Starting /dee2/code/volunteer_pipeline.sh SRR11389757 current disk space = 1547005743104 free memory = 1599759832 SRR11389757 SRAfilesize 54cdd2d496dee483c1ff57f0f4807f22 SRR11389757.sra SRR11389757.sra file validated SRR11389757 is paired end SRR11389757 is conventional basespace SRR11389757 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389757_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.966 32.0 32.0 32.0 32.0 32.0 2 30.9155 32.0 32.0 32.0 32.0 32.0 3 30.99675 32.0 32.0 32.0 32.0 32.0 4 30.94125 32.0 32.0 32.0 32.0 32.0 5 31.032 32.0 32.0 32.0 32.0 32.0 6 34.0165 36.0 36.0 36.0 32.0 36.0 7 34.16625 36.0 36.0 36.0 32.0 36.0 8 34.214 36.0 36.0 36.0 32.0 36.0 9 34.23975 36.0 36.0 36.0 32.0 36.0 10-11 34.148875000000004 36.0 36.0 36.0 32.0 36.0 12-13 34.209375 36.0 36.0 36.0 32.0 36.0 14-15 34.144875 36.0 36.0 36.0 32.0 36.0 16-17 34.095375000000004 36.0 36.0 36.0 32.0 36.0 18-19 34.135875 36.0 36.0 36.0 32.0 36.0 20-21 34.123999999999995 36.0 36.0 36.0 32.0 36.0 22-23 34.178 36.0 36.0 36.0 32.0 36.0 24-25 34.025625 36.0 36.0 36.0 32.0 36.0 26-27 34.02125 36.0 36.0 36.0 32.0 36.0 28-29 33.788875000000004 36.0 36.0 36.0 32.0 36.0 30-31 33.711875 36.0 36.0 36.0 32.0 36.0 32-33 33.77575 36.0 36.0 36.0 32.0 36.0 34-35 33.713499999999996 36.0 36.0 36.0 32.0 36.0 36-37 34.003935571286114 36.0 36.0 36.0 32.0 36.0 38-39 33.91831057157309 36.0 36.0 36.0 32.0 36.0 40-41 34.08333333333333 36.0 36.0 36.0 32.0 36.0 42-43 34.025796661608496 36.0 36.0 36.0 32.0 36.0 44-45 34.02137616999747 36.0 36.0 36.0 32.0 36.0 46-47 33.76992157854794 36.0 36.0 36.0 27.0 36.0 48-49 33.632535887496324 36.0 36.0 36.0 27.0 36.0 50-51 33.672108327005816 36.0 36.0 36.0 27.0 36.0 52-53 33.82417721518988 36.0 36.0 36.0 27.0 36.0 54-55 33.50949367088607 36.0 36.0 36.0 27.0 36.0 56-57 33.51984084234286 36.0 36.0 36.0 27.0 36.0 58-59 33.43514061312389 36.0 36.0 36.0 27.0 36.0 60-61 33.45134313228586 36.0 36.0 36.0 27.0 36.0 62-63 33.24670830564955 36.0 36.0 36.0 27.0 36.0 64-65 33.29540842212075 36.0 34.0 36.0 27.0 36.0 66-67 33.17315702785544 36.0 34.0 36.0 24.0 36.0 68-69 33.32296954314721 36.0 36.0 36.0 27.0 36.0 70-71 33.11561844782682 36.0 34.0 36.0 24.0 36.0 72-73 33.23996664144882 36.0 36.0 36.0 27.0 36.0 74-75 33.190464300175464 36.0 34.0 36.0 24.0 36.0 76 31.97668296352012 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 42.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 3.0 21 0.0 22 9.0 23 10.0 24 15.0 25 19.0 26 47.0 27 70.0 28 71.0 29 135.0 30 158.0 31 207.0 32 261.0 33 428.0 34 842.0 35 1682.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.051035876705406 17.963617988883275 11.192521475492672 39.79282465891865 2 23.496715512885295 15.740272865083377 36.50833754421425 24.25467407781708 3 20.060636685194545 21.803941384537644 25.265285497726126 32.870136432541685 4 25.088428499242042 29.28246589186458 19.858514401212734 25.77059120768065 5 24.279939363314806 32.13744315310763 23.294593228903487 20.288024254674077 6 20.564311133706152 32.63853584138282 25.34316217590239 21.45399084900864 7 17.508842849924207 26.37695805962607 37.0389085396665 19.075290550783226 8 19.151086407276402 24.05255179383527 31.859525012632645 24.936836786255682 9 19.125821121778678 21.65234967155129 32.49115715007579 26.73067205659424 10-11 22.258716523496716 31.215260232440627 23.420919656392115 23.10510358767054 12-13 23.02930773117736 24.393633148054573 