Starting /dee2/code/volunteer_pipeline.sh SRR11389760 current disk space = 1546842939392 free memory = 1599758956 SRR11389760 SRAfilesize 53b7499555b908d9951cfd38730c8c5d SRR11389760.sra SRR11389760.sra file validated SRR11389760 is paired end SRR11389760 is conventional basespace SRR11389760 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389760_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.24025 32.0 32.0 32.0 32.0 32.0 2 31.16225 32.0 32.0 32.0 32.0 32.0 3 31.20375 32.0 32.0 32.0 32.0 32.0 4 31.295 32.0 32.0 32.0 32.0 32.0 5 31.23725 32.0 32.0 32.0 32.0 32.0 6 34.29275 36.0 36.0 36.0 32.0 36.0 7 34.4965 36.0 36.0 36.0 32.0 36.0 8 34.43 36.0 36.0 36.0 32.0 36.0 9 34.5535 36.0 36.0 36.0 32.0 36.0 10-11 34.411125 36.0 36.0 36.0 32.0 36.0 12-13 34.504875 36.0 36.0 36.0 32.0 36.0 14-15 34.412375 36.0 36.0 36.0 32.0 36.0 16-17 34.335750000000004 36.0 36.0 36.0 32.0 36.0 18-19 34.433375 36.0 36.0 36.0 32.0 36.0 20-21 34.394125 36.0 36.0 36.0 32.0 36.0 22-23 34.428875 36.0 36.0 36.0 32.0 36.0 24-25 34.417500000000004 36.0 36.0 36.0 32.0 36.0 26-27 34.283125 36.0 36.0 36.0 32.0 36.0 28-29 34.147875 36.0 36.0 36.0 32.0 36.0 30-31 34.071875000000006 36.0 36.0 36.0 32.0 36.0 32-33 34.224000000000004 36.0 36.0 36.0 32.0 36.0 34-35 34.06975 36.0 36.0 36.0 32.0 36.0 36-37 34.143935965231925 36.0 36.0 36.0 32.0 36.0 38-39 33.8951975987994 36.0 36.0 36.0 29.5 36.0 40-41 33.94897448724362 36.0 36.0 36.0 32.0 36.0 42-43 33.95785392696348 36.0 36.0 36.0 32.0 36.0 44-45 34.00862931465733 36.0 36.0 36.0 32.0 36.0 46-47 33.79764882441221 36.0 36.0 36.0 29.5 36.0 48-49 33.70485242621311 36.0 36.0 36.0 27.0 36.0 50-51 33.69259629814907 36.0 36.0 36.0 27.0 36.0 52-53 33.869788597075626 36.0 36.0 36.0 29.5 36.0 54-55 33.44570928196147 36.0 36.0 36.0 27.0 36.0 56-57 33.591429084955145 36.0 36.0 36.0 27.0 36.0 58-59 33.28117175763646 36.0 36.0 36.0 27.0 36.0 60-61 33.48447282744803 36.0 36.0 36.0 27.0 36.0 62-63 33.1121963436013 36.0 32.0 36.0 27.0 36.0 64-65 33.150137741046834 36.0 32.0 36.0 27.0 36.0 66-67 33.150137741046834 36.0 34.0 36.0 27.0 36.0 68-69 33.25081433224756 36.0 34.0 36.0 27.0 36.0 70-71 33.0698461298683 36.0 34.0 36.0 24.0 36.0 72-73 33.23033339864754 36.0 36.0 36.0 27.0 36.0 74-75 33.11294017607604 36.0 34.0 36.0 24.0 36.0 76 31.8091962346126 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 3.0 22 2.0 23 3.0 24 9.0 25 20.0 26 42.0 27 71.0 28 83.0 29 127.0 30 169.0 31 239.0 32 324.0 33 436.0 34 877.0 35 1593.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.73343335833959 14.553638409602401 11.677919479869967 40.03500875218805 2 23.680920230057513 14.928732183045762 34.883720930232556 26.506626656664167 3 22.43060765191298 21.280320080020005 22.55563890972743 33.73343335833959 4 27.33183295823956 28.08202050512628 18.629657414353588 25.95648912228057 5 26.806701675418854 31.58289572393098 20.855213803450862 20.7551887971993 6 22.728416813491066 32.19229801157815 22.92977598791845 22.149509187012335 7 18.929732433108278 23.305826456614152 35.95898974743686 21.80545136284071 8 20.005001250312578 21.705426356589147 29.782445611402853 28.507126781695426 9 21.005251312828207 