Starting /dee2/code/volunteer_pipeline.sh SRR11389756 current disk space = 1546945880064 free memory = 1421056056 SRR11389756 SRAfilesize 43448ab5ab8f6cd892a97a0d43f90837 SRR11389756.sra SRR11389756.sra file validated SRR11389756 is paired end SRR11389756 is conventional basespace SRR11389756 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389756_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.41975 32.0 32.0 32.0 32.0 32.0 2 30.47225 32.0 32.0 32.0 32.0 32.0 3 30.359 32.0 32.0 32.0 32.0 32.0 4 30.519 32.0 32.0 32.0 32.0 32.0 5 30.51675 32.0 32.0 32.0 32.0 32.0 6 33.54275 36.0 36.0 36.0 32.0 36.0 7 33.62625 36.0 36.0 36.0 32.0 36.0 8 33.40825 36.0 36.0 36.0 27.0 36.0 9 33.5635 36.0 36.0 36.0 32.0 36.0 10-11 33.646625 36.0 36.0 36.0 32.0 36.0 12-13 33.729625 36.0 36.0 36.0 32.0 36.0 14-15 33.533625 36.0 36.0 36.0 32.0 36.0 16-17 33.50087499999999 36.0 36.0 36.0 32.0 36.0 18-19 33.562 36.0 36.0 36.0 32.0 36.0 20-21 33.5685 36.0 36.0 36.0 32.0 36.0 22-23 33.500875 36.0 36.0 36.0 26.5 36.0 24-25 33.445125 36.0 36.0 36.0 29.5 36.0 26-27 33.386875 36.0 36.0 36.0 26.5 36.0 28-29 33.217375000000004 36.0 36.0 36.0 24.0 36.0 30-31 33.274875 36.0 36.0 36.0 26.5 36.0 32-33 33.20025 36.0 36.0 36.0 24.0 36.0 34-35 33.198 36.0 36.0 36.0 24.0 36.0 36-37 33.94380587484036 36.0 36.0 36.0 32.0 36.0 38-39 33.97241379310345 36.0 36.0 36.0 32.0 36.0 40-41 33.842528735632186 36.0 36.0 36.0 32.0 36.0 42-43 33.74738186462324 36.0 36.0 36.0 32.0 36.0 44-45 33.759897828863345 36.0 36.0 36.0 32.0 36.0 46-47 33.84176245210728 36.0 36.0 36.0 32.0 36.0 48-49 33.75708812260537 36.0 36.0 36.0 32.0 36.0 50-51 33.7962962962963 36.0 36.0 36.0 32.0 36.0 52-53 33.64370841668356 36.0 36.0 36.0 29.5 36.0 54-55 33.72348581650907 36.0 36.0 36.0 29.5 36.0 56-57 33.59585889570552 36.0 36.0 36.0 26.5 36.0 58-59 33.48683537832311 36.0 36.0 36.0 24.0 36.0 60-61 33.54858092559448 36.0 36.0 36.0 24.0 36.0 62-63 33.575044745589366 36.0 36.0 36.0 27.0 36.0 64-65 33.41498338020966 36.0 36.0 36.0 24.0 36.0 66-67 33.426678450084694 36.0 36.0 36.0 24.0 36.0 68-69 33.28515156052106 36.0 36.0 36.0 21.0 36.0 70-71 33.30385821823639 36.0 36.0 36.0 24.0 36.0 72-73 33.405481053761434 36.0 36.0 36.0 24.0 36.0 74-75 33.26178261049007 36.0 36.0 36.0 21.0 36.0 76 32.70858208955224 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 85.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 0.0 22 5.0 23 10.0 24 8.0 25 17.0 26 35.0 27 56.0 28 86.0 29 111.0 30 186.0 31 243.0 32 320.0 33 486.0 34 874.0 35 1476.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.66036289292103 16.66240736008178 11.857909532328136 38.81932021466905 2 22.528735632183906 16.372924648786718 37.49680715197957 23.60153256704981 3 19.233716475095786 23.627075351213282 24.367816091954023 32.77139208173691 4 25.312899106002558 28.965517241379313 20.35759897828863 25.363984674329505 5 24.444444444444443 31.18773946360153 23.371647509578544 20.99616858237548 6 21.98617865369849 33.32480163808549 24.187356027642693 20.50166368057333 7 18.314176245210728 24.904214559386972 37.701149425287355 19.080459770114942 8 18.927203065134098 25.108556832694763 31.392081736909322 24.572158365261814 9 22.043422733077904 20.5874840357599 31.570881226053636 25.798212005108557 10-11 22.630906768837804 30.44699872286079 22.9757343550447 23.946360153256705 12-13 23.448275862068964 