26.301162203132893 26.275896917635173 14-15 22.170288024254674 25.454775138959068 27.463365336028296 24.911571500757958 16-17 22.76402223345124 25.593734209196562 26.225366346639717 25.416877210712478 18-19 21.867104598281962 25.088428499242042 27.76654876200101 25.277918140474988 20-21 21.917635169277414 26.553815058110157 26.667508842849923 24.861040929762506 22-23 22.877716018191006 27.021222839818087 25.96008084891359 24.14098029307731 24-25 22.68822637695806 25.467407781707934 25.99797877716018 25.846387064173825 26-27 22.410308236483072 26.856998484082872 26.36432541687721 24.36836786255685 28-29 23.408287013643253 27.109651339060132 25.353713996968164 24.12834765032845 30-31 22.625063163213742 26.478019201616977 26.048509348155633 24.848408287013644 32-33 22.385042950985344 25.833754421424963 26.51591712986357 25.265285497726126 34-35 23.47145022738757 25.821121778676098 26.427488630621525 24.279939363314806 36-37 22.785290029066093 25.894098319221538 26.197396688992796 25.123214962719576 38-39 22.685887708649467 26.6944865958523 25.720789074355082 24.898836621143147 40-41 22.02832574607992 27.35204855842185 25.847243297926152 24.77238239757208 42-43 23.368740515933233 26.39099645928174 24.92412746585736 25.316135558927666 44-45 22.059195547685302 26.1952947128763 26.498861624082977 25.246648115355423 46-47 23.336706299013407 25.891727801669617 26.233240576777135 24.53832532253984 48-49 22.421865114513476 26.16727824876629 25.686448184233836 25.724408452486397 50-51 23.032143761073147 25.80359402682865 25.487218425715007 25.677043786383198 52-53 23.0126582278481 25.39240506329114 25.82278481012658 25.772151898734176 54-55 23.303797468354432 25.17721518987342 25.696202531645568 25.82278481012658 56-57 23.448974423904787 26.00658394530261 26.53836414282097 24.006077487971638 58-59 23.18216366860907 25.728401317456296 26.019761844438815 25.06967316949582 60-61 23.276735935124176 25.240750126710594 25.848960973137352 25.633552965027878 62-63 23.047667342799187 25.43103448275862 26.66075050709939 24.8605476673428 64-65 23.186199898528663 26.17960426179604 25.976661593099948 24.65753424657534 66-67 23.975643790435115 24.711404287707726 25.916529240137002 25.39642268172016 68-69 23.28680203045685 26.624365482233504 25.52030456852792 24.568527918781726 70-71 24.241655032364513 25.599695392816347 25.19355248127935 24.96509709353979 72-73 23.164201937786842 25.66292707802142 25.53544110147884 25.637429882712905 74-75 23.152510432090455 22.65446224256293 26.88114147260735 27.311885852739266 76 26.701767581797668 0.0 36.21662279052275 37.081609627679576 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 46.0 1 23.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 3.5 19 12.0 20 18.5 21 18.5 22 18.5 23 20.0 24 15.5 25 10.0 26 15.5 27 24.0 28 28.5 29 32.5 30 36.5 31 46.5 32 57.5 33 64.0 34 78.5 35 95.5 36 106.0 37 116.0 38 150.5 39 173.0 40 178.5 41 190.0 42 198.0 43 207.0 44 220.0 45 218.5 46 208.0 47 204.0 48 198.5 49 175.5 50 147.5 51 136.5 52 136.5 53 126.5 54 108.0 55 112.5 56 110.0 57 96.5 58 84.0 59 81.0 60 84.0 61 76.0 62 70.5 63 64.5 64 53.5 65 52.5 66 56.0 67 57.5 68 51.5 69 43.5 70 41.0 71 44.5 72 41.0 73 32.5 74 26.5 75 20.0 76 19.5 77 24.5 78 16.5 79 5.0 80 5.0 81 4.5 82 2.5 83 1.5 84 2.0 85 1.5 86 1.5 87 2.0 88 2.0 89 1.