Starting /dee2/code/volunteer_pipeline.sh SRR11389759 current disk space = 1546842939392 free memory = 1599758956 SRR11389759 SRAfilesize e987ff87adfb9e2cb3d60385a415ee7a SRR11389759.sra SRR11389759.sra file validated SRR11389759 is paired end SRR11389759 is conventional basespace SRR11389759 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389759_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.12625 32.0 32.0 32.0 32.0 32.0 2 31.06975 32.0 32.0 32.0 32.0 32.0 3 31.1395 32.0 32.0 32.0 32.0 32.0 4 31.15775 32.0 32.0 32.0 32.0 32.0 5 31.29025 32.0 32.0 32.0 32.0 32.0 6 34.002 36.0 36.0 36.0 32.0 36.0 7 34.1805 36.0 36.0 36.0 32.0 36.0 8 34.273 36.0 36.0 36.0 32.0 36.0 9 34.3005 36.0 36.0 36.0 32.0 36.0 10-11 34.366 36.0 36.0 36.0 32.0 36.0 12-13 34.353750000000005 36.0 36.0 36.0 32.0 36.0 14-15 34.34525 36.0 36.0 36.0 32.0 36.0 16-17 34.311499999999995 36.0 36.0 36.0 32.0 36.0 18-19 34.3565 36.0 36.0 36.0 32.0 36.0 20-21 34.300749999999994 36.0 36.0 36.0 32.0 36.0 22-23 34.255250000000004 36.0 36.0 36.0 32.0 36.0 24-25 34.141999999999996 36.0 36.0 36.0 32.0 36.0 26-27 34.102374999999995 36.0 36.0 36.0 32.0 36.0 28-29 33.937875 36.0 36.0 36.0 32.0 36.0 30-31 34.041125 36.0 36.0 36.0 32.0 36.0 32-33 33.8665 36.0 36.0 36.0 32.0 36.0 34-35 33.890125 36.0 36.0 36.0 32.0 36.0 36-37 33.928499749121926 36.0 36.0 36.0 32.0 36.0 38-39 33.867285499247366 36.0 36.0 36.0 29.5 36.0 40-41 33.81823883592574 36.0 36.0 36.0 32.0 36.0 42-43 33.97516307074761 36.0 36.0 36.0 32.0 36.0 44-45 33.82037129954842 36.0 36.0 36.0 32.0 36.0 46-47 33.73256397390868 36.0 36.0 36.0 27.0 36.0 48-49 33.612170639899624 36.0 36.0 36.0 27.0 36.0 50-51 33.52082810539523 36.0 36.0 36.0 27.0 36.0 52-53 33.80622489959839 36.0 36.0 36.0 27.0 36.0 54-55 33.49744146684655 36.0 36.0 36.0 27.0 36.0 56-57 33.44701155198393 36.0 36.0 36.0 27.0 36.0 58-59 33.3111994114182 36.0 36.0 36.0 27.0 36.0 60-61 33.41765708093343 36.0 36.0 36.0 27.0 36.0 62-63 33.18178391959799 36.0 32.0 36.0 27.0 36.0 64-65 33.055932478586044 36.0 34.0 36.0 21.0 36.0 66-67 33.09524767020153 36.0 32.0 36.0 24.0 36.0 68-69 33.27449005288341 36.0 34.0 36.0 27.0 36.0 70-71 33.10036866780379 36.0 32.0 36.0 27.0 36.0 72-73 32.92982107205547 36.0 32.0 36.0 21.0 36.0 74-75 33.07298771623135 36.0 36.0 36.0 24.0 36.0 76 31.94219440353461 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 2.0 22 4.0 23 7.0 24 14.0 25 30.0 26 41.0 27 70.0 28 88.0 29 133.0 30 165.0 31 225.0 32 320.0 33 475.0 34 764.0 35 1646.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.30205720020071 13.572503763171099 12.794781736076267 37.330657300551934 2 25.79026593075765 13.998996487706975 33.44204716507777 26.768690416457602 3 22.32814851981937 21.475163070747616 22.428499749121926 33.76818866031109 4 27.74711490215755 27.87255393878575 19.292523833416958 25.087807325639737 5 27.972905168088307 29.578524836929255 21.24937280481686 21.19919719016558 6 23.846933603649266 31.170805879371517 23.846933603649266 21.135326913329955 7 19.593577521324637 23.557451078775713 34.169593577521326 22.679377822378324 8 20.84796788760662 22.12744606121425 29.377822378324137 27.64676367285499 9 22.403411941796286 20.873055694932262 30.356246864024083 26.367285499247366 10-11 24.711490215755145 29.114400401404914 21.04867034621174 25.1254390366282 