23.984674329501914 26.283524904214563 26.283524904214563 14-15 22.260536398467433 25.887611749680715 27.100893997445723 24.75095785440613 16-17 22.88633461047254 25.33844189016603 26.11749680715198 25.657726692209447 18-19 22.426564495530013 25.070242656449555 26.25798212005109 26.245210727969347 20-21 23.077905491698594 26.743295019157088 26.10472541507024 24.074074074074073 22-23 23.384418901660283 25.03192848020434 27.177522349936144 24.406130268199234 24-25 23.652618135376756 25.37675606641124 25.49169859514687 25.478927203065133 26-27 22.081736909323116 25.53001277139208 26.20689655172414 26.181353767560665 28-29 24.469987228607916 25.26181353767561 26.053639846743295 24.214559386973182 30-31 22.618135376756065 26.679438058748406 25.312899106002558 25.389527458492978 32-33 23.72924648786718 26.168582375478927 25.989782886334613 24.112388250319285 34-35 23.869731800766285 25.593869731800766 25.146871008939975 25.389527458492978 36-37 23.933588761174967 25.810983397190295 24.687100893997446 25.568326947637292 38-39 22.911877394636015 26.89655172413793 24.5338441890166 25.657726692209447 40-41 23.933588761174967 25.41507024265645 25.6066411238825 25.04469987228608 42-43 23.856960408684547 24.91698595146871 25.312899106002558 25.91315453384419 44-45 23.690932311621967 25.04469987228608 25.887611749680715 25.37675606641124 46-47 23.920817369093232 25.185185185185183 25.351213282247762 25.54278416347382 48-49 22.911877394636015 25.274584929757342 26.44955300127714 25.363984674329505 50-51 23.946360153256705 25.146871008939975 25.402298850574713 25.504469987228607 52-53 23.53091466530404 24.70618293306081 25.204394481349002 26.55850792028615 54-55 23.15359059545106 25.658062867365196 25.82417582417583 25.364170713007923 56-57 22.507668711656443 24.7060327198364 26.610429447852763 26.1758691206544 58-59 23.977505112474436 25.268404907975462 24.76993865030675 25.984151329243353 60-61 23.817437995397597 24.980823318844287 25.824597289695728 25.377141396062385 62-63 22.44950140628995 25.466632574789056 26.39989772436717 25.68396829455382 64-65 25.15980567629762 24.060342623369984 24.865763231909998 25.914088468422396 66-67 23.583578462719018 24.96482926205397 25.681033380227653 25.77055889499936 68-69 23.378119001919387 25.028790786948175 24.964811260396676 26.628278950735762 70-71 24.433346139070302 25.713919836086568 24.85593545908567 24.99679856575746 72-73 23.870220162224797 24.745719067851166 25.196343504570617 26.187717265353417 74-75 23.955507325013564 22.23277265328269 26.98046663049376 26.831253391209987 76 26.828358208955223 0.0 36.90298507462686 36.268656716417915 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 86.0 1 43.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 8.5 19 13.0 20 17.5 21 26.0 22 30.0 23 21.0 24 10.0 25 10.5 26 12.5 27 22.5 28 25.0 29 24.0 30 34.0 31 38.0 32 51.5 33 71.5 34 82.5 35 99.0 36 116.0 37 126.5 38 128.0 39 142.5 40 165.5 41 172.5 42 183.0 43 188.0 44 182.0 45 184.5 46 186.5 47 181.5 48 173.0 49 159.5 50 146.5 51 134.5 52 125.5 53 120.0 54 114.5 55 123.5 56 122.5 57 115.5 58 117.0 59 113.0 60 112.0 61 106.5 62 97.0 63 92.5 64 73.0 65 55.0 66 49.5 67 39.0 68 42.5 69 51.5 70 48.0 71 42.5 72 44.0 73 41.0 74 37.0 75 37.5 76 28.5 77 18.5 78 13.0 79 8.5 80 8.5 81 5.5 82 3.0 83 4.0 84 2.5 85 0.5 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.175 2 2.125 3 2.125 4 2.125 5 2.125 6 2.325 7 2.125 8 2.125 9 2.125 10-11 2.125 12-13 2.125 14-15 2.125 16-17 2.125 18-19 2.125 20-21 2.125 22-23 2.125 24-25 2.125 26-27 2.125 28-29 2.125 30-31 2.125 32-33 2.125 34-35 2.125 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 85.