Starting /dee2/code/volunteer_pipeline.sh SRR11389758 current disk space = 1547035652096 free memory = 1601953544 SRR11389758 SRAfilesize d8ec000f46e508aad7803c4670d1b1a6 SRR11389758.sra SRR11389758.sra file validated SRR11389758 is paired end SRR11389758 is conventional basespace SRR11389758 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389758_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.035 32.0 32.0 32.0 32.0 32.0 2 31.0385 32.0 32.0 32.0 32.0 32.0 3 31.1935 32.0 32.0 32.0 32.0 32.0 4 31.202 32.0 32.0 32.0 32.0 32.0 5 31.18475 32.0 32.0 32.0 32.0 32.0 6 34.1405 36.0 36.0 36.0 32.0 36.0 7 34.237 36.0 36.0 36.0 32.0 36.0 8 34.41425 36.0 36.0 36.0 32.0 36.0 9 34.3305 36.0 36.0 36.0 32.0 36.0 10-11 34.371125 36.0 36.0 36.0 32.0 36.0 12-13 34.5655 36.0 36.0 36.0 32.0 36.0 14-15 34.248 36.0 36.0 36.0 32.0 36.0 16-17 34.157250000000005 36.0 36.0 36.0 32.0 36.0 18-19 34.297625 36.0 36.0 36.0 32.0 36.0 20-21 34.2795 36.0 36.0 36.0 32.0 36.0 22-23 34.36 36.0 36.0 36.0 32.0 36.0 24-25 34.155625 36.0 36.0 36.0 32.0 36.0 26-27 34.10125 36.0 36.0 36.0 32.0 36.0 28-29 33.964749999999995 36.0 36.0 36.0 32.0 36.0 30-31 33.844125000000005 36.0 36.0 36.0 32.0 36.0 32-33 33.95025 36.0 36.0 36.0 32.0 36.0 34-35 33.818375 36.0 36.0 36.0 32.0 36.0 36-37 33.90638297872341 36.0 36.0 36.0 32.0 36.0 38-39 33.69799749687109 36.0 36.0 36.0 27.0 36.0 40-41 33.80312891113893 36.0 36.0 36.0 32.0 36.0 42-43 33.81689612015019 36.0 36.0 36.0 32.0 36.0 44-45 33.685356695869835 36.0 36.0 36.0 29.5 36.0 46-47 33.531982234929366 36.0 36.0 36.0 27.0 36.0 48-49 33.42789183775663 36.0 36.0 36.0 21.0 36.0 50-51 33.49787180771157 36.0 36.0 36.0 27.0 36.0 52-53 33.487606409614415 36.0 36.0 36.0 24.0 36.0 54-55 33.114296444667005 36.0 34.0 36.0 21.0 36.0 56-57 33.199924887330994 36.0 36.0 36.0 21.0 36.0 58-59 33.0736536653864 36.0 34.0 36.0 21.0 36.0 60-61 33.139852418568346 36.0 36.0 36.0 20.5 36.0 62-63 32.95776458448026 36.0 32.0 36.0 21.0 36.0 64-65 33.011534037779256 36.0 32.0 36.0 21.0 36.0 66-67 32.99472391519302 36.0 34.0 36.0 21.0 36.0 68-69 32.99623047038537 36.0 32.0 36.0 21.0 36.0 70-71 32.8915368972074 36.0 32.0 36.0 17.5 36.0 72-73 32.81719300930483 36.0 32.0 36.0 21.0 36.0 74-75 32.860129207279186 36.0 32.0 36.0 17.5 36.0 76 31.688297484506016 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 4.0 23 13.0 24 13.0 25 27.0 26 54.0 27 92.0 28 90.0 29 157.0 30 191.0 31 225.0 32 303.0 33 443.0 34 878.0 35 1505.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.94493116395495 13.692115143929911 12.365456821026283 37.997496871088856 2 23.128911138923655 14.843554443053817 34.54317897371715 27.48435544430538 3 21.877346683354194 20.625782227784732 24.20525657071339 33.29161451814768 4 28.1351689612015 23.704630788485606 20.600750938673343 27.55944931163955 5 26.458072590738425 30.112640801001252 21.802252816020026 21.6270337922403 6 22.68716914544996 29.997479203428284 25.586085202924124 21.72926644819763 7 17.972465581977474 25.081351689612013 35.19399249061327 21.752190237797247 8 19.72465581977472 22.503128911138923 29.737171464330416 28.035043804755944 9 22.678347934918648 20.375469336670836 31.83979974968711 25.106382978723403 10-11 24.6433041301627 29.123904881101375 21.777221526908637 24.455569461827285 12-13 23.704630788485606 22.39048811013767 25.594493116395494 28.31038798498123 14-15 22.453066332916144 24.44305381727159 27.359198998748436 25.744680851063826 16-17 24.53066332916145 24.58072590738423 25.244055068836047 25.64455569461827 18-19 24.20525657071339 24.317897371714643 25.46933667083855 26.007509386733418 20-21 24.030037546933666 