Starting /dee2/code/volunteer_pipeline.sh SRR11389761 current disk space = 1546825740288 free memory = 1596872340 SRR11389761 SRAfilesize 675cae8ff6281c4d4160343d5f84308b SRR11389761.sra SRR11389761.sra file validated SRR11389761 is paired end SRR11389761 is conventional basespace SRR11389761 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389761_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.93125 32.0 32.0 32.0 32.0 32.0 2 31.0095 32.0 32.0 32.0 32.0 32.0 3 30.98475 32.0 32.0 32.0 32.0 32.0 4 31.06675 32.0 32.0 32.0 32.0 32.0 5 31.004 32.0 32.0 32.0 32.0 32.0 6 34.16325 36.0 36.0 36.0 32.0 36.0 7 34.147 36.0 36.0 36.0 32.0 36.0 8 34.08375 36.0 36.0 36.0 32.0 36.0 9 34.4175 36.0 36.0 36.0 32.0 36.0 10-11 34.166 36.0 36.0 36.0 32.0 36.0 12-13 34.28375 36.0 36.0 36.0 32.0 36.0 14-15 34.094625 36.0 36.0 36.0 32.0 36.0 16-17 34.15625 36.0 36.0 36.0 32.0 36.0 18-19 34.312875000000005 36.0 36.0 36.0 32.0 36.0 20-21 34.2025 36.0 36.0 36.0 32.0 36.0 22-23 34.294125 36.0 36.0 36.0 32.0 36.0 24-25 34.17175 36.0 36.0 36.0 32.0 36.0 26-27 34.03775 36.0 36.0 36.0 32.0 36.0 28-29 33.9055 36.0 36.0 36.0 32.0 36.0 30-31 33.88825 36.0 36.0 36.0 32.0 36.0 32-33 33.878875 36.0 36.0 36.0 32.0 36.0 34-35 33.848749999999995 36.0 36.0 36.0 32.0 36.0 36-37 34.08859803674805 36.0 36.0 36.0 32.0 36.0 38-39 33.89932041278631 36.0 36.0 36.0 29.5 36.0 40-41 33.978731437201105 36.0 36.0 36.0 32.0 36.0 42-43 33.903599295242884 36.0 36.0 36.0 32.0 36.0 44-45 33.84155549962245 36.0 36.0 36.0 32.0 36.0 46-47 33.758746539139196 36.0 36.0 36.0 27.0 36.0 48-49 33.61162849232318 36.0 36.0 36.0 27.0 36.0 50-51 33.588220488295995 36.0 36.0 36.0 27.0 36.0 52-53 33.72712013923794 36.0 36.0 36.0 27.0 36.0 54-55 33.57112286002014 36.0 36.0 36.0 27.0 36.0 56-57 33.44461228600201 36.0 36.0 36.0 27.0 36.0 58-59 33.3730798287585 36.0 36.0 36.0 27.0 36.0 60-61 33.35761928243636 36.0 36.0 36.0 27.0 36.0 62-63 33.20037909146629 36.0 32.0 36.0 27.0 36.0 64-65 33.08270297528996 36.0 32.0 36.0 24.0 36.0 66-67 33.12550454086781 36.0 34.0 36.0 27.0 36.0 68-69 33.25141314092795 36.0 34.0 36.0 27.0 36.0 70-71 33.23771752334217 36.0 36.0 36.0 27.0 36.0 72-73 33.06973898635218 36.0 34.0 36.0 21.0 36.0 74-75 33.13284443958005 36.0 34.0 36.0 24.0 36.0 76 31.82639670041245 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 3.0 23 5.0 24 14.0 25 23.0 26 36.0 27 77.0 28 91.0 29 128.0 30 172.0 31 218.0 32 309.0 33 444.0 34 880.0 35 1572.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.95218922999497 14.871665827881229 11.75138399597383 38.42476094614998 2 23.024660291897334 16.758933064921994 35.22898842476095 24.987418218419727 3 20.332159033719176 22.34524408656266 23.301459486663312 34.02113739305486 4 26.37141419224962 27.377956718671363 19.77856064418722 26.472068444891793 5 26.421741318570707 30.422747861097132 21.84197282335179 21.313537996980372 6 22.766279656739023 31.574962140333163 24.30590610802625 21.352852094901564 7 18.621036738802214 24.383492702566684 34.826371414192245 22.169099144438853 8 19.828887770508306 21.992954202315047 31.102164066431808 27.075993960744842 9 21.94262707599396 