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 2.0 53 0.0 54 0.0 55 1.0 56 0.0 57 0.0 58 0.0 59 1.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 1.0 66 1.0 67 0.0 68 3.0 69 1.0 70 1.0 71 13.0 72 15.0 73 56.0 74 268.0 75 872.0 76 2680.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.675 #Duplication Level Percentage of deduplicated Percentage of total 1 97.27782225780625 91.125 2 1.8681611956231654 3.5000000000000004 3 0.5871363757672805 1.6500000000000001 4 0.05337603416066186 0.2 5 0.05337603416066186 0.25 6 0.0 0.0 7 0.05337603416066186 0.35000000000000003 8 0.02668801708033093 0.2 9 0.0 0.0 >10 0.05337603416066186 0.6 >50 0.02668801708033093 2.125 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 85 2.125 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 14 0.35000000000000003 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 10 0.25 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 8 0.2 TruSeq Adapter, Index 7 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 7 (97% over 36bp) ATTTTTTCTCTTTTTATTTTGTTTCTTTTTATTTAGACCTTCTTCATATT 7 0.17500000000000002 No Hit CAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGG 5 0.125 No Hit CCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389756 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389756_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.12875 32.0 32.0 32.0 21.0 32.0 2 29.862 32.0 32.0 32.0 21.0 32.0 3 29.866 32.0 32.0 32.0 21.0 32.0 4 29.759 32.0 32.0 32.0 21.0 32.0 5 29.72 32.0 32.0 32.0 21.0 32.0 6 32.666 36.0 36.0 36.0 14.0 36.0 7 32.97625 36.0 36.0 36.0 21.0 36.0 8 32.8585 36.0 36.0 36.0 21.0 36.0 9 32.8835 36.0 36.0 36.0 21.0 36.0 10-11 32.653125 36.0 36.0 36.0 14.0 36.0 12-13 32.90575 36.0 36.0 36.0 21.0 36.0 14-15 32.839875 36.0 36.0 36.0 21.0 36.0 16-17 32.731125 36.0 36.0 36.0 17.5 36.0 18-19 32.86475 36.0 36.0 36.0 17.5 36.0 20-21 32.740875 36.0 36.0 36.0 14.0 36.0 22-23 32.61475 36.0 36.0 36.0 14.0 36.0 24-25 32.695750000000004 36.0 36.0 36.0 14.0 36.0 26-27 32.6065 36.0 36.0 36.0 14.0 36.0 28-29 32.633875 36.0 36.0 36.0 14.0 36.0 30-31 32.554874999999996 36.0 36.0 36.0 14.0 36.0 32-33 32.5145 36.0 36.0 36.0 14.0 36.0 34-35 32.423500000000004 36.0 36.0 36.0 14.0 36.0 36-37 33.20131869046677 36.0 36.0 36.0 17.5 36.0 38-39 33.185885962669396 36.0 36.0 36.0 17.5 36.0 40-41 33.29864484786499 36.0 36.0 36.0 17.5 36.0 42-43 33.205574021989264 36.0 36.0 36.0 17.5 36.0 44-45 33.133469700843776 36.0 36.0 36.0 17.5 36.0 46-47 33.057402198926106 36.0 36.0 36.0 17.5 36.0 48-49 32.79711071337254 36.0 36.0 36.0 14.0 36.0 50-51 32.99169010483253 36.0 36.0 36.0 17.5 36.0 52-53 33.13220551489103 36.0 36.0 36.0 21.0 36.0 54-55 32.957150166282936 36.0 36.0 36.0 17.5 36.0 56-57 32.77558853633572 36.0 36.0 36.0 14.0 36.0 58-59 32.79421551062196 36.0 36.0 36.0 14.0 36.0 60-61 32.78059395801331 36.0 34.0 36.0 14.0 36.0 62-63 32.61853558627752 36.0 32.0 36.0 14.0 36.0 64-65 32.47235023041475 36.0 34.0 36.0 14.0 36.0 66-67 32.55346343616843 36.0 32.0 36.0 14.0 36.0 68-69 32.37299520719782 36.0 32.0 36.0 14.0 36.0 70-71 32.45658141601659 36.0 32.0 36.0 14.0 36.0 72-73 32.39302109772757 36.0 32.0 36.0 14.0 36.0 74-75 32.48307951536801 36.0 32.0 36.0 14.0 36.0 76 31.42671755725191 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 87.