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.05 2 1.05 3 1.05 4 1.05 5 1.05 6 1.6500000000000001 7 1.05 8 1.05 9 1.05 10-11 1.05 12-13 1.05 14-15 1.05 16-17 1.05 18-19 1.05 20-21 1.05 22-23 1.05 24-25 1.05 26-27 1.05 28-29 1.05 30-31 1.05 32-33 1.05 34-35 1.05 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 42.0 36 3.0 37 1.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 1.0 44 0.0 45 0.0 46 0.0 47 1.0 48 1.0 49 0.0 50 0.0 51 1.0 52 0.0 53 0.0 54 0.0 55 0.0 56 2.0 57 1.0 58 0.0 59 1.0 60 0.0 61 1.0 62 2.0 63 1.0 64 0.0 65 0.0 66 1.0 67 1.0 68 0.0 69 0.0 70 1.0 71 6.0 72 22.0 73 67.0 74 259.0 75 926.0 76 2659.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.21382345327466 94.85 2 1.3461040641988091 2.6 3 0.23297954957287084 0.675 4 0.1035464664768315 0.4 5 0.05177323323841575 0.25 6 0.0 0.0 7 0.025886616619207874 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025886616619207874 1.05 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 42 1.05 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 7 0.17500000000000002 No Hit CTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACG 5 0.125 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389757 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389757_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.58675 32.0 32.0 32.0 32.0 32.0 2 30.29275 32.0 32.0 32.0 32.0 32.0 3 30.31175 32.0 32.0 32.0 32.0 32.0 4 30.279 32.0 32.0 32.0 21.0 32.0 5 30.2845 32.0 32.0 32.0 32.0 32.0 6 33.484 36.0 36.0 36.0 21.0 36.0 7 33.59275 36.0 36.0 36.0 21.0 36.0 8 33.5005 36.0 36.0 36.0 21.0 36.0 9 33.4455 36.0 36.0 36.0 21.0 36.0 10-11 33.489125 36.0 36.0 36.0 21.0 36.0 12-13 33.571125 36.0 36.0 36.0 26.5 36.0 14-15 33.35275 36.0 36.0 36.0 21.0 36.0 16-17 33.217375 36.0 36.0 36.0 21.0 36.0 18-19 33.2255 36.0 36.0 36.0 21.0 36.0 20-21 33.366875 36.0 36.0 36.0 21.0 36.0 22-23 33.226124999999996 36.0 36.0 36.0 21.0 36.0 24-25 33.188375 36.0 36.0 36.0 21.0 36.0 26-27 33.308 36.0 36.0 36.0 21.0 36.0 28-29 33.181875000000005 36.0 36.0 36.0 21.0 36.0 30-31 33.17 36.0 36.0 36.0 17.5 36.0 32-33 33.205125 36.0 36.0 36.0 17.5 36.0 34-35 33.0475 36.0 36.0 36.0 14.0 36.0 36-37 33.38291345004342 36.0 36.0 36.0 17.5 36.0 38-39 33.30691569914185 36.0 36.0 36.0 17.5 36.0 40-41 33.4723624432105 36.0 36.0 36.0 21.0 36.0 42-43 33.229808177688035 36.0 36.0 36.0 17.5 36.0 44-45 33.228982580156526 36.0 36.0 36.0 17.5 36.0 46-47 33.111966675082044 36.0 36.0 36.0 14.0 36.0 48-49 33.176553582044235 36.0 36.0 36.0 17.5 36.0 50-51 33.10810810810811 36.0 36.0 36.0 14.0 36.0 52-53 33.03827690752905 36.0 36.0 36.0 14.0 36.0 54-55 32.97789287518949 36.0 36.0 36.0 14.0 36.0 56-57 32.689769628623296 36.0 34.0 36.0 14.0 36.0 58-59 32.87281921618205 36.0 36.0 36.0 14.0 36.0 60-61 32.69777440566515 36.0 32.0 36.0 14.0 36.0 62-63 32.55602753384923 36.0 32.0 36.0 14.0 36.0 64-65 32.59518987341772 36.0 32.0 36.0 14.0 36.0 66-67 32.71970445970939 36.0 32.0 36.0 14.0 36.0 68-69 32.52761591081834 36.0 32.0 36.0 14.0 36.0 70-71 32.48100198731903 36.0 32.0 36.0 14.0 36.0 72-73 32.442814746257646 36.0 32.0 36.0 14.0 36.0 74-75 32.583488650744016 36.0 32.0 36.0 14.0 36.0 76 31.44 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 35.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 7.0 16 7.0 17 6.0 18 14.0 19 7.0 20 10.0 21 9.0 22 29.0 23 20.0 24 42.0 25 38.0 26 70.0 27 95.0 28 104.0 29 139.0 30 178.0 31 235.0 32 289.0 33 449.0 34 842.0 35 1374.