19.60241570206341 30.62405636638148 27.830900855561147 10-11 23.817312531454455 29.567186713638648 22.08102667337695 24.534474081529943 12-13 23.86763965777554 23.301459486663312 25.163563160543532 27.667337695017615 14-15 23.792148968293912 25.075490689481633 25.352289884247607 25.78007045797685 16-17 24.69803724207348 24.484146955208857 24.584801207851033 26.23301459486663 18-19 24.20734776044288 24.899345747357827 25.176144942123805 25.71716155007549 20-21 23.527931555108204 24.723200805234022 26.37141419224962 25.377453447408154 22-23 23.86763965777554 25.679416205334675 25.037745344740813 25.415198792148967 24-25 23.251132360342226 25.327126321087068 24.396074484146954 27.025666834423756 26-27 24.421238047307497 24.21992954202315 25.817815802717664 25.54101660795169 28-29 24.094111726220433 24.92450931051837 24.874182184197284 26.10719677906392 30-31 23.08756919979869 25.050327126321086 25.99396074484147 25.86814292903875 32-33 23.13789632611978 24.647710115752393 25.578761952692503 26.63563160543533 34-35 23.86763965777554 24.458983392048314 25.767488676396578 25.905888273779563 36-37 24.112761137679335 24.679083815756357 24.603574125346086 26.604580921218222 38-39 23.697457840422853 25.132141958217975 25.03146237100428 26.138937830354898 40-41 24.653913918952934 24.288950415303297 24.729423609363202 26.32771205638057 42-43 23.24439969796124 25.132141958217975 25.42159577145734 26.201862572363453 44-45 23.559023408004027 24.767178454568338 24.943367732192296 26.73043040523534 46-47 24.64132897055122 25.383840926252205 24.37704505411528 25.597785049081303 48-49 24.414799899320414 25.547445255474454 23.722627737226276 26.31512710797886 50-51 24.918197835388874 24.238610621696452 24.918197835388874 25.9249937075258 52-53 24.103209565764633 24.59408432976715 23.939584644430457 27.36312146003776 54-55 24.15659617321249 24.962235649546827 24.181772406847934 26.699395770392748 56-57 24.282477341389725 24.660120845921448 24.647532729103727 26.409869083585097 58-59 25.25812138000504 24.729287333165452 23.936036262906068 26.076555023923444 60-61 24.97795692152664 24.121425872276106 24.297770500062978 26.602846706134276 62-63 24.146187775677376 24.297416509136735 24.66288594833018 26.8935097668557 64-65 24.420070600100857 24.079677256681794 24.81089258698941 26.689359556227938 66-67 24.129667003027244 24.470232088799193 25.42885973763875 25.971241170534814 68-69 25.003153778226316 24.763466633026365 23.438879777974012 26.79449981077331 70-71 25.21146319909102 25.072591844464082 23.393510920338343 26.32243403610655 72-73 24.92393509127789 23.998478701825558 24.530933062880326 26.546653144016226 74-75 24.694179325178116 21.373840569969083 26.07877402876731 27.853206076085495 76 26.359205099362583 0.0 34.72065991751031 38.920134983127106 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 26.0 1 13.