455 24.815568557618928 25.235309081658613 30-31 23.658102264054946 25.61689137624014 25.17171203256169 25.553294327143224 32-33 23.37827524802849 25.82040193335029 25.93487662172475 24.86644619689646 34-35 24.306792164843554 25.349783770033067 25.260747901297382 25.082676163826 36-37 23.848893411345713 24.879165606715848 24.879165606715848 26.392775375222588 38-39 24.348047322223636 24.984098715176188 24.984098715176188 25.68375524742399 40-41 23.536895674300254 24.580152671755727 26.42493638676845 25.458015267175572 42-43 23.37150127226463 24.465648854961835 25.674300254452927 26.48854961832061 44-45 23.15816261610892 24.723247232472325 25.15587224837766 26.9627179030411 46-47 25.222702977856958 23.911936879613133 25.617205395775006 25.248154746754896 48-49 23.81012980402138 24.395520488673963 25.40086536014253 26.393484347162126 50-51 23.402901501654366 24.726393484347163 25.59175362687707 26.278951387121406 52-53 24.115100585688822 24.306086070791952 24.05143875732111 27.527374586198118 54-55 23.618538324420676 25.42653425006366 24.815380697733637 26.13954672778202 56-57 23.40208810797046 25.120957473898653 25.413801884390118 26.06315253374077 58-59 24.617931737137035 24.490575649516046 24.796230259806418 26.095262353540498 60-61 24.095771777890985 24.88537952114111 25.45848191543556 25.560366785532345 62-63 24.38216560509554 24.114649681528665 25.019108280254777 26.484076433121018 64-65 24.40112130479103 24.19724770642202 25.560652395514783 25.840978593272173 66-67 24.06273909716909 24.39428717163989 25.057383320581483 26.48559041060954 68-69 24.677645857270523 24.35848333971658 24.767011362185627 26.196859440827268 70-71 23.738341637920023 24.747668327584005 25.578126996294877 25.935863038201102 72-73 24.355851813870018 23.83027816946545 24.77887450326881 27.03499551339572 74-75 24.451030580627776 22.026134985854775 25.784723157752932 27.738111275764517 76 28.12725958062184 0.0 35.97252349963846 35.9002169197397 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 70.0 1 35.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.0 17 2.5 18 6.5 19 9.0 20 10.0 21 15.0 22 19.0 23 15.0 24 10.5 25 12.0 26 16.0 27 25.5 28 27.0 29 21.0 30 26.5 31 30.0 32 38.0 33 59.5 34 60.5 35 62.0 36 88.5 37 114.0 38 134.0 39 139.5 40 141.0 41 153.0 42 165.0 43 176.5 44 198.5 45 206.5 46 196.0 47 182.5 48 174.5 49 168.5 50 153.0 51 140.5 52 123.0 53 116.5 54 120.5 55 125.0 56 129.5 57 132.0 58 137.0 59 130.0 60 124.5 61 118.5 62 112.5 63 104.0 64 88.5 65 78.0 66 68.5 67 63.0 68 57.0 69 48.0 70 45.0 71 51.5 72 53.0 73 35.5 74 29.0 75 36.5 76 29.0 77 21.0 78 15.0 79 9.5 80 9.5 81 8.0 82 4.5 83 3.5 84 2.5 85 2.5 86 1.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7500000000000002 2 1.725 3 1.725 4 1.725 5 1.725 6 1.775 7 1.725 8 1.725 9 1.725 10-11 1.725 12-13 1.725 14-15 1.725 16-17 1.725 18-19 1.725 20-21 1.725 22-23 1.725 24-25 1.725 26-27 1.725 28-29 1.725 30-31 1.725 32-33 1.725 34-35 1.725 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.012733987011333249 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.012774655084312725 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 69.0 36 0.0 37 0.0 38 1.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 1.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 2.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 2.0 65 1.0 66 2.0 67 3.0 68 1.0 69 1.0 70 2.0 71 6.0 72 13.0 73 56.0 74 253.0 75 819.0 76 2766.