24.918648310387987 26.020025031289112 25.03128911138924 22-23 23.76720901126408 25.193992490613265 25.00625782227785 26.032540675844807 24-25 23.429286608260323 25.193992490613265 24.718397997496872 26.65832290362954 26-27 23.46683354192741 24.49311639549437 25.544430538172712 26.495619524405505 28-29 24.267834793491865 25.06883604505632 24.6558197747184 26.007509386733418 30-31 22.202753441802255 25.594493116395494 24.90613266583229 27.29662077596996 32-33 23.642052565707132 24.893617021276597 25.043804755944933 26.420525657071337 34-35 24.39299123904881 25.294117647058822 23.9549436795995 26.357947434292868 36-37 24.405506883604506 24.44305381727159 25.256570713391742 25.894868585732166 38-39 24.6433041301627 23.654568210262827 25.193992490613265 26.5081351689612 40-41 24.881101376720903 24.84355444305382 24.155193992490613 26.12015018773467 42-43 24.868585732165208 24.831038798498124 24.780976220275345 25.519399249061326 44-45 23.216520650813514 24.330413016270338 25.46933667083855 26.9837296620776 46-47 25.134560020027536 23.98297659281512 24.671423206909502 26.211040180247842 48-49 24.54932398597897 24.59939909864797 24.349023535302955 26.50225338007011 50-51 24.774661992989483 24.72458688032048 24.661992989484226 25.838758137205808 52-53 24.536805207811717 25.212819228843266 24.636955433149723 25.61342013019529 54-55 24.41161742613921 24.2864296444667 24.68703054581873 26.61492238357536 56-57 24.098647971957938 24.211316975463195 25.363044566850274 26.32699048572859 58-59 24.689966178128522 24.790179130652636 24.001002129525244 26.518852561693603 60-61 24.896629495050746 23.8817190828217 25.184813933091093 26.03683748903646 62-63 25.14414640260717 25.3823013286538 23.7152168463274 25.758335422411633 64-65 25.304075235109718 24.752351097178686 24.739811912225708 25.203761755485893 66-67 25.749404239307665 23.479242443245955 24.582967515364356 26.188385802082024 68-69 24.639317526031864 24.099861999749088 25.392046167356668 25.868774306862374 70-71 25.059635907093536 24.858757062146893 24.318895166352796 25.76271186440678 72-73 24.622166246851386 25.17632241813602 24.571788413098236 25.629722921914354 74-75 24.336870026525197 21.312997347480106 27.16180371352785 27.18832891246684 76 27.925628873496173 0.0 35.72730586948597 36.34706525701786 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 6.0 1 3.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.5 19 3.5 20 2.5 21 4.5 22 5.5 23 4.5 24 3.5 25 3.5 26 6.5 27 13.5 28 17.0 29 18.5 30 21.5 31 24.5 32 29.5 33 36.0 34 53.5 35 69.0 36 96.0 37 129.0 38 133.5 39 143.5 40 162.5 41 175.0 42 189.0 43 194.5 44 206.0 45 210.5 46 203.5 47 205.5 48 191.0 49 173.0 50 166.0 51 151.0 52 132.5 53 117.5 54 113.0 55 128.0 56 122.0 57 106.5 58 111.5 59 114.0 60 114.5 61 116.0 62 113.0 63 107.0 64 90.5 65 82.0 66 83.5 67 75.0 68 61.5 69 55.0 70 49.5 71 43.0 72 44.0 73 37.5 74 32.0 75 35.0 76 31.0 77 22.0 78 17.5 79 12.5 80 11.0 81 9.0 82 5.0 83 3.0 84 1.5 85 1.0 86 1.0 87 1.5 88 3.5 89 4.0 90 1.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.125 3 0.125 4 0.125 5 0.125 6 0.8250000000000001 7 0.125 8 0.125 9 0.125 10-11 0.125 12-13 0.125 14-15 0.125 16-17 0.125 18-19 0.125 20-21 0.125 22-23 0.125 24-25 0.125 26-27 0.125 28-29 0.125 30-31 0.125 32-33 0.125 34-35 0.125 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 5.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 1.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 2.0 58 1.0 59 0.0 60 1.0 61 0.0 62 2.0 63 0.0 64 1.0 65 0.0 66 1.0 67 0.0 68 1.0 69 2.0 70 1.0 71 4.0 72 16.0 73 63.0 74 258.0 75 898.0 76 2743.