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 2.0 20 6.5 21 10.0 22 9.5 23 6.0 24 3.0 25 5.0 26 5.5 27 8.0 28 13.0 29 16.0 30 17.5 31 24.0 32 33.0 33 39.5 34 52.0 35 65.5 36 79.0 37 95.0 38 127.0 39 154.0 40 165.5 41 179.0 42 192.0 43 206.5 44 225.5 45 233.0 46 223.0 47 206.5 48 193.5 49 184.5 50 171.0 51 161.0 52 138.0 53 127.5 54 136.0 55 133.0 56 130.0 57 119.0 58 104.5 59 104.5 60 106.0 61 94.5 62 87.0 63 82.0 64 73.5 65 80.5 66 75.0 67 63.5 68 67.5 69 61.0 70 49.5 71 42.5 72 39.5 73 39.5 74 35.0 75 31.5 76 25.5 77 18.0 78 17.5 79 17.0 80 14.0 81 8.5 82 5.5 83 6.0 84 6.5 85 5.0 86 1.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.65 3 0.65 4 0.65 5 0.65 6 0.95 7 0.65 8 0.65 9 0.65 10-11 0.65 12-13 0.65 14-15 0.65 16-17 0.65 18-19 0.65 20-21 0.65 22-23 0.65 24-25 0.65 26-27 0.65 28-29 0.65 30-31 0.65 32-33 0.65 34-35 0.65 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 27.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 1.0 53 0.0 54 0.0 55 0.0 56 0.0 57 1.0 58 0.0 59 1.0 60 1.0 61 1.0 62 1.0 63 1.0 64 0.0 65 2.0 66 0.0 67 0.0 68 1.0 69 1.0 70 3.0 71 8.0 72 14.0 73 76.0 74 283.0 75 911.0 76 2667.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.6969851814001 96.575 2 1.0986203372508943 2.15 3 0.1021972406745018 0.3 4 0.0510986203372509 0.2 5 0.02554931016862545 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02554931016862545 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 26 0.65 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389761 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389761_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.578 32.0 32.0 32.0 32.0 32.0 2 30.5275 32.0 32.0 32.0 32.0 32.0 3 30.30425 32.0 32.0 32.0 27.0 32.0 4 30.4185 32.0 32.0 32.0 32.0 32.0 5 30.37175 32.0 32.0 32.0 32.0 32.0 6 33.66225 36.0 36.0 36.0 32.0 36.0 7 33.8185 36.0 36.0 36.0 32.0 36.0 8 33.72275 36.0 36.0 36.0 32.0 36.0 9 33.70525 36.0 36.0 36.0 32.0 36.0 10-11 33.576125 36.0 36.0 36.0 26.5 36.0 12-13 33.648250000000004 36.0 36.0 36.0 26.5 36.0 14-15 33.672250000000005 36.0 36.0 36.0 32.0 36.0 16-17 33.3505 36.0 36.0 36.0 21.0 36.0 18-19 33.37075 36.0 36.0 36.0 21.0 36.0 20-21 33.351625 36.0 36.0 36.0 21.0 36.0 22-23 33.29025 36.0 36.0 36.0 21.0 36.0 24-25 33.429500000000004 36.0 36.0 36.0 24.0 36.0 26-27 33.26525 36.0 36.0 36.0 21.0 36.0 28-29 33.327 36.0 36.0 36.0 21.0 36.0 30-31 33.244375 36.0 36.0 36.0 17.5 36.0 32-33 33.312 36.0 36.0 36.0 17.5 36.0 34-35 33.181 36.0 36.0 36.0 14.0 36.0 36-37 33.35030165912519 36.0 36.0 36.0 21.0 36.0 38-39 33.19306184012066 36.0 36.0 36.0 14.0 36.0 40-41 33.223981900452486 36.0 36.0 36.0 14.0 36.0 42-43 33.24057315233786 36.0 36.0 36.0 17.5 36.0 44-45 33.238813474107594 36.0 36.0 36.0 17.5 36.0 46-47 33.23856209150327 36.0 36.0 36.0 17.5 36.0 48-49 33.165786827551536 36.0 36.0 36.0 17.5 36.0 50-51 33.10143288084464 36.0 36.0 36.0 14.0 36.0 52-53 33.067506311112936 36.0 36.0 36.0 14.0 36.0 54-55 32.896530047774704 36.0 36.0 36.0 14.0 36.0 56-57 32.69378772635815 36.0 32.0 36.0 14.0 36.0 58-59 32.843396226415095 36.0 34.0 36.0 14.0 36.0 60-61 32.66654874479232 36.0 32.0 36.0 14.0 36.0 62-63 32.47198378835589 36.0 32.0 36.0 14.0 36.0 64-65 32.49647443968774 36.0 32.0 36.0 14.0 36.0 66-67 32.39355001259763 36.0 32.0 36.0 14.0 36.0 68-69 32.5339629672807 36.0 32.0 36.0 14.0 36.0 70-71 32.37459116566073 36.0 32.0 36.0 14.0 36.0 72-73 32.49167118862924 36.0 32.0 36.0 14.0 36.0 74-75 32.597395080242435 36.0 32.0 36.0 14.0 36.0 76 31.354313217326915 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 7.0 16 7.0 17 21.0 18 10.0 19 7.0 20 17.0 21 13.0 22 13.0 23 21.0 24 28.0 25 50.0 26 50.0 27 96.0 28 106.0 29 146.0 30 177.0 31 230.0 32 312.0 33 455.0 34 850.0 35 1361.