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.875 #Duplication Level Percentage of deduplicated Percentage of total 1 96.61784287616511 90.7 2 2.5299600532623168 4.75 3 0.559254327563249 1.575 4 0.15978695073235685 0.6 5 0.07989347536617843 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02663115845539281 0.27499999999999997 >50 0.02663115845539281 1.725 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 69 1.725 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 11 0.27499999999999997 No Hit CCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATTT 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 5 0.125 TruSeq Adapter, Index 3 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 5 0.125 TruSeq Adapter, Index 3 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389755 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389755_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.27 32.0 32.0 32.0 32.0 32.0 2 29.99 32.0 32.0 32.0 21.0 32.0 3 29.89875 32.0 32.0 32.0 21.0 32.0 4 29.90575 32.0 32.0 32.0 21.0 32.0 5 29.8875 32.0 32.0 32.0 21.0 32.0 6 32.81075 36.0 36.0 36.0 21.0 36.0 7 33.21275 36.0 36.0 36.0 21.0 36.0 8 33.01975 36.0 36.0 36.0 21.0 36.0 9 32.983 36.0 36.0 36.0 21.0 36.0 10-11 32.862125 36.0 36.0 36.0 17.5 36.0 12-13 33.155874999999995 36.0 36.0 36.0 21.0 36.0 14-15 33.044875000000005 36.0 36.0 36.0 21.0 36.0 16-17 32.950625 36.0 36.0 36.0 21.0 36.0 18-19 32.931625 36.0 36.0 36.0 17.5 36.0 20-21 32.794250000000005 36.0 36.0 36.0 14.0 36.0 22-23 32.72625 36.0 36.0 36.0 14.0 36.0 24-25 32.762249999999995 36.0 36.0 36.0 14.0 36.0 26-27 32.772625000000005 36.0 36.0 36.0 14.0 36.0 28-29 32.715374999999995 36.0 36.0 36.0 14.0 36.0 30-31 32.699875000000006 36.0 36.0 36.0 14.0 36.0 32-33 32.65275 36.0 36.0 36.0 14.0 36.0 34-35 32.684875 36.0 36.0 36.0 14.0 36.0 36-37 33.18990078860341 36.0 36.0 36.0 14.0 36.0 38-39 33.04988307142701 36.0 36.0 36.0 14.0 36.0 40-41 33.23771952150675 36.0 36.0 36.0 17.5 36.0 42-43 33.12865869177908 36.0 36.0 36.0 14.0 36.0 44-45 32.990564573107484 36.0 36.0 36.0 14.0 36.0 46-47 32.98905295315682 36.0 36.0 36.0 14.0 36.0 48-49 32.822174134419555 36.0 36.0 36.0 14.0 36.0 50-51 32.96741344195519 36.0 36.0 36.0 14.0 36.0 52-53 32.95606214977076 36.0 36.0 36.0 17.5 36.0 54-55 32.78120224146714 36.0 36.0 36.0 14.0 36.0 56-57 32.87035150280184 36.0 36.0 36.0 14.0 36.0 58-59 32.78805536177241 36.0 36.0 36.0 14.0 36.0 60-61 32.7712101910828 36.0 34.0 36.0 14.0 36.0 62-63 32.59454638124363 36.0 32.0 36.0 14.0 36.0 64-65 32.651844115190144 36.0 34.0 36.0 14.0 36.0 66-67 32.563924452812884 36.0 32.0 36.0 14.0 36.0 68-69 32.49178056177158 36.0 32.0 36.0 14.0 36.0 70-71 32.565083604337865 36.0 32.0 36.0 14.0 36.0 72-73 32.3560163982863 36.0 32.0 36.0 14.0 36.0 74-75 32.57702679297068 36.0 32.0 36.0 14.0 36.0 76 31.673937570515232 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 69.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 8.0 16 11.0 17 5.0 18 6.0 19 1.0 20 8.0 21 8.0 22 11.0 23 20.0 24 35.0 25 67.0 26 71.0 27 85.0 28 119.0 29 160.0 30 211.0 31 254.0 32 309.0 33 491.0 34 875.0 35 1174.