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.535200605601815 24.4259399444865 10.648498612162504 31.39036083774918 2 31.48335015136226 23.91523713420787 28.355196770938445 16.246215943491425 3 24.79192938209332 27.64186633039092 23.455233291298867 24.1109709962169 4 28.020176544766706 31.424968474148802 18.764186633039092 21.790668348045397 5 28.3984867591425 32.686002522068094 19.646910466582597 19.26860025220681 6 21.6141235813367 35.73770491803279 21.916771752837327 20.73139974779319 7 24.1109709962169 18.814627994955863 34.0983606557377 22.976040353089534 8 24.312736443883985 21.740226986128626 27.440100882723833 26.506935687263557 9 24.867591424968474 21.740226986128626 27.440100882723833 25.952080706179064 10-11 27.559651559146577 28.49387703572781 20.515086478979928 23.431384926145686 12-13 26.63297536323436 23.234365129500947 24.914718888186986 25.2179406190777 14-15 25.34428300694883 25.192672141503476 25.205306380290587 24.257738471257106 16-17 25.812160283150043 25.91328529895083 23.549488054607508 24.72506636329162 18-19 26.049039433771487 24.355409504550053 25.214863498483314 24.380687563195146 20-21 26.77692210579472 25.489205908344907 24.16361570508774 23.570256280772632 22-23 26.605156723963603 25.341253791708795 24.3427704752275 23.7108190091001 24-25 25.691549829480863 25.982063913098397 24.769483390173043 23.556902867247693 26-27 26.56644770085902 25.505305709954524 24.494694290045476 23.43355229914098 28-29 26.06772807682588 25.486479656305285 24.639878695981803 23.805913570887036 30-31 25.37219278324502 26.053494827151148 24.791824375473126 23.78248801413071 32-33 25.864244259399445 25.775927327781982 24.640423921271765 23.719404491546808 34-35 26.54811451633245 24.94639929373187 23.97528061546223 24.530205574473452 36-37 26.527006562342255 25.378596668349317 24.078748107016658 24.01564866229177 38-39 25.4416961130742 25.492175668854117 24.697122665320546 24.369005552751137 40-41 25.8329126703685 25.69409389197375 24.1670873296315 24.30590610802625 42-43 26.190777005685405 25.71067593177511 24.409349336702462 23.68919772583702 44-45 25.985844287158745 25.808897876643073 25.06319514661274 23.14206268958544 46-47 25.622550878523576 25.76159777524965 24.459613196814562 24.15623814941221 48-49 25.52195368847273 25.863596102745795 24.5096798684044 24.104770340377073 50-51 25.278199291856346 26.213960546282244 25.290844714213456 23.21699544764795 52-53 25.932481982551526 24.9209761031736 24.79453786825136 24.352004046023517 54-55 25.720060636685194 25.846387064173825 24.229408792319354 24.204143506821627 56-57 25.73919636087945 25.815011372251707 24.260803639120546 24.184988627748293 58-59 26.839443742098613 25.840707964601773 24.12136536030341 23.198482932996207 60-61 25.531107738998482 25.63227111785534 24.73444613050076 24.10217501264542 62-63 25.708502024291498 25.581983805668017 24.633097165991902 24.076417004048583 64-65 26.44303797468354 25.58227848101266 24.82278481012658 23.151898734177216 66-67 25.8387137612356 25.864033421952147 24.281554627167996 24.015698189644258 68-69 25.0 26.5973630831643 25.266227180527384 23.136409736308316 70-71 25.481744421906694 26.29310344827586 24.568965517241377 23.656186612576064 72-73 25.789205702647656 25.318228105906314 25.114562118126273 23.778004073319757 74-75 26.017794553788082 22.404960905904556 26.583984901590725 24.993259638716637 76 28.42718446601942 0.0 35.92233009708738 35.650485436893206 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 37.0 1 19.