12-13 24.372804816859006 22.942799799297543 24.611138986452584 28.073256397390868 14-15 23.79578524836929 24.498243853487207 25.062719518314097 26.6432513798294 16-17 24.623682890115404 24.234821876567988 24.25990968389363 26.881585549422983 18-19 24.811841445057702 23.89613647767185 24.510787757150023 26.781234320120422 20-21 24.636226793778224 23.833416959357752 25.401404917210236 26.128951329653788 22-23 24.912192674360263 24.711490215755145 24.636226793778224 25.74009031610637 24-25 24.07175112895133 23.75815353738083 25.01254390366282 27.157551430005018 26-27 24.12192674360261 24.96236828901154 25.05017561465128 25.865529352734573 28-29 25.965880582037133 25.0 23.130958354239837 25.90316106372303 30-31 24.586051179126944 24.67385850476668 24.12192674360261 26.61816357250376 32-33 24.197190165579528 24.523331660812843 24.94982438534872 26.329653788258906 34-35 25.639739086803814 24.172102358253888 24.172102358253888 26.01605619668841 36-37 25.22579026593076 24.598595082789764 23.98394380331159 26.191670847967885 38-39 24.686402408429505 25.514300050175613 23.75815353738083 26.04114400401405 40-41 25.664826894129455 25.67737079779227 22.96788760662318 25.68991470145509 42-43 24.197190165579528 24.8745609633718 24.648770697441044 26.27947817360763 44-45 25.062719518314097 24.184646261916708 24.13447064726543 26.61816357250376 46-47 25.965880582037133 25.35122930255896 22.9177119919719 25.765178123432015 48-49 24.37892095357591 25.01882057716437 23.626097867001256 26.97616060225847 50-51 25.332496863237143 24.07779171894605 24.278544542032623 26.311166875784192 52-53 25.376506024096386 22.92921686746988 23.33082329317269 28.363453815261042 54-55 24.35044558805071 24.601481109577005 23.798167440692858 27.24990586167943 56-57 25.53992968357609 23.34254143646409 24.37217478653943 26.745354093420392 58-59 25.291975386160992 24.56360668089916 23.97337686801457 26.171041064925276 60-61 24.88380856676297 24.632583846250473 24.368797889712347 26.11480969727421 62-63 24.798994974874372 24.87437185929648 23.944723618090453 26.38190954773869 64-65 25.26077667462612 24.16739977378409 24.06685936910896 26.504964182480833 66-67 24.962254655259184 24.05636638147962 23.88022143935581 27.101157523905385 68-69 25.87509443465122 24.011583983883153 23.885671115588014 26.227650465877613 70-71 25.324266465180706 24.7072157159048 23.724971666037025 26.24354615287747 72-73 25.37653461587141 24.22478167320592 23.84508290089862 26.553600810024047 74-75 26.542880042746457 20.504942559444295 25.35399412236174 27.598183275447504 76 28.865979381443296 0.0 31.81148748159057 39.32253313696613 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 14.0 1 7.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 3.5 19 6.5 20 8.5 21 11.0 22 10.0 23 6.5 24 4.5 25 5.0 26 9.0 27 14.0 28 15.5 29 18.0 30 25.0 31 31.0 32 39.0 33 44.5 34 47.0 35 62.0 36 81.0 37 94.0 38 114.0 39 135.0 40 142.5 41 145.0 42 149.0 43 178.0 44 197.0 45 185.5 46 188.5 47 204.0 48 196.5 49 168.0 50 146.0 51 131.0 52 121.5 53 116.5 54 113.0 55 124.0 56 128.5 57 121.0 58 122.0 59 129.5 60 121.0 61 112.0 62 116.0 63 105.5 64 112.0 65 107.0 66 88.5 67 93.5 68 88.5 69 74.5 70 67.0 71 63.5 72 60.0 73 47.5 74 41.0 75 41.0 76 36.0 77 28.5 78 15.5 79 8.5 80 8.5 81 8.0 82 5.0 83 2.5 84 5.5 85 6.0 86 3.0 87 2.0 88 1.0 89 0.0 90 1.