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.36729495669893 22.185430463576157 11.20733571064697 33.23993886907794 2 33.12961548255666 22.587216704863764 27.27272727272727 17.010440539852304 3 24.93638676844784 27.480916030534353 21.34860050890585 26.234096692111958 4 28.23319755600815 32.56109979633401 18.380855397148675 20.824847250509166 5 30.348511829051134 32.20554566268125 18.951920630882725 18.49402187738489 6 23.327397608750957 34.87662172475197 20.630882727041467 21.16509793945561 7 22.58967183922666 17.908929025693208 35.461714576443654 24.03968455863648 8 24.07737337744973 22.0666836345126 23.873759226266227 29.98218376177144 9 25.337064360213684 22.538794199949123 25.489697278046297 26.634444161790892 10-11 27.41381503625493 28.469660348556165 19.335962345757537 24.780562269431368 12-13 27.61650114591291 22.001527883880826 23.605805958747137 26.77616501145913 14-15 26.311099796334013 24.198065173116092 23.867107942973522 25.623727087576377 16-17 27.35391681551416 24.521561622862976 22.914008675682574 25.21051288594029 18-19 26.406210231611098 24.802748791040976 23.911936879613133 24.879104097734793 20-21 27.228731533367295 25.10188487009679 23.166072338257766 24.503311258278146 22-23 27.253027405991077 25.162523900573614 22.24346717654557 25.340981516889737 24-25 26.39949109414758 25.979643765903308 22.786259541984734 24.834605597964376 26-27 27.09209017959496 25.41077569736339 22.404789198828176 25.092344924213478 28-29 26.38623326959847 24.219247928616955 24.38495857233907 25.009560229445505 30-31 26.34593356242841 24.80590556191931 23.609520173094054 25.23864070255823 32-33 25.928288886053334 24.10361107566671 24.090851090978692 25.87724894730126 34-35 26.552735620456573 25.149853335033796 22.586404795306724 25.711006249202907 36-37 26.51293158364123 24.49993629761753 23.990317237864698 24.996814880876546 38-39 27.444231994901212 24.62715105162524 22.893562778840028 25.035054174633526 40-41 26.960285132382893 24.707230142566193 22.479633401221996 25.85285132382892 42-43 26.996052464026487 25.175092321405835 22.73016681522985 25.09868839933783 44-45 26.642893530310747 25.292919001528276 22.796739684156904 25.267447784004077 46-47 26.90348866819455 24.840845429080723 22.765469824293355 25.49019607843137 48-49 27.105900344080542 23.88173824391487 23.7415572830381 25.270804128966486 50-51 26.643730886850154 24.350152905198776 23.572884811416923 25.43323139653415 52-53 26.292993630573246 25.044585987261147 23.46496815286624 25.197452229299362 54-55 27.36077481840194 25.156110615521854 22.849496622913215 24.633617943162992 56-57 26.05256442970145 25.784638938504724 22.93952538912988 25.223271242663948 58-59 26.710844908882375 24.6718491143112 23.996431757359503 24.62087421944692 60-61 27.31097794211399 24.90118577075099 23.039653193930896 24.748183093204133 62-63 25.799872530274058 25.340981516889737 23.747609942638622 25.111536010197575 64-65 27.462000255460467 23.489589985949674 23.349086728828713 25.699323029761146 66-67 27.208886618998978 26.378958120531156 22.433605720122575 23.978549540347295 68-69 26.817426855755716 25.156509518333976 23.48281589370129 24.54324773220902 70-71 26.24903920061491 24.455547015116576 24.570842941327182 24.724570842941326 72-73 26.977164236872664 24.848406657205523 23.326022448716294 24.848406657205523 74-75 27.563230894751158 21.988033723143868 24.43568126189829 26.01305412020669 76 28.227324049680092 0.0 35.15242754986827 36.620248400451636 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 71.0 1 35.