19.604901225306325 30.75768942235559 28.632158039509875 10-11 23.943485871467868 28.75718929732433 21.780445111277817 25.51887971992998 12-13 23.95598899724931 22.918229557389346 25.081270317579396 28.044511127781945 14-15 23.843460865216304 24.58114528632158 25.581395348837212 25.993998499624904 16-17 24.756189047261813 24.50612653163291 24.131032758189548 26.60665166291573 18-19 23.868467116779193 24.406101525381345 24.593648412103025 27.131782945736433 20-21 24.88122030507627 24.518629657414355 24.656164041010253 25.943985996499126 22-23 24.093523380845213 25.393848462115532 24.618654663665918 25.893973493373345 24-25 24.55613903475869 24.90622655663916 24.293573393348336 26.244061015253813 26-27 24.131032758189548 25.568892223055762 23.918479619904975 26.38159539884971 28-29 24.48112028007002 25.656414103525883 24.643660915228807 25.218804701175294 30-31 24.943735933983497 24.218554638659665 24.131032758189548 26.70667666916729 32-33 24.718679669917478 25.168792198049513 25.056264066016503 25.056264066016503 34-35 25.168792198049513 24.981245311327832 23.3183295823956 26.531632908227053 36-37 24.759284731774414 24.496686257346507 24.534200325121923 26.20982868575716 38-39 23.761880940470235 25.025012506253123 24.387193596798397 26.825912956478238 40-41 24.96248124062031 24.16208104052026 24.049524762381193 26.825912956478238 42-43 25.400200100050025 23.82441220610305 24.88744372186093 25.887943971985994 44-45 24.19959979989995 24.69984992496248 24.674837418709355 26.425712856428213 46-47 24.88744372186093 24.72486243121561 23.449224612306153 26.93846923461731 48-49 24.137068534267133 24.79989994997499 23.56178089044522 27.501250625312657 50-51 25.30015007503752 23.92446223111556 23.936968484242122 26.8384192096048 52-53 24.590368980612883 24.86554096310194 23.85240775484678 26.691682301438398 54-55 24.043032274205654 25.056292219164373 24.130597948461347 26.770077558168627 56-57 24.41191191191191 23.923923923923923 23.986486486486484 27.677677677677675 58-59 25.475713570355534 23.948422633950926 24.3114672008012 26.264396594892336 60-61 24.242424242424242 23.67893814174806 24.74330077635863 27.335336839469072 62-63 24.36764337590784 24.292511895817682 24.467818682694716 26.872026045579766 64-65 25.90783871775607 24.355121462559477 24.36764337590784 25.36939644377661 66-67 24.830954169797145 24.793388429752067 23.816679188580014 26.558978211870777 68-69 24.65547481834127 24.40491104986219 24.36732648459033 26.572287647206217 70-71 24.316871396339934 24.592629731762347 23.790423665078965 27.300075206818754 72-73 26.075471698113205 23.836477987421382 23.572327044025158 26.51572327044025 74-75 25.357142857142854 21.256613756613756 25.29100529100529 28.095238095238095 76 27.7335264301231 0.0 33.562635771180304 38.7038377986966 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 2.0 19 3.0 20 4.5 21 7.0 22 6.5 23 5.0 24 6.0 25 7.0 26 8.5 27 9.5 28 12.0 29 16.5 30 19.5 31 27.5 32 36.5 33 42.0 34 47.0 35 59.0 36 78.5 37 97.0 38 120.0 39 135.5 40 135.5 41 153.5 42 180.5 43 199.0 44 223.5 45 219.0 46 207.5 47 202.5 48 192.0 49 183.5 50 171.5 51 158.0 52 141.5 53 128.0 54 114.5 55 120.0 56 118.0 57 107.5 58 112.5 59 112.0 60 115.0 61 113.5 62 98.0 63 93.5 64 93.5 65 93.0 66 97.0 67 99.0 68 87.0 69 71.5 70 61.5 71 49.5 72 47.0 73 44.0 74 39.0 75 38.5 76 30.5 77 24.5 78 19.0 79 11.0 80 8.0 81 6.5 82 5.5 83 4.5 84 5.0 85 4.0 86 2.0 87 1.0 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.675 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 1.