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 1.5 16 3.5 17 4.0 18 7.0 19 8.5 20 8.0 21 9.0 22 7.5 23 6.5 24 12.0 25 16.5 26 16.0 27 19.0 28 22.5 29 26.0 30 35.5 31 45.0 32 53.5 33 57.5 34 56.5 35 70.0 36 92.5 37 111.0 38 129.0 39 146.0 40 163.0 41 180.0 42 190.5 43 199.5 44 198.0 45 180.5 46 173.0 47 190.5 48 189.0 49 170.5 50 165.5 51 153.0 52 142.5 53 127.5 54 112.5 55 119.5 56 124.0 57 111.5 58 101.5 59 93.0 60 95.5 61 95.0 62 84.5 63 79.0 64 74.0 65 66.0 66 70.5 67 79.0 68 69.0 69 54.0 70 46.0 71 46.5 72 51.5 73 44.5 74 33.5 75 33.0 76 26.5 77 22.0 78 14.5 79 8.0 80 9.0 81 9.0 82 8.0 83 6.5 84 3.5 85 2.0 86 4.0 87 4.5 88 2.0 89 0.5 90 1.5 91 2.0 92 2.0 93 2.0 94 2.0 95 1.5 96 1.0 97 1.5 98 1.5 99 2.5 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.9249999999999999 2 0.8999999999999999 3 0.8750000000000001 4 0.8750000000000001 5 0.8750000000000001 6 0.8750000000000001 7 0.8750000000000001 8 0.8750000000000001 9 0.8750000000000001 10-11 0.9875 12-13 1.0625 14-15 1.0625 16-17 1.1125 18-19 1.0999999999999999 20-21 0.9875 22-23 1.0999999999999999 24-25 1.0375 26-27 1.05 28-29 1.075 30-31 0.9249999999999999 32-33 0.9249999999999999 34-35 0.8875 36-37 0.050454086781029264 38-39 0.0 40-41 0.0 42-43 0.11357900050479555 44-45 0.12623074981065388 46-47 0.13885382479171926 48-49 0.20204571284253062 50-51 0.1262945188178833 52-53 0.08842849924204144 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.07600709399543958 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 35.0 36 2.0 37 1.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 1.0 44 0.0 45 0.0 46 0.0 47 1.0 48 1.0 49 0.0 50 0.0 51 1.0 52 0.0 53 0.0 54 0.0 55 0.0 56 2.0 57 1.0 58 0.0 59 1.0 60 0.0 61 1.0 62 2.0 63 1.0 64 0.0 65 0.0 66 1.0 67 2.0 68 0.0 69 0.0 70 6.0 71 6.0 72 14.0 73 64.0 74 296.0 75 986.0 76 2575.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.06251614569878 94.89999999999999 2 1.4466546112115732 2.8000000000000003 3 0.38749677086024287 1.125 4 0.07749935417204858 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025833118057349523 0.8750000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 35 0.8750000000000001 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.075 0.0 0.0 0.0 0.0 20 0.075 0.0 0.0 0.0 0.0 21 0.075 0.0 0.0 0.0 0.0 22 0.075 0.0 0.0 0.0 0.0 23 0.1 0.0 0.0 0.0 0.0 24 0.1 0.0 0.0 0.0 0.0 25 0.1 0.0 0.0 0.0 0.0 26 0.1 0.0 0.0 0.0 0.0 27 0.1 0.0 0.0 0.0 0.0 28 0.1 0.0 0.0 0.0 0.0 29 0.1 0.0 0.0 0.0 0.0 30 0.1 0.0 0.0 0.0 0.0 31 0.125 0.0 0.0 0.0 0.0 32 0.125 0.0 0.0 0.0 0.0 33 0.125 0.0 0.0 0.0 0.0 34 0.125 0.0 0.0 0.0 0.0 35 0.125 0.0 0.0 0.0 0.0 36 0.125 0.0 0.0 0.0 0.0 37 0.125 0.0 0.0 0.0 0.0 38 0.125 0.0 0.0 0.0 0.0 39 0.125 0.0 0.0 0.0 0.0 40 0.125 0.0 0.0 0.0 0.0 41 0.125 0.0 0.0 0.0 0.0 42 0.125 0.0 0.0 0.0 0.0 43 0.125 0.0 0.0 0.0 0.0 44 0.125 0.0 0.0 0.0 0.0 45 0.125 0.0 0.0 0.0 0.0 46 0.125 0.0 0.0 0.0 0.0 47 0.125 0.0 0.0 0.0 0.0 48 0.125 0.0 0.0 0.0 0.0 49 0.125 0.0 0.0 0.0 0.0 50 0.125 0.0 0.0 0.0 0.0 51 0.125 0.0 0.0 0.0 0.0 52 0.125 0.0 0.0 0.0 0.0 53 0.125 0.0 0.0 0.0 0.0 54 0.125 0.0 0.0 0.0 0.0 55 0.125 0.0 0.0 0.0 0.0 56 0.125 0.0 0.0 0.0 0.0 57 0.125 0.0 0.0 0.0 0.0 58 0.125 0.0 0.0 0.0 0.0 59 0.125 0.0 0.0 0.0 0.0 60 0.125 0.0 0.0 0.0 0.0 61 0.125 0.0 0.0 0.0 0.0 62 0.125 0.0 0.0 0.0 0.0 63 0.125 0.0 0.0 0.0 0.0 64 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1032507 spots for SRR11389757.sra