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 4.5 19 8.0 20 8.0 21 10.5 22 8.0 23 3.5 24 7.0 25 12.0 26 13.0 27 11.0 28 11.5 29 17.0 30 22.5 31 28.0 32 37.5 33 44.5 34 48.5 35 75.0 36 99.5 37 101.0 38 96.5 39 100.0 40 125.0 41 146.5 42 148.5 43 175.0 44 183.5 45 162.5 46 165.5 47 172.0 48 165.5 49 155.0 50 159.5 51 150.5 52 139.0 53 126.5 54 109.5 55 122.5 56 139.5 57 131.0 58 123.5 59 131.5 60 137.5 61 129.5 62 121.0 63 112.0 64 99.0 65 91.0 66 86.0 67 87.0 68 85.0 69 72.5 70 63.0 71 62.0 72 54.5 73 54.5 74 54.5 75 43.0 76 34.5 77 24.5 78 20.0 79 18.5 80 12.5 81 9.5 82 6.5 83 3.0 84 3.0 85 2.5 86 3.0 87 3.0 88 1.5 89 0.5 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.8499999999999999 2 1.825 3 1.7500000000000002 4 1.7999999999999998 5 1.725 6 1.725 7 1.725 8 1.775 9 1.725 10-11 1.7375000000000003 12-13 1.825 14-15 1.7999999999999998 16-17 2.025 18-19 1.775 20-21 1.8499999999999999 22-23 1.9375 24-25 1.7500000000000002 26-27 1.8624999999999998 28-29 1.9375 30-31 1.7874999999999999 32-33 2.0375 34-35 1.9875 36-37 0.16535232765199695 38-39 0.19083969465648853 40-41 0.025451768897938407 42-43 0.06362942224484602 44-45 0.06363752068219422 46-47 0.02545824847250509 48-49 0.11456211812627291 50-51 0.10183299389002036 52-53 0.025471217524197655 54-55 0.06367804381049415 56-57 0.1782985226693836 58-59 0.05094892370398676 60-61 0.08917197452229299 62-63 0.0382262996941896 64-65 0.21667091511598266 66-67 0.08929710422247736 68-69 0.02554604674926555 70-71 0.025614754098360656 72-73 0.025796465884173867 74-75 0.02718868950516585 76 0.07521624670928921 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 69.0 36 0.0 37 0.0 38 2.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 1.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 2.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 2.0 65 1.0 66 3.0 67 3.0 68 1.0 69 1.0 70 18.0 71 10.0 72 17.0 73 58.0 74 264.0 75 887.0 76 2659.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.25 #Duplication Level Percentage of deduplicated Percentage of total 1 97.0026525198939 91.425 2 2.042440318302387 3.85 3 0.6631299734748011 1.875 4 0.1856763925729443 0.7000000000000001 5 0.05305039787798408 0.25 6 0.0 0.0 7 0.02652519893899204 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02652519893899204 1.725 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 69 1.725 No Hit GTAAGTTAGAAGGGGAACGCGAAATCACTTTAGGTTTTGTTGATTTATTGCGCGACGATTTTATTGAAAA 7 0.17500000000000002 No Hit AAATTATCCGAGCAGCTTGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCG 5 0.125 No Hit GGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1217143 spots for SRR11389755.sra Written 1217143 spots for SRR11389755.sra Read 1217143 spots for SRR11389755.sra Written 1217143 spots for SRR11389755.sra Read 1217143 spots for SRR11389755.sra Written 1217143 spots for SRR11389755.sra Read 1217143 spots for SRR11389755.sra Written 1217143 spots for SRR11389755.sra Read 1217143 spots for SRR11389755.sra Written 1217143 spots for SRR11389755.sra Read 1217148 spots for SRR11389755.sra Written 1217148 spots for SRR11389755.sra Read 1217143 spots for SRR11389755.sra Written 1217143 spots for SRR11389755.sra Read 1217143 spots for SRR11389755.sra Written 1217143 spots for SRR11389755.sra Read 1217143 spots for SRR11389755.sra Written 1217143 spots for SRR11389755.sra Read 1217143 spots for SRR11389755.sra Written 1217143 spots for SRR11389755.sra