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 1.0 53 0.0 54 0.0 55 0.0 56 2.0 57 1.0 58 0.0 59 1.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 2.0 68 0.0 69 1.0 70 2.0 71 4.0 72 18.0 73 58.0 74 256.0 75 890.0 76 2762.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.2129180495277 96.175 2 1.582844013275466 3.1 3 0.15317845289762574 0.44999999999999996 4 0.025529742149604292 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025529742149604292 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 19 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.025 58 0.0 0.0 0.0 0.0 0.025 59 0.0 0.0 0.0 0.0 0.025 60 0.0 0.0 0.0 0.0 0.025 61 0.0 0.0 0.0 0.0 0.025 62 0.0 0.0 0.0 0.0 0.025 63 0.0 0.0 0.0 0.0 0.025 64 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389760 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389760_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.927 32.0 32.0 32.0 32.0 32.0 2 30.631 32.0 32.0 32.0 32.0 32.0 3 30.5395 32.0 32.0 32.0 32.0 32.0 4 30.6765 32.0 32.0 32.0 32.0 32.0 5 30.4775 32.0 32.0 32.0 32.0 32.0 6 33.73275 36.0 36.0 36.0 27.0 36.0 7 33.85275 36.0 36.0 36.0 32.0 36.0 8 33.6445 36.0 36.0 36.0 21.0 36.0 9 33.89925 36.0 36.0 36.0 32.0 36.0 10-11 33.73325 36.0 36.0 36.0 32.0 36.0 12-13 33.7725 36.0 36.0 36.0 32.0 36.0 14-15 33.673125 36.0 36.0 36.0 32.0 36.0 16-17 33.552 36.0 36.0 36.0 24.0 36.0 18-19 33.411874999999995 36.0 36.0 36.0 21.0 36.0 20-21 33.5625 36.0 36.0 36.0 26.5 36.0 22-23 33.46825 36.0 36.0 36.0 21.0 36.0 24-25 33.46625 36.0 36.0 36.0 21.0 36.0 26-27 33.45825 36.0 36.0 36.0 21.0 36.0 28-29 33.425875000000005 36.0 36.0 36.0 21.0 36.0 30-31 33.468 36.0 36.0 36.0 24.0 36.0 32-33 33.43775 36.0 36.0 36.0 21.0 36.0 34-35 33.270875000000004 36.0 36.0 36.0 17.5 36.0 36-37 33.36534133533384 36.0 36.0 36.0 17.5 36.0 38-39 33.30482620655164 36.0 36.0 36.0 17.5 36.0 40-41 33.26056514128532 36.0 36.0 36.0 14.0 36.0 42-43 33.18492123030758 36.0 36.0 36.0 14.0 36.0 44-45 33.20517629407352 36.0 36.0 36.0 17.5 36.0 46-47 33.11877969492373 36.0 36.0 36.0 14.0 36.0 48-49 33.1565391347837 36.0 36.0 36.0 17.5 36.0 50-51 33.0951487871968 36.0 36.0 36.0 14.0 36.0 52-53 33.07415566998303 36.0 36.0 36.0 14.0 36.0 54-55 33.010880440220106 36.0 36.0 36.0 14.0 36.0 56-57 32.83009378813531 36.0 32.0 36.0 17.5 36.0 58-59 32.90187734668335 36.0 34.0 36.0 14.0 36.0 60-61 32.69379068602905 36.0 32.0 36.0 14.0 36.0 62-63 32.67025538307461 36.0 32.0 36.0 14.0 36.0 64-65 32.65373059589384 36.0 32.0 36.0 14.0 36.0 66-67 32.58838257386079 36.0 32.0 36.0 14.0 36.0 68-69 32.515781563126254 36.0 32.0 36.0 14.0 36.0 70-71 32.57662985061441 36.0 32.0 36.0 14.0 36.0 72-73 32.41805780120183 36.0 32.0 36.0 14.0 36.0 74-75 32.431756336011176 36.0 32.0 36.0 14.0 36.0 76 31.507543103448278 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 8.0 16 16.0 17 10.0 18 3.0 19 7.0 20 9.0 21 8.0 22 12.0 23 16.0 24 25.0 25 64.0 26 65.0 27 82.0 28 124.0 29 155.0 30 187.0 31 249.0 32 315.0 33 456.0 34 834.0 35 1354.