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.80010057832537 19.763640935378426 10.9630374654262 34.47322102087001 2 31.942699170645888 21.965317919075144 27.795928625282734 18.29605428499623 3 25.106810756471475 27.896456396079415 23.573762251822068 23.422970595627042 4 29.203317416436292 31.54058808745916 18.069866800703693 21.186227695400856 5 29.052525760241267 32.04322694144257 19.200804222166372 19.70344307614979 6 23.171651168635336 34.858004523749685 20.33174164362905 21.638602663985925 7 24.151796933902993 17.416436290525258 33.92812264388037 24.50364413169138 8 25.508921839658207 20.733852726815783 25.358130183463178 28.399095250062828 9 25.408394068861522 20.25634581553154 26.43880371952752 27.896456396079415 10-11 28.133249528598363 28.133249528598363 19.89943431803897 23.8340666247643 12-13 27.414486921529175 21.956740442655935 23.327464788732392 27.301307847082494 14-15 27.213279678068407 24.044265593561367 24.15744466800805 24.585010060362173 16-17 28.084517670733238 24.487485850836375 22.072695258458054 25.355301219972333 18-19 27.543705194315184 23.758017859388755 23.041126902276442 25.657150044019623 20-21 26.88874921433061 24.978001257071025 22.589566310496544 25.54368321810182 22-23 26.830188679245282 24.968553459119498 22.77987421383648 25.42138364779874 24-25 26.82344064386318 24.77364185110664 22.82444668008048 25.5784708249497 26-27 26.86116700201207 24.673038229376257 23.490945674044266 24.974849094567407 28-29 27.92101622437429 24.17305999245378 23.254936485976607 24.65098729719532 30-31 27.1904462602137 24.36203645505971 22.476429918290382 25.9710873664362 32-33 26.262880120633326 24.390550389545112 23.624026137220408 25.722543352601157 34-35 26.690123146519223 23.925609449610455 23.18421713998492 26.200050263885398 36-37 27.617850408548083 24.299182903834065 24.07291011942175 24.010056568196102 38-39 27.33785822021116 24.296128707893413 23.42885872297637 24.937154348919055 40-41 27.463549522373054 24.773755656108598 22.435897435897438 25.326797385620914 42-43 27.297875015717338 25.047152018106374 22.658116434050044 24.99685653212624 44-45 26.518294983025275 25.084873632591474 22.922167735445743 25.474663648937508 46-47 26.32704402515723 24.07547169811321 23.157232704402517 26.440251572327046 48-49 26.566037735849058 24.41509433962264 23.232704402515722 25.78616352201258 50-51 26.930817610062892 24.51572327044025 23.044025157232703 25.50943396226415 52-53 27.79384035197989 24.223758642363293 22.149591451917033 25.83280955373979 54-55 27.835051546391753 25.44631631883329 22.428966557706815 24.289665577068142 56-57 26.836016096579478 24.87424547283702 22.82444668008048 25.465291750503017 58-59 26.842767295597486 24.59119496855346 22.943396226415093 25.62264150943396 60-61 26.601233169749587 25.116396124323643 