Written 1032507 spots for SRR11389757.sra Read 1032507 spots for SRR11389757.sra Written 1032507 spots for SRR11389757.sra Read 1032507 spots for SRR11389757.sra Written 1032507 spots for SRR11389757.sra Read 1032507 spots for SRR11389757.sra Written 1032507 spots for SRR11389757.sra Read 1032507 spots for SRR11389757.sra Written 1032507 spots for SRR11389757.sra Read 1032507 spots for SRR11389757.sra Written 1032507 spots for SRR11389757.sra Read 1032507 spots for SRR11389757.sra Written 1032507 spots for SRR11389757.sra Read 1032507 spots for SRR11389757.sra Written 1032507 spots for SRR11389757.sra Read 1032507 spots for SRR11389757.sra Written 1032507 spots for SRR11389757.sra Read 1032507 spots for SRR11389757.sra Written 1032507 spots for SRR11389757.sra Read 1032507 spots for SRR11389757.sra Written 1032507 spots for SRR11389757.sra Read 1032507 spots for SRR11389757.sra Written 1032507 spots for SRR11389757.sra Read 1032507 spots for SRR11389757.sra Written 1032507 spots for SRR11389757.sra Read 1032507 spots for SRR11389757.sra Written 1032507 spots for SRR11389757.sra Read 1032518 spots for SRR11389757.sra Written 1032518 spots for SRR11389757.sra Read 1032507 spots for SRR11389757.sra Written 1032507 spots for SRR11389757.sra Read 1032507 spots for SRR11389757.sra Written 1032507 spots for SRR11389757.sra Read 1032507 spots for SRR11389757.sra Written 1032507 spots for SRR11389757.sra Read 1032507 spots for SRR11389757.sra Written 1032507 spots for SRR11389757.sra Read 1032507 spots for SRR11389757.sra Written 1032507 spots for SRR11389757.sra SRR ids: ['SRR11389757.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j1x5c783 SRR11389757.sra spots: 20650151 blocks: [[1, 1032507], [1032508, 2065014], [2065015, 3097521], [3097522, 4130028], [4130029, 5162535], [5162536, 6195042], [6195043, 7227549], [7227550, 8260056], [8260057, 9292563], [9292564, 10325070], [10325071, 11357577], [11357578, 12390084], [12390085, 13422591], [13422592, 14455098], [14455099, 15487605], [15487606, 16520112], [16520113, 17552619], [17552620, 18585126], [18585127, 19617633], [19617634, 20650151]] SRR11389757 file size 3903272 SRR11389757 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389757 SRR11389757_1.fastq SRR11389757_2.fastq Input file: SRR11389757_1.fastq Paired file: SRR11389757_2.fastq trimmed: SRR11389757-trimmed-pair1.fastq, SRR11389757-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 04:42:00 2024 >> started Sat Dec 7 04:42:19 2024 >> done (19.265s) 20650151 read pairs processed; of these: 788 ( 0.00%) short read pairs filtered out after trimming by size control 392466 ( 1.90%) empty read pairs filtered out after trimming by size control 20256897 (98.10%) read pairs available; of these: 31327 ( 0.15%) trimmed read pairs available after processing 20225570 (99.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2677 0.01% 19 26 0.00% 20 2951 0.01% 21 25 0.00% 22 3217 0.02% 23 30 0.00% 24 3204 0.02% 25 30 0.00% 26 3135 0.02% 27 23 0.00% 28 2317 0.01% 29 29 0.00% 30 1880 0.01% 31 18 0.00% 32 1367 0.01% 33 26 0.00% 34 976 0.00% 35 242 0.00% 36 1526 0.01% 37 280 0.00% 38 889 0.00% 39 400 0.00% 40 722 0.00% 41 581 0.00% 42 755 0.00% 43 734 0.00% 44 798 0.00% 45 828 0.00% 46 964 0.00% 47 1173 0.01% 48 1307 0.01% 49 1325 0.01% 50 1599 0.01% 51 1687 0.01% 52 2013 0.01% 53 2176 0.01% 54 2318 0.01% 55 2806 0.01% 56 3530 0.02% 57 3682 0.02% 