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.35000000000000003 3 0.35000000000000003 4 0.35000000000000003 5 0.35000000000000003 6 1.35 7 0.35000000000000003 8 0.35000000000000003 9 0.35000000000000003 10-11 0.35000000000000003 12-13 0.35000000000000003 14-15 0.35000000000000003 16-17 0.35000000000000003 18-19 0.35000000000000003 20-21 0.35000000000000003 22-23 0.35000000000000003 24-25 0.35000000000000003 26-27 0.35000000000000003 28-29 0.35000000000000003 30-31 0.35000000000000003 32-33 0.35000000000000003 34-35 0.35000000000000003 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 14.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 1.0 48 0.0 49 0.0 50 0.0 51 1.0 52 0.0 53 0.0 54 1.0 55 1.0 56 0.0 57 0.0 58 1.0 59 0.0 60 1.0 61 0.0 62 0.0 63 0.0 64 3.0 65 2.0 66 2.0 67 2.0 68 0.0 69 0.0 70 1.0 71 12.0 72 15.0 73 64.0 74 272.0 75 891.0 76 2716.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.0 #Duplication Level Percentage of deduplicated Percentage of total 1 97.16145833333333 93.27499999999999 2 2.2395833333333335 4.3 3 0.4427083333333333 1.275 4 0.026041666666666668 0.1 5 0.026041666666666668 0.125 6 0.026041666666666668 0.15 7 0.0 0.0 8 0.026041666666666668 0.2 9 0.026041666666666668 0.22499999999999998 >10 0.026041666666666668 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 14 0.35000000000000003 No Hit CAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGG 9 0.22499999999999998 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 8 0.2 TruSeq Adapter, Index 1 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 6 0.15 TruSeq Adapter, Index 1 (97% over 36bp) GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389759 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389759_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.6765 32.0 32.0 32.0 32.0 32.0 2 30.44325 32.0 32.0 32.0 32.0 32.0 3 30.4525 32.0 32.0 32.0 32.0 32.0 4 30.25075 32.0 32.0 32.0 21.0 32.0 5 30.33775 32.0 32.0 32.0 21.0 32.0 6 33.59225 36.0 36.0 36.0 21.0 36.0 7 33.68025 36.0 36.0 36.0 32.0 36.0 8 33.56975 36.0 36.0 36.0 32.0 36.0 9 33.5245 36.0 36.0 36.0 21.0 36.0 10-11 33.533625 36.0 36.0 36.0 21.0 36.0 12-13 33.583375000000004 36.0 36.0 36.0 26.5 36.0 14-15 33.448125000000005 36.0 36.0 36.0 21.0 36.0 16-17 33.358374999999995 36.0 36.0 36.0 21.0 36.0 18-19 33.379125 36.0 36.0 36.0 24.0 36.0 20-21 33.258250000000004 36.0 36.0 36.0 17.5 36.0 22-23 33.184625 36.0 36.0 36.0 17.5 36.0 24-25 33.17125 36.0 36.0 36.0 21.0 36.0 26-27 33.172 36.0 36.0 36.0 17.5 36.0 28-29 33.191125 36.0 36.0 36.0 21.0 36.0 30-31 33.172625 36.0 36.0 36.0 17.5 36.0 32-33 33.172625 36.0 36.0 36.0 14.0 36.0 34-35 32.888125 36.0 36.0 36.0 14.0 36.0 36-37 33.23714572360171 36.0 36.0 36.0 14.0 36.0 38-39 33.14961123651868 36.0 36.0 36.0 14.0 36.0 40-41 33.11700526711813 36.0 36.0 36.0 14.0 36.0 42-43 33.05630800100326 36.0 36.0 36.0 14.0 36.0 44-45 33.01555053925257 36.0 36.0 36.0 14.0 36.0 46-47 33.11763230499122 36.0 36.0 36.0 14.0 36.0 48-49 32.93389362769694 36.0 36.0 36.0 14.0 36.0 50-51 33.04791771199197 36.0 36.0 36.0 14.0 36.0 52-53 32.90752823086575 36.0 36.0 36.0 14.0 36.0 54-55 32.84541626354854 36.0 36.0 36.0 14.0 36.0 56-57 32.59954807933718 36.0 34.0 36.0 14.0 36.0 58-59 32.78769599401171 36.0 36.0 36.0 