23.530892160563734 24.751478545363028 62-63 27.111390811831342 24.75770925110132 23.423536815607303 24.707363121460038 64-65 27.386048854192897 24.175270712666837 23.02946361118106 25.409216821959202 66-67 27.05971277399849 24.300831443688587 23.43159486016629 25.207860922146637 68-69 26.959919334509706 25.37181749432821 23.48122006554071 24.187043105621374 70-71 27.20050441361917 23.720050441361916 23.152585119798236 25.926860025220684 72-73 26.34783711784853 24.330838513256374 23.696562222504124 25.624762146390967 74-75 26.926174496644293 21.073825503355707 25.140939597315437 26.859060402684566 76 28.767123287671232 0.0 31.766012587930398 39.46686412439837 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 21.0 1 10.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 3.5 20 2.5 21 0.5 22 1.0 23 5.5 24 10.5 25 9.5 26 8.5 27 9.5 28 10.5 29 14.0 30 15.5 31 17.0 32 21.0 33 29.5 34 44.5 35 67.0 36 85.5 37 93.0 38 101.5 39 121.0 40 142.0 41 161.5 42 179.0 43 182.5 44 180.5 45 186.5 46 195.0 47 188.0 48 173.0 49 177.0 50 189.5 51 162.0 52 131.0 53 128.0 54 127.0 55 133.5 56 125.5 57 117.0 58 123.0 59 128.0 60 126.0 61 108.5 62 91.5 63 88.0 64 89.0 65 85.0 66 85.5 67 94.0 68 95.5 69 84.5 70 68.0 71 57.0 72 57.5 73 57.0 74 54.5 75 55.0 76 47.5 77 32.0 78 17.5 79 12.5 80 14.0 81 13.0 82 11.0 83 10.0 84 7.5 85 3.5 86 2.0 87 2.0 88 3.5 89 3.0 90 2.0 91 2.5 92 2.0 93 1.0 94 1.0 95 3.0 96 4.0 97 2.0 98 0.5 99 2.5 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.525 3 0.525 4 0.525 5 0.525 6 0.525 7 0.525 8 0.525 9 0.525 10-11 0.5625 12-13 0.6 14-15 0.6 16-17 0.6125 18-19 0.6125 20-21 0.5625 22-23 0.625 24-25 0.6 26-27 0.6 28-29 0.6125 30-31 0.5625 32-33 0.525 34-35 0.525 36-37 0.012569130216189038 38-39 0.0 40-41 0.0 42-43 0.037707390648567124 44-45 0.037707390648567124 46-47 0.07541478129713425 48-49 0.07541478129713425 50-51 0.07541478129713425 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.03779765654529419 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 22.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 1.0 53 0.0 54 0.0 55 1.0 56 0.0 57 1.0 58 0.0 59 1.0 60 1.0 61 0.0 62 1.0 63 1.0 64 0.0 65 2.0 66 0.0 67 0.0 68 1.0 69 1.0 70 4.0 71 10.0 72 23.0 73 58.0 74 294.0 75 877.0 76 2701.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.28249166880288 95.85000000000001 2 1.4355293514483467 2.8000000000000003 3 0.20507562163547807 0.6 4 0.02563445270443476 0.1 5 0.02563445270443476 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02563445270443476 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 21 0.525 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 553905 spots for SRR11389761.sra Written 553905 spots for SRR11389761.sra Read 553905 spots for SRR11389761.sra Written 553905 spots for SRR11389761.sra Read 553905 spots for SRR11389761.sra Written 553905 spots for SRR11389761.sra Read 553905 spots for SRR11389761.sra Written 553905 spots for SRR11389761.sra Read 553905 spots for SRR11389761.sra Written 553905 spots for SRR11389761.sra Read 553905 spots for SRR11389761.sra Written 553905 spots for SRR11389761.sra Read 553905 spots for