58 3670 0.02% 59 3950 0.02% 60 4238 0.02% 61 4631 0.02% 62 4973 0.02% 63 5390 0.03% 64 6013 0.03% 65 6635 0.03% 66 7133 0.04% 67 7997 0.04% 68 8411 0.04% 69 9199 0.05% 70 10301 0.05% 71 12913 0.06% 72 30971 0.15% 73 195554 0.97% 74 1483488 7.32% 75 9300599 45.91% 76 9096565 44.91% 20256897 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=29 prefix-density=0.54 prefix-fanout=2.1 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=93.84 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=7.5 sequence=TTTTTATTTTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATATG criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.64 fanout-score-rank=14 prefix-density=0.32 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=13 fanout-score=73.17 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=18.3 sequence=CGGCGGCGGCGCCCTCCTCGTCTACAACACCAGCGCTCTCGCCGGCTAATTAAGAATCAAGTCATCTCATTCTCATCTATGCAATTGCAAACACAACACAGGGCCGGGTATCTCTCTGCATGTACGTATGCCTGTAATGTACGTAGCTACCTGCTGTGAAATGTACGTATGTGATCGATGATGCCAAGTACTTGATCGAAACGCATCGCTTAATTTTATGTATGTATAACACTTGCTACTACGTACAC SRR11389757 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 04:42:45 Started mapping on | Dec 07 04:42:45 Finished on | Dec 07 04:45:26 Mapping speed, Million of reads per hour | 452.95 Number of input reads | 20256897 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 15982317 Uniquely mapped reads % | 78.90% Average mapped length | 150.18 Number of splices: Total | 6917470 Number of splices: Annotated (sjdb) | 6546564 Number of splices: GT/AG | 6820768 Number of splices: GC/AG | 83991 Number of splices: AT/AC | 2297 Number of splices: Non-canonical | 10414 Mismatch rate per base, % | 0.53% Deletion rate per base | 0.01% Deletion average length | 1.63 Insertion rate per base | 0.01% Insertion average length | 1.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2301576 % of reads mapped to multiple loci | 11.36% Number of reads mapped to too many loci | 43999 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.65% % of reads unmapped: other | 0.87% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1973004 1973004 1973004 N_multimapping 2301576 2301576 2301576 N_noFeature 749151 15389989 997714 N_ambiguous 488853 4260 159649 UnstrandedReadsAssigned:14744313 PositiveStrandReadsAssigned:588068 NegativeStrandReadsAssigned:14824954 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389757 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389757-trimmed-pair1.fastq SRR11389757-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,256,897 reads, 16,829,708 reads pseudoaligned [quant] estimated average fragment length: 184.5 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,316 rounds 52973 SRR11389757.ke.tsv 35125 SRR11389757.se.tsv 88098 total ==> SRR11389757.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 752.645 0 0 PNS24247 1044 860.5 33.2327 3.15025 PNS24249 1928 1744.5 123.325 5.7665 PNS24246 1044 860.5 33.2327 3.15025 PNS24248 1044 860.5 33.2327 3.15025 PNS24244 1471 1287.5 141.977 8.99499 PNS24243 293 122.117 0 0 KQK14069 1603 1419.5 4720.87 271.28 KQK14071 474 292.309 250.982 70.0375 ==> SRR11389757.se.tsv <== BRADI_1g14170v3 5316 BRADI_1g53295v3 21 BRADI_1g59795v3 331 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 104 BRADI_1g74790v3 166 BRADI_1g09890v3 0 BRADI_1g77505v3 292 BRADI_1g48960v3 0 SRR11389757 completed mapping pipeline successfully