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.29214607303652 19.5847923961981 11.030515257628814 35.09254627313656 2 30.50762690672668 22.1055263815954 28.582145536384097 18.804701175293822 3 25.006251562890725 26.281570392598148 22.1055263815954 26.60665166291573 4 28.532133033258315 30.75768942235559 17.129282320580145 23.58089522380595 5 29.532383095773945 31.207801950487625 19.604901225306325 19.654913728432106 6 23.80595148787197 34.53363340835209 19.129782445611404 22.53063265816454 7 23.605901475368842 17.57939484871218 34.658664666166544 24.15603900975244 8 24.781195298824706 20.255063765941486 24.681170292573142 30.282570642660666 9 24.456114028507127 21.80545136284071 25.93148287071768 27.806951737934483 10-11 28.003003003003002 26.83933933933934 19.694694694694697 25.462962962962965 12-13 27.18507387928876 20.924117205108942 24.01702980215377 27.87377911344853 14-15 27.169149868536373 23.71353449355202 23.951421059221232 25.165894578690374 16-17 26.746806912096165 23.27823691460055 23.127973954420238 26.84698221888305 18-19 27.009767092411717 23.804157275231656 22.501878287002253 26.68419734535437 20-21 27.566349524286434 23.985978968452677 22.984476715072606 25.463194792188283 22-23 28.290544771446463 23.40638697557921 22.316844082654978 25.98622417031935 24-25 27.031426067359458 23.801176912482784 23.888819331413547 25.278577688744207 26-27 26.35862759829702 24.27998998246932 23.415977961432507 25.945404457801153 28-29 27.72004507324402 23.788656566921247 23.300363090021285 25.190935269813448 30-31 27.077077077077078 23.373373373373376 23.94894894894895 25.600600600600597 32-33 27.6172607879925 23.75234521575985 23.039399624765476 25.59099437148218 34-35 26.5474552957359 23.87145179442291 22.495935975990996 27.085156933850197 36-37 26.66082822469661 23.87088702614788 23.445514825472287 26.022769923683224 38-39 27.619404851212803 24.23105776444111 23.593398349587396 24.55613903475869 40-41 26.881720430107524 23.293323330832706 23.305826456614152 26.51912978244561 42-43 27.293204855462395 23.91440370416719 23.038418220498063 25.753973219872357 44-45 27.01789513202353 23.726692529095235 23.576523589037667 25.678888749843576 46-47 27.1156735102654 23.985978968452677 22.47120681021532 26.4271407110666 48-49 26.49305120821335 23.538249655690496 23.337924126705897 26.630775009390263 50-51 27.466199298948425 23.923385077616423 23.034551827741613 25.575863795693543 52-53 26.957718288716535 23.2424318238679 23.492619464598448 26.307230422817113 54-55 26.525762881440716 23.13656828414207 23.699349674837418 26.638319159579787 56-57 26.870152614460846 23.617713284963724 24.25569176882662 25.25644233174881 58-59 27.42177722152691 23.216520650813514 23.566958698372968 25.79474342928661 60-61 27.366049073610416 23.960941412118178 22.158237356034054 26.514772158237353 62-63 27.190786179268905 24.198798197295943 22.871807711567353 