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 8.0 16 10.0 17 6.0 18 4.0 19 8.0 20 10.0 21 9.0 22 11.0 23 24.0 24 23.0 25 39.0 26 63.0 27 100.0 28 116.0 29 173.0 30 189.0 31 268.0 32 352.0 33 507.0 34 849.0 35 1141.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.182817693684484 22.219381232421377 10.585527997954488 32.01227307593966 2 30.657120940935823 22.423932498082333 29.276399897724364 17.64254666325748 3 24.2137560726157 28.841728458194837 21.759140884684225 25.185374584505244 4 27.461007414983378 30.554845308105342 18.435182817693686 23.548964459217594 5 28.44364937388193 32.967032967032964 19.55021722463583 19.03910043444927 6 22.693585484283158 36.3915154612829 20.470227446971634 20.444671607462304 7 23.12803475594173 17.096856631740355 34.29593662151802 25.479171990799898 8 23.619631901840492 21.983640081799592 25.920245398773005 28.476482617586914 9 23.741374904165603 22.642473805264505 27.319192435471507 26.29695885509839 10-11 28.166134185303516 27.412140575079874 20.166134185303513 24.2555910543131 12-13 26.507103545373095 22.603353385383336 24.011263279150135 26.878279790093433 14-15 26.429576563899193 24.93283868491749 24.357170269924524 24.280414481258795 16-17 27.453751284686533 24.537512846865365 23.15005138746146 24.85868448098664 18-19 26.268694874089228 24.70919084750096 24.19787805189825 24.824236226511566 20-21 26.691440287032293 25.089697590978986 24.013326499231162 24.20553562275756 22-23 26.91221765913758 25.166837782340863 22.908110882956876 25.012833675564682 24-25 26.53792045018545 24.990407980560175 23.724261414503133 24.747410154751247 26-27 27.17140661029977 25.172943889315913 23.584422239303098 24.07122726108122 28-29 26.42114718336969 24.945463877839085 22.430386244065186 26.203002694726035 30-31 25.66201867724191 25.18869131380325 24.472303952923117 24.676986056031723 32-33 26.674379740326522 25.32459184985217 23.9105283455457 24.090500064275613 34-35 27.844849730285127 24.51836629848446 23.298227587978424 24.33855638325199 36-37 26.361655773420477 24.50339612969371 23.6319364347046 25.503011662181212 38-39 26.828329484218628 25.58378239671542 23.1075186040544 24.480369515011546 40-41 27.356439442383934 24.77298887325745 23.48126358869421 24.389308095664408 42-43 26.846754576878762 25.054410446805786 23.684547433107156 24.414287543208296 44-45 25.854345321899398 25.278382183540256 24.100857545117112 24.766414949443234 46-47 26.138107416879798 25.37084398976982 22.9923273657289 25.498721227621484 48-49 26.12093261593646 24.942352036894697 24.481168332052267 24.455547015116576 50-51 26.89452124935996 25.47363031233999 23.835125448028673 23.796722990271377 52-53 26.601867246450954 24.696252717738844 23.506842307200408 25.195037728609798 54-55 26.5590984761173 25.86758867972852 23.05032654629274 24.522986297861443 56-57 26.691487995891645 25.741430222108104 23.63589677750674 23.931185004493514 58-59 27.60696899820651 25.71099154496541 23.007942608250065 23.674096848578017 60-61 27.099089860274322 25.086527368286117 23.637995128829637 24.176387642609924 62-63 26.478873239436616 24.95518565941101 24.289372599231754 24.276568501920615 