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.4979633401222 96.72500000000001 2 1.2474541751527495 2.45 3 0.20366598778004072 0.6 4 0.02545824847250509 0.1 5 0.02545824847250509 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389758 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389758_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.81425 32.0 32.0 32.0 32.0 32.0 2 30.56025 32.0 32.0 32.0 32.0 32.0 3 30.509 32.0 32.0 32.0 32.0 32.0 4 30.47175 32.0 32.0 32.0 32.0 32.0 5 30.414 32.0 32.0 32.0 32.0 32.0 6 33.553 36.0 36.0 36.0 21.0 36.0 7 33.85175 36.0 36.0 36.0 32.0 36.0 8 33.61725 36.0 36.0 36.0 32.0 36.0 9 33.56375 36.0 36.0 36.0 21.0 36.0 10-11 33.707375 36.0 36.0 36.0 32.0 36.0 12-13 33.56575 36.0 36.0 36.0 21.0 36.0 14-15 33.608625 36.0 36.0 36.0 26.5 36.0 16-17 33.296875 36.0 36.0 36.0 21.0 36.0 18-19 33.310375 36.0 36.0 36.0 21.0 36.0 20-21 33.357875 36.0 36.0 36.0 21.0 36.0 22-23 33.27875 36.0 36.0 36.0 21.0 36.0 24-25 33.274125 36.0 36.0 36.0 21.0 36.0 26-27 33.357749999999996 36.0 36.0 36.0 21.0 36.0 28-29 33.231625 36.0 36.0 36.0 21.0 36.0 30-31 33.389875 36.0 36.0 36.0 21.0 36.0 32-33 33.304500000000004 36.0 36.0 36.0 21.0 36.0 34-35 33.158249999999995 36.0 36.0 36.0 14.0 36.0 36-37 33.09672172172172 36.0 36.0 36.0 14.0 36.0 38-39 33.318193193193196 36.0 36.0 36.0 21.0 36.0 40-41 33.13663663663664 36.0 36.0 36.0 14.0 36.0 42-43 33.15427927927928 36.0 36.0 36.0 14.0 36.0 44-45 33.11524024024024 36.0 36.0 36.0 14.0 36.0 46-47 32.99672685827254 36.0 36.0 36.0 14.0 36.0 48-49 32.86958698372966 36.0 36.0 36.0 14.0 36.0 50-51 32.85556946182729 36.0 36.0 36.0 14.0 36.0 52-53 32.77709637046308 36.0 36.0 36.0 14.0 36.0 54-55 32.83066332916145 36.0 36.0 36.0 14.0 36.0 56-57 32.60625782227785 36.0 32.0 36.0 14.0 36.0 58-59 32.68253336123787 36.0 32.0 36.0 14.0 36.0 60-61 32.64723916638087 36.0 32.0 36.0 14.0 36.0 62-63 32.4113996715724 36.0 32.0 36.0 14.0 36.0 64-65 32.369446299540385 36.0 32.0 36.0 14.0 36.0 66-67 32.47889265992107 36.0 32.0 36.0 14.0 36.0 68-69 32.39922582688771 36.0 32.0 36.0 14.0 36.0 70-71 32.26974421940085 36.0 32.0 36.0 14.0 36.0 72-73 32.28112419494653 36.0 32.0 36.0 14.0 36.0 74-75 32.38759644065853 36.0 32.0 36.0 14.0 36.0 76 31.13535808023997 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 14.0 16 17.0 17 19.0 18 8.0 19 6.0 20 4.0 21 7.0 22 20.0 23 21.0 24 30.0 25 56.0 26 89.0 27 92.0 28 114.0 29 155.0 30 209.0 31 229.0 32 282.0 33 428.0 34 832.0 35 1363.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.001002004008015 20.140280561122246 10.721442885771543 31.137274549098198 2 30.863579474342927 22.853566958698373 26.433041301627036 19.849812265331664 3 26.476476476476474 25.775775775775777 23.44844844844845 24.2992992992993 4 29.679679679679676 29.629629629629626 17.49249249249249 23.1981981981982 5 29.504504504504503 33.108108108108105 18.56856856856857 18.81881881881882 6 22.02202202202202 35.83583583583583 20.295295295295297 21.846846846846844 7 22.22222222222222 18.01801801801802 35.26026026026026 24.4994994994995 8 23.6986986986987 20.695695695695697 24.774774774774773 30.83083083083083 9 25.7386079118678 23.335002503755632 25.41311967951928 25.51326990485729 10-11 27.962916562265093 27.273866198947633 20.22049611626159 24.54272112252568 12-13 27.119919719016554 21.864024084295032 23.720521826392375 27.29553437029604 14-15 25.13798294029102 25.388861013547416 24.197190165579528 25.275965880582035 16-17 27.63207428786548 23.704354373196136 22.725561551010166 25.938009787928223 18-19 27.054837495294265 24.858827958338562 23.00163132137031 25.08470322499686 20-21 26.826212254103492 