SRR11389761.sra Written 553905 spots for SRR11389761.sra Read 553905 spots for SRR11389761.sra Written 553905 spots for SRR11389761.sra Read 553905 spots for SRR11389761.sra Written 553905 spots for SRR11389761.sra Read 553905 spots for SRR11389761.sra Written 553905 spots for SRR11389761.sra Read 553905 spots for SRR11389761.sra Written 553905 spots for SRR11389761.sra Read 553905 spots for SRR11389761.sra Written 553905 spots for SRR11389761.sra Read 553905 spots for SRR11389761.sra Written 553905 spots for SRR11389761.sra Read 553905 spots for SRR11389761.sra Written 553905 spots for SRR11389761.sra Read 553905 spots for SRR11389761.sra Written 553905 spots for SRR11389761.sra Read 553905 spots for SRR11389761.sra Written 553905 spots for SRR11389761.sra Read 553912 spots for SRR11389761.sra Written 553912 spots for SRR11389761.sra Read 553905 spots for SRR11389761.sra Written 553905 spots for SRR11389761.sra Read 553905 spots for SRR11389761.sra Written 553905 spots for SRR11389761.sra Read 553905 spots for SRR11389761.sra Written 553905 spots for SRR11389761.sra SRR ids: ['SRR11389761.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h_2ph0bj SRR11389761.sra spots: 11078107 blocks: [[1, 553905], [553906, 1107810], [1107811, 1661715], [1661716, 2215620], [2215621, 2769525], [2769526, 3323430], [3323431, 3877335], [3877336, 4431240], [4431241, 4985145], [4985146, 5539050], [5539051, 6092955], [6092956, 6646860], [6646861, 7200765], [7200766, 7754670], [7754671, 8308575], [8308576, 8862480], [8862481, 9416385], [9416386, 9970290], [9970291, 10524195], [10524196, 11078107]] SRR11389761 file size 2090789 SRR11389761 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389761 SRR11389761_1.fastq SRR11389761_2.fastq Input file: SRR11389761_1.fastq Paired file: SRR11389761_2.fastq trimmed: SRR11389761-trimmed-pair1.fastq, SRR11389761-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 04:59:25 2024 >> started Sat Dec 7 04:59:34 2024 >> done (9.216s) 11078107 read pairs processed; of these: 200 ( 0.00%) short read pairs filtered out after trimming by size control 160333 ( 1.45%) empty read pairs filtered out after trimming by size control 10917574 (98.55%) read pairs available; of these: 6397 ( 0.06%) trimmed read pairs available after processing 10911177 (99.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 295 0.00% 19 2 0.00% 20 375 0.00% 21 0 0.00% 22 434 0.00% 23 2 0.00% 24 508 0.00% 25 4 0.00% 26 502 0.00% 27 7 0.00% 28 409 0.00% 29 3 0.00% 30 314 0.00% 31 9 0.00% 32 221 0.00% 33 10 0.00% 34 147 0.00% 35 159 0.00% 36 365 0.00% 37 192 0.00% 38 272 0.00% 39 221 0.00% 40 276 0.00% 41 325 0.00% 42 371 0.00% 43 337 0.00% 44 422 0.00% 45 491 0.00% 46 499 0.00% 47 599 0.01% 48 650 0.01% 49 700 0.01% 50 766 0.01% 51 817 0.01% 52 977 0.01% 53 1012 0.01% 54 1043 0.01% 55 1243 0.01% 56 1432 0.01% 57 1480 0.01% 58 1626 0.01% 59 1763 0.02% 60 1924 0.02% 61 1983 0.02% 62 2057 0.02% 63 2385 0.02% 64 2486 0.02% 65 2723 0.02% 66 2951 0.03% 67 3299 0.03% 68 3214 0.03% 69 3631 0.03% 70 4276 0.04% 71 5207 0.05% 72 14510 0.13% 73 98084 0.90% 74 763772 7.00% 75 4850383 44.43% 