Read 1217143 spots for SRR11389755.sra Written 1217143 spots for SRR11389755.sra Read 1217143 spots for SRR11389755.sra Written 1217143 spots for SRR11389755.sra Read 1217143 spots for SRR11389755.sra Written 1217143 spots for SRR11389755.sra Read 1217143 spots for SRR11389755.sra Written 1217143 spots for SRR11389755.sra Read 1217143 spots for SRR11389755.sra Written 1217143 spots for SRR11389755.sra Read 1217143 spots for SRR11389755.sra Written 1217143 spots for SRR11389755.sra Read 1217143 spots for SRR11389755.sra Written 1217143 spots for SRR11389755.sra Read 1217143 spots for SRR11389755.sra Written 1217143 spots for SRR11389755.sra Read 1217143 spots for SRR11389755.sra Written 1217143 spots for SRR11389755.sra Read 1217143 spots for SRR11389755.sra Written 1217143 spots for SRR11389755.sra SRR ids: ['SRR11389755.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3ud5jtto SRR11389755.sra spots: 24342865 blocks: [[1, 1217143], [1217144, 2434286], [2434287, 3651429], [3651430, 4868572], [4868573, 6085715], [6085716, 7302858], [7302859, 8520001], [8520002, 9737144], [9737145, 10954287], [10954288, 12171430], [12171431, 13388573], [13388574, 14605716], [14605717, 15822859], [15822860, 17040002], [17040003, 18257145], [18257146, 19474288], [19474289, 20691431], [20691432, 21908574], [21908575, 23125717], [23125718, 24342865]] SRR11389755 file size 4594865 SRR11389755 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389755 SRR11389755_1.fastq SRR11389755_2.fastq Input file: SRR11389755_1.fastq Paired file: SRR11389755_2.fastq trimmed: SRR11389755-trimmed-pair1.fastq, SRR11389755-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 04:36:22 2024 >> started Sat Dec 7 04:36:41 2024 >> done (18.603s) 24342865 read pairs processed; of these: 1767 ( 0.01%) short read pairs filtered out after trimming by size control 690429 ( 2.84%) empty read pairs filtered out after trimming by size control 23650669 (97.16%) read pairs available; of these: 35569 ( 0.15%) trimmed read pairs available after processing 23615100 (99.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2722 0.01% 19 12 0.00% 20 3131 0.01% 21 19 0.00% 22 3469 0.01% 23 25 0.00% 24 3797 0.02% 25 38 0.00% 26 3531 0.01% 27 44 0.00% 28 2710 0.01% 29 42 0.00% 30 2121 0.01% 31 44 0.00% 32 1560 0.01% 33 27 0.00% 34 1042 0.00% 35 506 0.00% 36 1743 0.01% 37 621 0.00% 38 1098 0.00% 39 753 0.00% 40 984 0.00% 41 959 0.00% 42 1117 0.00% 43 1139 0.00% 44 1306 0.01% 45 1396 0.01% 46 1601 0.01% 47 1781 0.01% 48 2074 0.01% 49 2142 0.01% 50 2318 0.01% 51 2486 0.01% 52 2746 0.01% 53 2905 0.01% 54 3234 0.01% 55 3674 0.02% 56 4824 0.02% 57 4522 0.02% 58 4703 0.02% 59 5105 0.02% 60 5494 0.02% 61 5727 0.02% 62 6352 0.03% 63 6805 0.03% 64 7630 0.03% 65 8053 0.03% 66 8629 0.04% 67 9535 0.04% 68 9953 0.04% 69 10732 0.05% 70 11804 0.05% 71 14856 0.06% 72 39334 0.17% 73 228342 0.97% 74 1631859 6.90% 75 10551232 44.61% 76 11014261 46.57% 23650669 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=20 prefix-density=0.82 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=30.78 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=1.1 