24.25761182809172 23.02969552687633 25.886480390928458 22-23 26.66583009160497 25.222738110176934 23.34044422135776 24.770987576860335 24-25 25.19122257053292 25.755485893416928 23.67398119122257 25.379310344827587 26-27 27.260188087774296 24.852664576802507 23.21003134796238 24.677115987460816 28-29 26.282775059591017 24.538953707188558 23.69840672437586 25.479864508844564 30-31 26.34610568494866 24.292511895817682 24.01702980215377 25.344352617079892 32-33 26.8436208839364 23.751095530236636 23.82621760360586 25.57906598222111 34-35 26.9837296620776 24.705882352941178 23.717146433041304 24.593241551939926 36-37 26.72176308539945 25.08139243676434 23.102930127723518 25.093914350112694 38-39 27.08958958958959 25.100100100100097 23.335835835835837 24.474474474474476 40-41 27.540040040040044 24.386886886886888 23.16066066066066 24.91241241241241 42-43 27.470875610672678 25.191030940749094 23.462357509708127 23.8757359388701 44-45 26.240601503759397 23.99749373433584 24.160401002506266 25.601503759398497 46-47 27.398119122257054 24.288401253918497 24.100313479623825 24.213166144200628 48-49 27.797290516808832 23.68289011540391 23.469643753135976 25.05017561465128 50-51 26.92404111306092 23.0383554775633 24.492353973426926 25.545249435948858 52-53 26.111458985597995 25.28490920475892 23.018159048215402 25.585472761427674 54-55 26.495619524405505 25.219023779724658 22.74092615769712 25.544430538172712 56-57 26.433041301627036 25.632040050062578 23.617021276595747 24.317897371714643 58-59 26.54978083907326 24.558547276142768 23.681903569192237 25.209768315591734 60-61 26.79443818113491 24.702492797194036 22.961292747087562 25.541776274583487 62-63 26.604010025062657 25.087719298245613 24.160401002506266 24.14786967418546 64-65 28.030587940328445 23.367180644352516 24.482888303873636 24.119343111445403 66-67 26.344827586206897 24.752351097178686 23.0846394984326 25.818181818181817 68-69 26.518574297188756 24.937248995983936 24.046184738955823 24.497991967871485 70-71 26.94964209468793 23.810121813386914 24.186864247143035 25.05337184478212 72-73 25.634549816896072 24.333880540472283 24.295996969314306 25.735572673317336 74-75 26.826331281776827 21.461065025421462 24.458121487824457 27.254482204977254 76 29.32133483314586 0.0 33.74578177727784 36.932883389576304 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 1.5 17 1.5 18 1.5 19 2.5 20 3.0 21 3.0 22 4.0 23 5.0 24 9.0 25 11.5 26 10.0 27 13.0 28 14.5 29 17.0 30 20.5 31 25.0 32 38.5 33 46.0 34 42.0 35 51.0 36 77.0 37 93.5 38 105.5 39 131.5 40 150.5 41 162.5 42 167.0 43 174.5 44 192.5 45 192.5 46 176.5 47 168.0 48 171.0 49 176.0 50 171.5 51 156.5 52 138.5 53 126.5 54 125.0 55 123.0 56 122.0 57 118.5 58 111.5 59 117.5 60 123.0 61 115.5 62 113.0 63 107.5 64 93.0 65 82.5 66 83.0 67 90.0 68 97.0 69 86.0 70 65.0 71 55.5 72 58.5 73 55.5 74 42.5 75 39.5 76 33.0 77 25.0 78 21.5 79 18.0 80 14.0 81 9.5 82 7.0 83 4.5 84 4.0 85 3.5 86 2.0 87 1.5 88 2.5 89 3.5 90 2.5 91 2.5 92 4.0 93 2.5 94 1.0 95 2.0 96 3.0 97 3.0 98 1.5 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.125 3 0.1 4 0.1 5 0.1 6 0.1 7 0.1 8 0.1 9 0.15 10-11 0.22499999999999998 12-13 0.35000000000000003 14-15 0.35000000000000003 16-17 0.3875 18-19 0.3875 20-21 0.2375 22-23 0.3875 24-25 0.3125 26-27 0.3125 28-29 0.36250000000000004 30-31 0.17500000000000002 32-33 0.1625 34-35 0.125 36-37 0.07507507507507508 38-39 0.0 40-41 0.0 42-43 0.11261261261261261 44-45 0.15015015015015015 46-47 0.20022525341008632 48-49 0.22528160200250313 50-51 0.1501877346683354 52-53 0.0625782227784731 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.06271165182490906 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 4.