64-65 26.70863309352518 25.064234326824252 22.970195272353546 25.25693730729702 66-67 26.238131896330515 25.4169874262253 23.518090839107007 24.82678983833718 68-69 27.277386290839207 24.52274183215887 24.18962203715567 24.01024983984625 70-71 26.17062219371392 24.785118665811417 23.912764592687623 25.131494547787042 72-73 25.82268679829656 25.112917795844623 23.55142599045038 25.51296941540844 74-75 25.927446954140997 23.01163586584531 25.311430527036276 25.74948665297741 76 25.821237585943468 0.0 35.94346829640948 38.23529411764706 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 91.0 1 45.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 2.0 17 3.0 18 7.0 19 10.5 20 10.0 21 10.5 22 10.0 23 12.0 24 15.0 25 15.0 26 13.5 27 16.0 28 21.0 29 19.0 30 25.5 31 32.0 32 34.5 33 39.0 34 52.0 35 74.5 36 87.0 37 90.5 38 103.5 39 134.0 40 147.0 41 136.0 42 130.5 43 156.0 44 177.5 45 171.0 46 173.5 47 188.5 48 174.5 49 150.5 50 145.0 51 146.5 52 140.5 53 128.5 54 134.5 55 130.5 56 121.0 57 123.0 58 126.0 59 124.0 60 122.5 61 118.0 62 107.5 63 103.5 64 91.0 65 91.0 66 89.0 67 74.0 68 73.0 69 66.5 70 62.5 71 65.0 72 60.0 73 50.5 74 36.0 75 26.5 76 24.5 77 20.5 78 16.0 79 13.0 80 13.0 81 11.0 82 6.5 83 4.5 84 4.5 85 3.5 86 1.5 87 0.5 88 1.5 89 1.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.5 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.225 2 2.225 3 2.225 4 2.225 5 2.175 6 2.175 7 2.175 8 2.1999999999999997 9 2.175 10-11 2.1875 12-13 2.3375 14-15 2.2875 16-17 2.7 18-19 2.2125 20-21 2.45 22-23 2.6 24-25 2.2624999999999997 26-27 2.4250000000000003 28-29 2.5875 30-31 2.2875 32-33 2.7625 34-35 2.675 36-37 0.2684049079754601 38-39 0.3579647149066735 40-41 0.0383533623114293 42-43 0.14062899514190744 44-45 0.1150600869342879 46-47 0.025568908207619537 48-49 0.2045512656609563 50-51 0.12784454103809767 52-53 0.012787723785166238 54-55 0.11511895625479662 56-57 0.34544524053224157 58-59 0.10238034297414896 60-61 0.1408090117767537 62-63 0.025601638504864313 64-65 0.35842293906810035 66-67 0.1920860545524395 68-69 0.0 70-71 0.0 72-73 0.012903225806451613 74-75 0.0 76 0.07633587786259542 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 87.0 36 2.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 2.0 53 0.0 54 0.0 55 1.0 56 0.0 57 1.0 58 0.0 59 1.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 1.0 66 1.0 67 0.0 68 3.0 69 1.0 70 5.0 71 7.0 72 26.0 73 76.0 74 267.0 75 899.0 76 2620.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.425 #Duplication Level Percentage of deduplicated Percentage of total 1 97.45830023828435 92.025 2 1.6415144294413555 3.1 3 0.6883770187979878 1.95 4 0.13238019592268996 0.5 5 0.052952078369075985 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.026476039184537992 2.175 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 87 2.175 No Hit GGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACA 5 0.125 No Hit CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1709228 spots for SRR11389756.sra Written 1709228 spots for SRR11389756.sra Read 1709228 spots for SRR11389756.sra Written 1709228 spots for SRR11389756.sra Read 1709228 spots for SRR11389756.sra Written 1709228 spots for SRR11389756.sra Read 1709228 spots for SRR11389756.sra Written 1709228 spots for SRR11389756.sra Read 1709228 spots for SRR11389756.sra Written 1709228 