25.7386079118678 64-65 27.8292438657987 23.910866299449175 22.8342513770656 25.425638457686528 66-67 28.14221331997997 23.15973960941412 23.73560340510766 24.962443665498245 68-69 27.121193131971427 24.238626394285 22.947737811755857 25.69244266198772 70-71 26.501944061206572 23.617208077260756 22.46331368368243 27.417534177850243 72-73 26.94829760403531 21.525851197982345 24.174022698612863 27.351828499369486 74-75 27.319724284199363 20.86426299045599 24.68186638388123 27.134146341463417 76 29.17714696370823 0.0 33.02191879266978 37.800934243621995 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 1.0 19 0.5 20 2.0 21 4.0 22 4.0 23 4.0 24 4.5 25 6.0 26 4.5 27 3.5 28 9.0 29 14.5 30 16.5 31 20.5 32 29.0 33 39.0 34 40.5 35 48.5 36 74.0 37 95.0 38 111.5 39 114.0 40 132.5 41 159.0 42 165.5 43 171.0 44 164.5 45 164.0 46 175.5 47 180.0 48 175.5 49 173.5 50 172.0 51 148.5 52 127.5 53 126.0 54 127.0 55 115.5 56 117.0 57 128.5 58 128.5 59 129.5 60 134.0 61 134.5 62 124.5 63 114.5 64 115.0 65 107.5 66 98.5 67 100.5 68 98.5 69 92.5 70 84.0 71 82.0 72 81.0 73 63.5 74 45.5 75 43.0 76 36.0 77 28.5 78 21.5 79 17.5 80 16.0 81 10.5 82 4.5 83 2.0 84 2.5 85 4.0 86 4.5 87 4.0 88 4.0 89 2.5 90 0.5 91 0.0 92 0.0 93 0.5 94 1.0 95 1.0 96 1.0 97 1.0 98 0.5 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.1 12-13 0.17500000000000002 14-15 0.1625 16-17 0.17500000000000002 18-19 0.17500000000000002 20-21 0.15 22-23 0.1875 24-25 0.1625 26-27 0.17500000000000002 28-29 0.1625 30-31 0.1 32-33 0.0625 34-35 0.0375 36-37 0.06251562890722681 38-39 0.0 40-41 0.0 42-43 0.08752188047011752 44-45 0.08752188047011752 46-47 0.12503125781445362 48-49 0.13753438359589898 50-51 0.12503125781445362 52-53 0.03751406777541578 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.062625250501002 70-71 0.0 72-73 0.0 74-75 0.013253810470510271 76 0.035919540229885055 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 1.0 53 0.0 54 0.0 55 0.0 56 2.0 57 1.0 58 0.0 59 1.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 2.0 68 0.0 69 1.0 70 9.0 71 9.0 72 16.0 73 70.0 74 229.0 75 874.0 76 2784.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.075 #Duplication Level Percentage of deduplicated Percentage of total 1 98.26663267907215 96.375 2 1.5039510578638797 2.9499999999999997 3 0.22941626306398166 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 904498 spots for SRR11389760.sra Written 904498 spots for SRR11389760.sra Read 904498 spots for SRR11389760.sra Written 904498 spots for SRR11389760.sra Read 904498 spots for SRR11389760.sra Written 904498 spots for SRR11389760.sra Read 904498 spots for SRR11389760.sra Written 904498 spots for SRR11389760.sra Read 904498 spots for SRR11389760.sra Written 904498 spots for SRR11389760.sra Read 904512 spots for SRR11389760.sra Written 904512 spots for SRR11389760.sra Read 904498 spots for SRR11389760.sra Written 904498 spots for SRR11389760.sra Read 904498 spots for SRR11389760.sra Written 904498 spots for SRR11389760.sra Read 904498 spots for SRR11389760.sra Written 904498 spots for SRR11389760.sra Read 904498 spots for SRR11389760.sra Written 904498 spots for SRR11389760.sra