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 1.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 2.0 58 1.0 59 0.0 60 1.0 61 0.0 62 2.0 63 0.0 64 1.0 65 0.0 66 1.0 67 0.0 68 1.0 69 2.0 70 5.0 71 9.0 72 21.0 73 75.0 74 274.0 75 933.0 76 2667.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.26131424188188 96.075 2 1.4062899514190743 2.75 3 0.1534134492457172 0.44999999999999996 4 0.1534134492457172 0.6 5 0.025568908207619537 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGAAATCAAGGGGCATTACTTGAATGCAACTGCGGGTACATGTGAAGAAATGATGAAGAGAGCTGTTTTTGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1494295 spots for SRR11389758.sra Written 1494295 spots for SRR11389758.sra Read 1494295 spots for SRR11389758.sra Written 1494295 spots for SRR11389758.sra Read 1494295 spots for SRR11389758.sra Written 1494295 spots for SRR11389758.sra Read 1494295 spots for SRR11389758.sra Written 1494295 spots for SRR11389758.sra Read 1494295 spots for SRR11389758.sra Written 1494295 spots for SRR11389758.sra Read 1494295 spots for SRR11389758.sra Written 1494295 spots for SRR11389758.sra Read 1494295 spots for SRR11389758.sra Written 1494295 spots for SRR11389758.sra Read 1494295 spots for SRR11389758.sra Written 1494295 spots for SRR11389758.sra Read 1494295 spots for SRR11389758.sra Written 1494295 spots for SRR11389758.sra Read 1494295 spots for SRR11389758.sra Written 1494295 spots for SRR11389758.sra Read 1494295 spots for SRR11389758.sra Written 1494295 spots for SRR11389758.sra Read 1494295 spots for SRR11389758.sra Written 1494295 spots for SRR11389758.sra Read 1494295 spots for SRR11389758.sra Written 1494295 spots for SRR11389758.sra Read 1494295 spots for SRR11389758.sra Written 1494295 spots for SRR11389758.sra Read 1494310 spots for SRR11389758.sra Written 1494310 spots for SRR11389758.sra Read 1494295 spots for SRR11389758.sra Written 1494295 spots for SRR11389758.sra Read 1494295 spots for SRR11389758.sra Written 1494295 spots for SRR11389758.sra Read 1494295 spots for SRR11389758.sra Written 1494295 spots for SRR11389758.sra Read 1494295 spots for SRR11389758.sra Written 1494295 spots for SRR11389758.sra Read 1494295 spots for SRR11389758.sra Written 1494295 spots for SRR11389758.sra SRR ids: ['SRR11389758.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k7e6hh_4 SRR11389758.sra spots: 29885915 blocks: [[1, 1494295], [1494296, 2988590], [2988591, 4482885], [4482886, 5977180], [5977181, 7471475], [7471476, 8965770], [8965771, 10460065], [10460066, 11954360], [11954361, 13448655], [13448656, 14942950], [14942951, 16437245], [16437246, 17931540], [17931541, 19425835], [19425836, 20920130], [20920131, 22414425], [22414426, 23908720], [23908721, 25403015], [25403016, 26897310], [26897311, 28391605], [28391606, 29885915]] SRR11389758 file size 5695198 SRR11389758 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389758 SRR11389758_1.fastq SRR11389758_2.fastq Input file: SRR11389758_1.fastq Paired file: SRR11389758_2.fastq trimmed: SRR11389758-trimmed-pair1.fastq, SRR11389758-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 04:43:38 2024 >> started Sat Dec 7 04:44:05 2024 >> done (26.328s) 29885915 read pairs processed; of these: 133 ( 0.00%) short read pairs filtered out after trimming by size control 278450 ( 0.93%) empty read pairs filtered out after trimming by size control 29607332 (99.07%) read pairs available; of these: 11126 ( 0.04%) trimmed read pairs available after processing 29596206 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 