spots for SRR11389756.sra Read 1709228 spots for SRR11389756.sra Written 1709228 spots for SRR11389756.sra Read 1709242 spots for SRR11389756.sra Written 1709242 spots for SRR11389756.sra Read 1709228 spots for SRR11389756.sra Written 1709228 spots for SRR11389756.sra Read 1709228 spots for SRR11389756.sra Written 1709228 spots for SRR11389756.sra Read 1709228 spots for SRR11389756.sra Written 1709228 spots for SRR11389756.sra Read 1709228 spots for SRR11389756.sra Written 1709228 spots for SRR11389756.sra Read 1709228 spots for SRR11389756.sra Written 1709228 spots for SRR11389756.sra Read 1709228 spots for SRR11389756.sra Written 1709228 spots for SRR11389756.sra Read 1709228 spots for SRR11389756.sra Written 1709228 spots for SRR11389756.sra Read 1709228 spots for SRR11389756.sra Written 1709228 spots for SRR11389756.sra Read 1709228 spots for SRR11389756.sra Written 1709228 spots for SRR11389756.sra Read 1709228 spots for SRR11389756.sra Written 1709228 spots for SRR11389756.sra Read 1709228 spots for SRR11389756.sra Written 1709228 spots for SRR11389756.sra Read 1709228 spots for SRR11389756.sra Written 1709228 spots for SRR11389756.sra Read 1709228 spots for SRR11389756.sra Written 1709228 spots for SRR11389756.sra SRR ids: ['SRR11389756.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bzie1z6d SRR11389756.sra spots: 34184574 blocks: [[1, 1709228], [1709229, 3418456], [3418457, 5127684], [5127685, 6836912], [6836913, 8546140], [8546141, 10255368], [10255369, 11964596], [11964597, 13673824], [13673825, 15383052], [15383053, 17092280], [17092281, 18801508], [18801509, 20510736], [20510737, 22219964], [22219965, 23929192], [23929193, 25638420], [25638421, 27347648], [27347649, 29056876], [29056877, 30766104], [30766105, 32475332], [32475333, 34184574]] SRR11389756 file size 6449010 SRR11389756 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389756 SRR11389756_1.fastq SRR11389756_2.fastq Input file: SRR11389756_1.fastq Paired file: SRR11389756_2.fastq trimmed: SRR11389756-trimmed-pair1.fastq, SRR11389756-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 04:52:25 2024 >> started Sat Dec 7 04:52:52 2024 >> done (27.150s) 34184574 read pairs processed; of these: 2695 ( 0.01%) short read pairs filtered out after trimming by size control 1155683 ( 3.38%) empty read pairs filtered out after trimming by size control 33026196 (96.61%) read pairs available; of these: 65659 ( 0.20%) trimmed read pairs available after processing 32960537 (99.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3682 0.01% 19 30 0.00% 20 5173 0.02% 21 47 0.00% 22 6473 0.02% 23 60 0.00% 24 7280 0.02% 25 96 0.00% 26 7287 0.02% 27 94 0.00% 28 6229 0.02% 29 79 0.00% 30 5015 0.02% 31 79 0.00% 32 3447 0.01% 33 88 0.00% 34 2266 0.01% 35 695 0.00% 36 3802 0.01% 37 866 0.00% 38 2047 0.01% 39 1038 0.00% 40 1588 0.00% 41 1419 0.00% 42 1661 0.01% 43 1702 0.01% 44 1860 0.01% 45 2024 0.01% 46 2346 0.01% 47 2496 0.01% 48 2881 0.01% 49 3088 0.01% 50 3358 0.01% 51 3555 0.01% 52 3964 0.01% 53 4418 0.01% 54 4509 0.01% 55 5545 0.02% 56 6899 0.02% 57 6751 0.02% 58 6718 0.02% 59 7097 0.02% 60 7701 0.02% 61 8158 0.02% 62 8840 0.03% 63 9292 0.03% 64 10380 0.03% 65 10923 0.03% 66 12062 0.04% 67 13243 0.04% 68 13961 0.04% 69 14907 0.05% 70 16450 0.05% 71 20575 0.06% 72 52752 0.16% 73 321652 0.97% 74 2351341 7.12% 75 14982334 