14.0 36.0 60-61 32.50647516310208 36.0 32.0 36.0 14.0 36.0 62-63 32.40944486309972 36.0 32.0 36.0 14.0 36.0 64-65 32.306844767547815 36.0 32.0 36.0 14.0 36.0 66-67 32.44012514948777 36.0 32.0 36.0 14.0 36.0 68-69 32.37465391391895 36.0 32.0 36.0 14.0 36.0 70-71 32.282761266479156 36.0 32.0 36.0 14.0 36.0 72-73 32.216041889332296 36.0 32.0 36.0 14.0 36.0 74-75 32.394567282406015 36.0 32.0 36.0 14.0 36.0 76 31.278421433743663 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 3.0 15 22.0 16 18.0 17 14.0 18 17.0 19 6.0 20 13.0 21 16.0 22 22.0 23 30.0 24 30.0 25 48.0 26 52.0 27 90.0 28 127.0 29 161.0 30 194.0 31 210.0 32 274.0 33 395.0 34 752.0 35 1493.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.14572360170554 18.159016804615 12.942061700526711 31.753197893152745 2 32.35515425131678 19.964885879107097 26.787057938299476 20.89290193127665 3 26.410835214446955 25.93428643090043 22.648607975921745 25.00627037873088 4 30.02257336343115 29.0694757963381 17.306245297215952 23.6017055430148 5 31.176323049912213 29.520943064961124 19.011788312014048 20.290945573112616 6 23.45121645347379 33.759719087032856 20.31602708803612 22.473037371457234 7 24.028091296714322 16.75445196889892 33.73463757210936 25.482819162277405 8 24.354150990719837 22.422874341610232 23.325808878856282 29.897165788813645 9 25.19447929736512 20.351317440401505 25.646173149309913 28.80803011292346 10-11 28.029637071455483 26.761270877809874 19.063167148059776 26.14592490267487 12-13 27.985919034448077 21.410611013326626 22.881569021875787 27.72190093034951 14-15 27.301307847082494 23.390342052313883 23.541247484909455 25.767102615694164 16-17 26.666666666666668 23.245283018867923 21.962264150943398 28.125786163522015 18-19 27.480820022638664 23.16689724562948 22.953087661929317 26.399195069802538 20-21 27.327553712777984 23.82208820203543 23.457720819198393 25.39263726598819 22-23 28.251572327044027 24.150943396226417 22.18867924528302 25.40880503144654 24-25 26.778979129997488 24.176514961025898 22.73070153381946 26.31380437515715 26-27 27.508171988936386 24.779984913251194 21.800352024138796 25.911491073673627 28-29 28.034209533392023 23.154320211294177 23.053703936611747 25.757766318702053 30-31 26.92018072289157 24.272088353413654 22.979417670682732 25.82831325301205 32-33 27.716436637390213 23.776662484316187 23.588456712672524 24.91844416562108 34-35 28.277505959101745 23.94931627148413 22.707314013298205 25.06586375611592 36-37 27.397088353413658 23.569277108433734 22.89156626506024 26.142068273092367 38-39 27.79031853523953 23.82743917732631 23.100075244544772 25.28216704288939 40-41 28.66817155756208 23.526460998244296 22.34762979683973 25.457737647353902 42-43 26.821608040201006 23.9321608040201 23.417085427135678 25.829145728643216 44-45 26.783919597989954 24.170854271356784 23.253768844221106 25.791457286432163 46-47 26.13450659962288 24.70144563167819 22.727844123192963 26.436203645505973 48-49 25.962264150943398 24.138364779874212 23.484276729559745 26.41509433962264 50-51 27.571033442293185 23.83706311289917 23.133014835302994 25.458888609504655 52-53 28.196433057020847 23.901029891986937 21.602612408942477 26.29992464204974 54-55 26.138787802735603 24.243945287990964 23.716902999121597 25.900363910151835 56-57 26.713532513181022 24.47903590258599 