Read 904498 spots for SRR11389760.sra Written 904498 spots for SRR11389760.sra Read 904498 spots for SRR11389760.sra Written 904498 spots for SRR11389760.sra Read 904498 spots for SRR11389760.sra Written 904498 spots for SRR11389760.sra Read 904498 spots for SRR11389760.sra Written 904498 spots for SRR11389760.sra Read 904498 spots for SRR11389760.sra Written 904498 spots for SRR11389760.sra Read 904498 spots for SRR11389760.sra Written 904498 spots for SRR11389760.sra Read 904498 spots for SRR11389760.sra Written 904498 spots for SRR11389760.sra Read 904498 spots for SRR11389760.sra Written 904498 spots for SRR11389760.sra Read 904498 spots for SRR11389760.sra Written 904498 spots for SRR11389760.sra Read 904498 spots for SRR11389760.sra Written 904498 spots for SRR11389760.sra SRR ids: ['SRR11389760.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_szalie2k SRR11389760.sra spots: 18089974 blocks: [[1, 904498], [904499, 1808996], [1808997, 2713494], [2713495, 3617992], [3617993, 4522490], [4522491, 5426988], [5426989, 6331486], [6331487, 7235984], [7235985, 8140482], [8140483, 9044980], [9044981, 9949478], [9949479, 10853976], [10853977, 11758474], [11758475, 12662972], [12662973, 13567470], [13567471, 14471968], [14471969, 15376466], [15376467, 16280964], [16280965, 17185462], [17185463, 18089974]] SRR11389760 file size 3438834 SRR11389760 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389760 SRR11389760_1.fastq SRR11389760_2.fastq Input file: SRR11389760_1.fastq Paired file: SRR11389760_2.fastq trimmed: SRR11389760-trimmed-pair1.fastq, SRR11389760-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 04:56:16 2024 >> started Sat Dec 7 04:56:33 2024 >> done (16.766s) 18089974 read pairs processed; of these: 57 ( 0.00%) short read pairs filtered out after trimming by size control 68052 ( 0.38%) empty read pairs filtered out after trimming by size control 18021865 (99.62%) read pairs available; of these: 5974 ( 0.03%) trimmed read pairs available after processing 18015891 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 116 0.00% 19 1 0.00% 20 115 0.00% 21 2 0.00% 22 163 0.00% 23 1 0.00% 24 130 0.00% 25 6 0.00% 26 179 0.00% 27 4 0.00% 28 142 0.00% 29 8 0.00% 30 114 0.00% 31 5 0.00% 32 79 0.00% 33 5 0.00% 34 47 0.00% 35 181 0.00% 36 262 0.00% 37 230 0.00% 38 240 0.00% 39 270 0.00% 40 354 0.00% 41 371 0.00% 42 383 0.00% 43 509 0.00% 44 543 0.00% 45 655 0.00% 46 702 0.00% 47 811 0.00% 48 844 0.00% 49 960 0.01% 50 1022 0.01% 51 1181 0.01% 52 1221 0.01% 53 1359 0.01% 54 1442 0.01% 55 1768 0.01% 56 1948 0.01% 57 2168 0.01% 58 2261 0.01% 59 2537 0.01% 60 2776 0.02% 61 2677 0.01% 62 3226 0.02% 63 3538 0.02% 64 3828 0.02% 65 4216 0.02% 66 4450 0.02% 67 4988 0.03% 68 5209 0.03% 69 5749 0.03% 70 6720 0.04% 71 8401 0.05% 72 24299 0.13% 73 157097 0.87% 74 1212831 6.73% 75 7885096 43.75% 76 8661425 48.06% 18021865 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=24 prefix-density=0.58 prefix-fanout=2.1 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=32 fanout-score=8.08 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=3.2 