sequence=ATCAGTGAGCTATTACGCACTCTTTAAAGGGTGGCTGCTTCTAGGCAAACCTCCTGGCTGTCTTTGCACCCCCACCTCCTTTATCACTGAGCGGTCATTTAGGGGCCTTAGCTGGTGATCCGGGCTGTTTCCCTCTCGACGATGAAGCTTATCCCCCATCGTCTCACTGGCCGACCTTGACCCCTGTTATTTTGGGGTCATATCTAGTATTCAGAGTTTGCCTCGATTTGGTACCGCTCGCGCAGCCCGCACCGAAACAGTGCTTTACCCCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCAGCTAGCTCTGGGTTCGAGTGGCATTTCACCCCTAACCACAACTCATCCGCTGATTCTTCAACATCAGTCGGTTCGGACCTCTGCTTAGTTTCATCCAAGCTTCATCCTGGTCATGGATAGATCACCCAGGTTCGGGTCCATAAGCAGTGACAATCGCCCTATGAAGACTCGCTTTCGCTACGGCTCCGGTGG criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=17 prefix-density=0.75 prefix-fanout=2.2 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=8.02 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=1.6 sequence=CTAAAGTTTCATTTACGCCTAATTCACATCGAGTAGACCTTGTTATTGTGAGAATTCTTAATTCAAGAGTTGTAAGGAGGGACTTATGTCACCACAAACAGAAACTAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAAGATTATAGATTGACTTACTACACCCCGGAGTATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTATCTCCTCAACCTGGGGTTCCGCCCGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACTAGTCTTGATCGTTACAAAGGACGATGCTATCACATCGAGCCTGTTCCTGGGGAAGACAGTCAATGGATCTGTTATGTAGCTTATCCATTAGATCTATTTGAAGAGGGTTCCGTTACTAACATGTTTACTTCCATTGTAGGTAACGTATTTGGTTTCAAAGCCCTACGTGCTCTACGTCTGGAGGATCTACGAATTCCCCCT SRR11389755 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 04:37:07 Started mapping on | Dec 07 04:37:08 Finished on | Dec 07 04:39:23 Mapping speed, Million of reads per hour | 630.68 Number of input reads | 23650669 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 19076606 Uniquely mapped reads % | 80.66% Average mapped length | 150.33 Number of splices: Total | 7889178 Number of splices: Annotated (sjdb) | 7539614 Number of splices: GT/AG | 7787255 Number of splices: GC/AG | 90779 Number of splices: AT/AC | 2029 Number of splices: Non-canonical | 9115 Mismatch rate per base, % | 0.54% Deletion rate per base | 0.01% Deletion average length | 1.64 Insertion rate per base | 0.01% Insertion average length | 1.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2931293 % of reads mapped to multiple loci | 12.39% Number of reads mapped to too many loci | 65497 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.64% % of reads unmapped: other | 1.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1642782 1642782 1642782 N_multimapping 2931293 2931293 2931293 N_noFeature 602393 18556205 765417 N_ambiguous 535638 3129 196700 UnstrandedReadsAssigned:17938575 PositiveStrandReadsAssigned:517272 NegativeStrandReadsAssigned:18114489 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389755 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389755-trimmed-pair1.fastq SRR11389755-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,650,669 reads, 20,803,443 reads pseudoaligned [quant] estimated average fragment length: 193.557 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,132 rounds 52973 SRR11389755.ke.tsv 35125 SRR11389755.se.tsv 88098 total ==> SRR11389755.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 743.55 0 0 PNS24247 1044 851.443 18.7781 1.41516 PNS24249 1928 1735.44 102.532 3.79102 PNS24246 1044 851.443 18.7781 1.41516 PNS24248 1044 851.443 18.7781 1.41516 PNS24244 1471 1278.44 21.134 1.06074 PNS24243 293 113.836 0 0 KQK14069 1603 1410.44 287 13.0568 KQK14071 474 282.962 0 0 ==> SRR11389755.se.tsv <== BRADI_1g14170v3 286 BRADI_1g53295v3 8 BRADI_1g59795v3 179 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 180 BRADI_1g74790v3 330 BRADI_1g09890v3 0 BRADI_1g77505v3 223 BRADI_1g48960v3 0 SRR11389755 completed mapping pipeline successfully