22.92242028621642 25.88501129801657 58-59 27.419962335216574 24.369114877589453 23.00062774639046 25.210295040803516 60-61 26.899409770187116 24.81476830340324 23.295240487253547 24.9905814391561 62-63 27.405174579251444 23.574478774177344 23.260487314745042 25.759859331826174 64-65 27.40294006784772 23.369770071617037 22.804372408594045 26.422917451941196 66-67 27.257861635220127 23.68553459119497 23.81132075471698 25.245283018867926 68-69 25.95766129032258 24.647177419354836 22.555443548387096 26.83971774193548 70-71 27.443324937027707 23.916876574307306 23.085642317380355 25.554156171284635 72-73 26.983926085305658 23.338817871155552 23.32616124541197 26.351094798126816 74-75 26.356589147286826 21.344560278000536 24.685912857524723 27.61293771718792 76 30.40956868430591 0.0 31.786879304095688 37.803552011598406 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 13.0 1 6.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 1.5 16 2.5 17 3.0 18 2.5 19 3.5 20 5.0 21 4.0 22 2.5 23 2.0 24 3.5 25 7.0 26 10.5 27 14.0 28 18.0 29 18.5 30 18.0 31 21.0 32 27.5 33 32.0 34 43.0 35 64.0 36 80.5 37 94.5 38 103.0 39 111.5 40 134.5 41 146.0 42 147.5 43 174.5 44 191.5 45 164.0 46 146.0 47 155.0 48 151.5 49 143.0 50 142.5 51 133.0 52 117.0 53 120.0 54 125.0 55 122.0 56 123.5 57 118.0 58 109.5 59 123.0 60 144.0 61 146.0 62 143.5 63 135.5 64 122.5 65 111.5 66 105.5 67 99.0 68 91.0 69 83.5 70 76.0 71 71.5 72 70.0 73 72.0 74 61.5 75 49.5 76 34.0 77 23.0 78 24.0 79 21.5 80 18.0 81 13.5 82 12.0 83 10.5 84 5.5 85 2.0 86 3.0 87 4.5 88 3.5 89 3.0 90 3.0 91 1.0 92 0.0 93 1.0 94 1.5 95 1.5 96 2.0 97 1.5 98 1.5 99 5.0 100 8.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.325 3 0.325 4 0.325 5 0.325 6 0.325 7 0.325 8 0.325 9 0.375 10-11 0.46249999999999997 12-13 0.575 14-15 0.6 16-17 0.625 18-19 0.6125 20-21 0.5125000000000001 22-23 0.625 24-25 0.575 26-27 0.575 28-29 0.6125 30-31 0.4 32-33 0.375 34-35 0.36250000000000004 36-37 0.07524454477050413 38-39 0.0 40-41 0.0 42-43 0.17557060446450964 44-45 0.17557060446450964 46-47 0.2382743917732631 48-49 0.27596588058203714 50-51 0.22579026593075763 52-53 0.10037641154328732 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.12584948401711551 70-71 0.0 72-73 0.0 74-75 0.04008016032064128 76 0.10861694424330195 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 13.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 1.0 48 0.0 49 0.0 50 0.0 51 1.0 52 0.0 53 0.0 54 1.0 55 1.0 56 0.0 57 0.0 58 1.0 59 0.0 60 1.0 61 0.0 62 0.0 63 0.0 64 3.0 65 2.0 66 2.0 67 1.0 68 0.0 69 0.0 70 6.0 71 7.0 72 19.0 73 70.0 74 257.0 75 852.0 76 2762.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.475 #Duplication Level Percentage of deduplicated Percentage of total 1 97.43456854107282 94.0 2 2.0212490282456597 3.9 3 0.38870173620108833 1.125 4 0.051826898160145116 0.2 5 0.051826898160145116 0.25 6 0.0 0.0 7 0.0 0.0 8 0.025913449080072558 0.2 9 0.0 0.0 >10 0.025913449080072558 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 13 0.325 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit GCTATTTATAAATCACAGGCGGAAACCGGTGAAATCAAGGGGCATTACTTGAATGCAACTGCGGGTACATGTGA 5 0.125 No Hit GGGAACGCGAAATCACTTTAGGTTTTGTTGATTTATTGCGCGACGATTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1673855 spots for SRR11389759.sra