45.37% 76 15041873 45.55% 33026196 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=18 prefix-density=0.69 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.04 sequence-density-rank=24 fanout-score=7.16 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=1.5 sequence=CAAAAACAGCTAATTGGAAAGCAATAGTCATATTTCTAATCCTCCAAGCTATCATCAAATAAAGTTGACTACATATTTGATCCCTCACTTAACCTAAATTGTAAAAAATACAAGAAGTAGGAGGGGTTTAATCATGAATCCATTGATTCTTCTCTTTAATTAATAATTAAAACTTATTACTTACCGCTTTTATTTGGATATGGGGATTAGGGTAGGGGATTTAGTCTTTATTTCAAAAGCGGGTATAGCGGATCTTCTATCCGTGTATACAGTATACAGAAATATATCGAAAAAGGATTTGCATCTGAGATGTTTCTAGAGGTTAGTAGATCCTTTTATTTTTATATGGCTGTGTTCTATTTCTAGGAGTAAAATAGGGATTAAGCTGTGGAGAGATGGCTGAGTGGTTGATAGCTCCGGTCTTGAAAACCGGTATAGTTCTAGGAACTATCGAGGGTTCGAATCCCTCTCTCTCCTTTTGCTTATTGAATACGTTTGTTTCTTTCA criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=25 prefix-density=0.87 prefix-fanout=2.0 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=9.40 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=2.3 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC SRR11389756 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 04:53:39 Started mapping on | Dec 07 04:53:39 Finished on | Dec 07 05:00:10 Mapping speed, Million of reads per hour | 304.08 Number of input reads | 33026196 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 26801605 Uniquely mapped reads % | 81.15% Average mapped length | 150.28 Number of splices: Total | 10071339 Number of splices: Annotated (sjdb) | 9552429 Number of splices: GT/AG | 9937143 Number of splices: GC/AG | 117383 Number of splices: AT/AC | 2770 Number of splices: Non-canonical | 14043 Mismatch rate per base, % | 0.53% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.01% Insertion average length | 1.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3622237 % of reads mapped to multiple loci | 10.97% Number of reads mapped to too many loci | 74691 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.71% % of reads unmapped: other | 0.94% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2602363 2602363 2602363 N_multimapping 3622237 3622237 3622237 N_noFeature 996946 25935505 1289364 N_ambiguous 765831 4901 212581 UnstrandedReadsAssigned:25038828 PositiveStrandReadsAssigned:861199 NegativeStrandReadsAssigned:25299660 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389756 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389756-trimmed-pair1.fastq SRR11389756-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,026,196 reads, 28,373,524 reads pseudoaligned [quant] estimated average fragment length: 186.054 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52973 SRR11389756.ke.tsv 35125 SRR11389756.se.tsv 88098 total ==> SRR11389756.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 751.058 0 0 PNS24247 1044 858.946 25.4806 1.36486 PNS24249 1928 1742.95 85.8051 2.26503 PNS24246 1044 858.946 25.4806 1.36486 PNS24248 1044 858.946 25.4806 1.36486 PNS24244 1471 1285.95 210.753 7.54041 PNS24243 293 118.939 0 0 KQK14069 1603 1417.95 760.858 24.6881 KQK14071 474 290.258 26.4691 4.19565 ==> SRR11389756.se.tsv <== BRADI_1g14170v3 804 BRADI_1g53295v3 30 BRADI_1g59795v3 668 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 320 BRADI_1g74790v3 477 BRADI_1g09890v3 0 BRADI_1g77505v3 483 BRADI_1g48960v3 0 SRR11389756 completed mapping pipeline successfully