76 5133409 47.02% 10917574 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=15 prefix-density=0.55 prefix-fanout=2.0 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=27.70 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=8.5 sequence=AAAAAAAAAAGTATGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=24 prefix-density=0.48 prefix-fanout=2.0 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCC criterion=fanout-score sequence-density=0.13 sequence-density-rank=23 fanout-score=81.11 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=18.1 sequence=CGGCGGCGGCGCCCTCCTCGTCTACAACACCAGCGCTCTCGCCGGCTAATTAAGAATCAAGTCATCTCATTCTCATCTATGCAATTGCAAACACAACACAGGGCCGGGTATCTCTCTGCATGTACGTATGCCTGTAATGTACGTAGCTACCTGCTGTGAAATGTACGTATGTGATCGATGATGCCAAGTACTTGATCGAAACGCATCGCTTAATTTTATGTATGTATAAC SRR11389761 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 05:00:01 Started mapping on | Dec 07 05:00:01 Finished on | Dec 07 05:00:53 Mapping speed, Million of reads per hour | 755.83 Number of input reads | 10917574 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 9508464 Uniquely mapped reads % | 87.09% Average mapped length | 150.27 Number of splices: Total | 4533511 Number of splices: Annotated (sjdb) | 4342692 Number of splices: GT/AG | 4469584 Number of splices: GC/AG | 56909 Number of splices: AT/AC | 1811 Number of splices: Non-canonical | 5207 Mismatch rate per base, % | 0.54% Deletion rate per base | 0.01% Deletion average length | 1.69 Insertion rate per base | 0.01% Insertion average length | 1.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 831484 % of reads mapped to multiple loci | 7.62% Number of reads mapped to too many loci | 28307 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.23% % of reads unmapped: other | 0.80% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 577626 577626 577626 N_multimapping 831484 831484 831484 N_noFeature 309048 9242071 398228 N_ambiguous 235753 1447 61258 UnstrandedReadsAssigned:8963663 PositiveStrandReadsAssigned:264946 NegativeStrandReadsAssigned:9048978 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389761 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389761-trimmed-pair1.fastq SRR11389761-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,917,574 reads, 9,816,529 reads pseudoaligned [quant] estimated average fragment length: 198.58 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,055 rounds 52973 SRR11389761.ke.tsv 35125 SRR11389761.se.tsv 88098 total ==> SRR11389761.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 738.497 0 0 PNS24247 1044 846.42 14.7789 2.47931 PNS24249 1928 1730.42 74.4776 6.11152 PNS24246 1044 846.42 14.7789 2.47931 PNS24248 1044 846.42 14.7789 2.47931 PNS24244 1471 1273.42 24.1858 2.6969 PNS24243 293 110.845 0 0 KQK14069 1603 1405.42 295.345 29.84 KQK14071 474 278.473 13.7892 7.03122 ==> SRR11389761.se.tsv <== BRADI_1g14170v3 316 BRADI_1g53295v3 20 BRADI_1g59795v3 152 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 75 BRADI_1g74790v3 157 BRADI_1g09890v3 0 BRADI_1g77505v3 141 BRADI_1g48960v3 0 SRR11389761 completed mapping pipeline successfully