Written 1673855 spots for SRR11389759.sra Read 1673855 spots for SRR11389759.sra Written 1673855 spots for SRR11389759.sra Read 1673855 spots for SRR11389759.sra Written 1673855 spots for SRR11389759.sra Read 1673855 spots for SRR11389759.sra Written 1673855 spots for SRR11389759.sra Read 1673855 spots for SRR11389759.sra Written 1673855 spots for SRR11389759.sra Read 1673864 spots for SRR11389759.sra Written 1673864 spots for SRR11389759.sra Read 1673855 spots for SRR11389759.sra Written 1673855 spots for SRR11389759.sra Read 1673855 spots for SRR11389759.sra Written 1673855 spots for SRR11389759.sra Read 1673855 spots for SRR11389759.sra Written 1673855 spots for SRR11389759.sra Read 1673855 spots for SRR11389759.sra Written 1673855 spots for SRR11389759.sra Read 1673855 spots for SRR11389759.sra Written 1673855 spots for SRR11389759.sra Read 1673855 spots for SRR11389759.sra Written 1673855 spots for SRR11389759.sra Read 1673855 spots for SRR11389759.sra Written 1673855 spots for SRR11389759.sra Read 1673855 spots for SRR11389759.sra Written 1673855 spots for SRR11389759.sra Read 1673855 spots for SRR11389759.sra Written 1673855 spots for SRR11389759.sra Read 1673855 spots for SRR11389759.sra Written 1673855 spots for SRR11389759.sra Read 1673855 spots for SRR11389759.sra Written 1673855 spots for SRR11389759.sra Read 1673855 spots for SRR11389759.sra Written 1673855 spots for SRR11389759.sra Read 1673855 spots for SRR11389759.sra Written 1673855 spots for SRR11389759.sra Read 1673855 spots for SRR11389759.sra Written 1673855 spots for SRR11389759.sra SRR ids: ['SRR11389759.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_er3wr0l8 SRR11389759.sra spots: 33477109 blocks: [[1, 1673855], [1673856, 3347710], [3347711, 5021565], [5021566, 6695420], [6695421, 8369275], [8369276, 10043130], [10043131, 11716985], [11716986, 13390840], [13390841, 15064695], [15064696, 16738550], [16738551, 18412405], [18412406, 20086260], [20086261, 21760115], [21760116, 23433970], [23433971, 25107825], [25107826, 26781680], [26781681, 28455535], [28455536, 30129390], [30129391, 31803245], [31803246, 33477109]] SRR11389759 file size 6374303 SRR11389759 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389759 SRR11389759_1.fastq SRR11389759_2.fastq Input file: SRR11389759_1.fastq Paired file: SRR11389759_2.fastq trimmed: SRR11389759-trimmed-pair1.fastq, SRR11389759-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 04:58:17 2024 >> started Sat Dec 7 04:58:46 2024 >> done (28.942s) 33477109 read pairs processed; of these: 326 ( 0.00%) short read pairs filtered out after trimming by size control 444220 ( 1.33%) empty read pairs filtered out after trimming by size control 33032563 (98.67%) read pairs available; of these: 20273 ( 0.06%) trimmed read pairs available after processing 33012290 (99.