sequence=GGGCTCCTTGAACTCCACGCCCACCCACTTCTGGAGCACCTCCGGGAACACGCAGCCGAGGGCGCCGAGCATCGCCCATCGCCCGTGGATCACCT criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=37 prefix-density=0.36 prefix-fanout=2.0 sequence=GACGCCTATGTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=41.09 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=1.9 sequence=CATCGAGTAGACCTTGTTATTGTGAGAATTCTTAATTCAAGAGTTGTAAGGAGGGACTTATGTCACCACAAACAGAAACTAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAAGATTATAGATTGACTTACTACACCCCGGAGTATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTATCTCCTCAACCTGGGGTTCCGCCCGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACTAGTCTTGATCGTTACAAAGGACGATGCTATCACATCGAGCCTGTTCCTGGGGAAGACAGTCAATGGATCTGTTATGTAGCTTATCCATTAGATCTATTTGAAGAGGGTTCCGTTACTAACATGTTTACTTCCATTGTAGGTAACGTATTTGGTTTCAAAGCCCTACGTGCTCTACGTCTGGAGGATCTACGAATTCCCCCTACTTATTCAAAAACTTTCCAAGGCCC SRR11389760 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 04:56:58 Started mapping on | Dec 07 04:56:58 Finished on | Dec 07 04:58:33 Mapping speed, Million of reads per hour | 682.93 Number of input reads | 18021865 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 15315989 Uniquely mapped reads % | 84.99% Average mapped length | 150.35 Number of splices: Total | 6420595 Number of splices: Annotated (sjdb) | 6151347 Number of splices: GT/AG | 6337819 Number of splices: GC/AG | 73159 Number of splices: AT/AC | 1741 Number of splices: Non-canonical | 7876 Mismatch rate per base, % | 0.52% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.01% Insertion average length | 1.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1581794 % of reads mapped to multiple loci | 8.78% Number of reads mapped to too many loci | 56704 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.03% % of reads unmapped: other | 0.90% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1124082 1124082 1124082 N_multimapping 1581794 1581794 1581794 N_noFeature 485096 14888989 613676 N_ambiguous 397373 1903 105291 UnstrandedReadsAssigned:14433520 PositiveStrandReadsAssigned:425097 NegativeStrandReadsAssigned:14597022 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389760 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389760-trimmed-pair1.fastq SRR11389760-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,021,865 reads, 16,026,291 reads pseudoaligned [quant] estimated average fragment length: 195.424 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52973 SRR11389760.ke.tsv 35125 SRR11389760.se.tsv 88098 total ==> SRR11389760.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 741.799 0 0 PNS24247 1044 849.576 21.2537 2.0771 PNS24249 1928 1733.58 64.8259 3.10477 PNS24246 1044 849.576 21.2537 2.0771 PNS24248 1044 849.576 21.2537 2.0771 PNS24244 1471 1276.58 24.4128 1.5878 PNS24243 293 113.514 0 0 KQK14069 1603 1408.58 4058.29 239.214 KQK14071 474 281.739 284.763 83.9189 ==> SRR11389760.se.tsv <== BRADI_1g14170v3 4719 BRADI_1g53295v3 19 BRADI_1g59795v3 633 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 111 BRADI_1g74790v3 67 BRADI_1g09890v3 0 BRADI_1g77505v3 213 BRADI_1g48960v3 0 SRR11389760 completed mapping pipeline successfully