349 0.00% 19 9 0.00% 20 342 0.00% 21 9 0.00% 22 369 0.00% 23 15 0.00% 24 404 0.00% 25 20 0.00% 26 351 0.00% 27 19 0.00% 28 259 0.00% 29 32 0.00% 30 227 0.00% 31 25 0.00% 32 160 0.00% 33 28 0.00% 34 120 0.00% 35 291 0.00% 36 480 0.00% 37 382 0.00% 38 521 0.00% 39 556 0.00% 40 661 0.00% 41 706 0.00% 42 857 0.00% 43 915 0.00% 44 979 0.00% 45 1169 0.00% 46 1223 0.00% 47 1418 0.00% 48 1516 0.01% 49 1688 0.01% 50 1871 0.01% 51 2029 0.01% 52 2205 0.01% 53 2444 0.01% 54 2481 0.01% 55 3032 0.01% 56 3414 0.01% 57 3654 0.01% 58 3876 0.01% 59 4415 0.01% 60 4730 0.02% 61 4964 0.02% 62 5340 0.02% 63 5689 0.02% 64 6302 0.02% 65 6840 0.02% 66 7326 0.02% 67 8311 0.03% 68 8542 0.03% 69 9455 0.03% 70 10592 0.04% 71 13816 0.05% 72 40373 0.14% 73 269090 0.91% 74 2077459 7.02% 75 13273652 44.83% 76 13809330 46.64% 29607332 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=25 prefix-density=0.40 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.12 sequence-density-rank=9 fanout-score=47.85 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=10.3 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=24 prefix-density=0.40 prefix-fanout=2.3 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=121.28 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=17.2 sequence=CCGCCGCCGCCTCC SRR11389758 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 04:44:40 Started mapping on | Dec 07 04:44:40 Finished on | Dec 07 04:46:45 Mapping speed, Million of reads per hour | 852.69 Number of input reads | 29607332 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 24755399 Uniquely mapped reads % | 83.61% Average mapped length | 150.27 Number of splices: Total | 11523791 Number of splices: Annotated (sjdb) | 10957220 Number of splices: GT/AG | 11375747 Number of splices: GC/AG | 129538 Number of splices: AT/AC | 3720 Number of splices: Non-canonical | 14786 Mismatch rate per base, % | 0.54% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.01% Insertion average length | 1.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3153126 % of reads mapped to multiple loci | 10.65% Number of reads mapped to too many loci | 54641 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.97% % of reads unmapped: other | 0.59% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1698807 1698807 1698807 N_multimapping 3153126 3153126 3153126 N_noFeature 929940 23989273 1236802 N_ambiguous 643981 4233 195462 UnstrandedReadsAssigned:23181478 PositiveStrandReadsAssigned:761893 NegativeStrandReadsAssigned:23323135 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389758 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389758-trimmed-pair1.fastq SRR11389758-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,607,332 reads, 26,400,561 reads pseudoaligned [quant] estimated average fragment length: 196.556 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,205 rounds 52973 SRR11389758.ke.tsv 35125 SRR11389758.se.tsv 88098 total ==> SRR11389758.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 740.623 0 0 PNS24247 1044 848.444 57.3608 3.6744 PNS24249 1928 1732.44 176.564 5.53907 PNS24246 1044 848.444 57.3608 3.6744 PNS24248 1044 848.444 57.3608 3.6744 PNS24244 1471 1275.44 39.354 1.67696 PNS24243 293 112.651 0 0 KQK14069 1603 1407.44 622.052 24.0209 KQK14071 474 280.776 31.801 6.15567 ==> SRR11389758.se.tsv <== BRADI_1g14170v3 737 BRADI_1g53295v3 29 BRADI_1g59795v3 219 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 212 BRADI_1g74790v3 147 BRADI_1g09890v3 0 BRADI_1g77505v3 346 BRADI_1g48960v3 0 SRR11389758 completed mapping pipeline successfully