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1077 0.00% 19 24 0.00% 20 1155 0.00% 21 34 0.00% 22 1192 0.00% 23 46 0.00% 24 1191 0.00% 25 36 0.00% 26 1123 0.00% 27 38 0.00% 28 865 0.00% 29 26 0.00% 30 656 0.00% 31 28 0.00% 32 454 0.00% 33 32 0.00% 34 364 0.00% 35 470 0.00% 36 1041 0.00% 37 614 0.00% 38 925 0.00% 39 777 0.00% 40 990 0.00% 41 999 0.00% 42 1168 0.00% 43 1333 0.00% 44 1462 0.00% 45 1624 0.00% 46 1757 0.01% 47 1921 0.01% 48 2226 0.01% 49 2450 0.01% 50 2605 0.01% 51 2907 0.01% 52 3038 0.01% 53 3472 0.01% 54 3918 0.01% 55 4558 0.01% 56 4807 0.01% 57 5335 0.02% 58 5714 0.02% 59 6010 0.02% 60 6659 0.02% 61 6914 0.02% 62 7550 0.02% 63 8142 0.02% 64 9021 0.03% 65 9613 0.03% 66 10475 0.03% 67 11667 0.04% 68 12167 0.04% 69 13401 0.04% 70 15076 0.05% 71 18587 0.06% 72 50942 0.15% 73 298335 0.90% 74 2222244 6.73% 75 14503535 43.91% 76 15757773 47.70% 33032563 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=22 prefix-density=0.68 prefix-fanout=2.0 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=31 fanout-score=10.37 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=5.1 sequence=CTTCTTCTCCGGGTCC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=38 prefix-density=0.42 prefix-fanout=2.0 sequence=GACGCCTATGTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=9.53 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.1 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGCTCCTTTCCA SRR11389759 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 04:59:35 Started mapping on | Dec 07 04:59:36 Finished on | Dec 07 05:02:59 Mapping speed, Million of reads per hour | 585.80 Number of input reads | 33032563 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 27046513 Uniquely mapped reads % | 81.88% Average mapped length | 150.31 Number of splices: Total | 11211221 Number of splices: Annotated (sjdb) | 10747758 Number of splices: GT/AG | 11064904 Number of splices: GC/AG | 129532 Number of splices: AT/AC | 3029 Number of splices: Non-canonical | 13756 Mismatch rate per base, % | 0.51% Deletion rate per base | 0.01% Deletion average length | 1.68 Insertion rate per base | 0.01% Insertion average length | 1.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3678347 % of reads mapped to multiple loci | 11.14% Number of reads mapped to too many loci | 65809 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.17% % of reads unmapped: other | 0.62% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2307703 2307703 2307703 N_multimapping 3678347 3678347 3678347 N_noFeature 774758 26304522 1024185 N_ambiguous 677164 3237 195277 UnstrandedReadsAssigned:25594591 PositiveStrandReadsAssigned:738754 NegativeStrandReadsAssigned:25827051 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389759 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389759-trimmed-pair1.fastq SRR11389759-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,032,563 reads, 29,474,119 reads pseudoaligned [quant] estimated average fragment length: 192.19 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52973 SRR11389759.ke.tsv 35125 SRR11389759.se.tsv 88098 total ==> SRR11389759.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 745.03 0 0 PNS24247 1044 852.81 35.5567 1.89246 PNS24249 1928 1736.81 147.042 3.84278 PNS24246 1044 852.81 35.5567 1.89246 PNS24248 1044 852.81 35.5567 1.89246 PNS24244 1471 1279.81 30.288 1.07419 PNS24243 293 116.716 0 0 KQK14069 1603 1411.81 1312.97 42.2119 KQK14071 474 284.917 150.834 24.0292 ==> SRR11389759.se.tsv <== BRADI_1g14170v3 1597 BRADI_1g53295v3 8 BRADI_1g59795v3 696 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 189 BRADI_1g74790v3 70 BRADI_1g09890v3 0 BRADI_1g77505v3 236 BRADI_1g48960v3 0 SRR11389759 completed mapping pipeline successfully