Starting /dee2/code/volunteer_pipeline.sh SRR11389762 current disk space = 1546866622464 free memory = 1604038492 SRR11389762 SRAfilesize 89fe27d6bf85909ac5e900ea014d7835 SRR11389762.sra SRR11389762.sra file validated SRR11389762 is paired end SRR11389762 is conventional basespace SRR11389762 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389762_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.11075 32.0 32.0 32.0 32.0 32.0 2 31.00375 32.0 32.0 32.0 32.0 32.0 3 31.1 32.0 32.0 32.0 32.0 32.0 4 31.1755 32.0 32.0 32.0 32.0 32.0 5 31.22075 32.0 32.0 32.0 32.0 32.0 6 34.0725 36.0 36.0 36.0 32.0 36.0 7 34.31075 36.0 36.0 36.0 32.0 36.0 8 34.488 36.0 36.0 36.0 32.0 36.0 9 34.36925 36.0 36.0 36.0 32.0 36.0 10-11 34.332375 36.0 36.0 36.0 32.0 36.0 12-13 34.395624999999995 36.0 36.0 36.0 32.0 36.0 14-15 34.21025 36.0 36.0 36.0 32.0 36.0 16-17 34.24225 36.0 36.0 36.0 32.0 36.0 18-19 34.3545 36.0 36.0 36.0 32.0 36.0 20-21 34.278875 36.0 36.0 36.0 32.0 36.0 22-23 34.283875 36.0 36.0 36.0 32.0 36.0 24-25 34.244375 36.0 36.0 36.0 32.0 36.0 26-27 34.1075 36.0 36.0 36.0 32.0 36.0 28-29 34.005875 36.0 36.0 36.0 32.0 36.0 30-31 33.968 36.0 36.0 36.0 32.0 36.0 32-33 33.903375 36.0 36.0 36.0 32.0 36.0 34-35 34.034125 36.0 36.0 36.0 32.0 36.0 36-37 34.096062202157015 36.0 36.0 36.0 32.0 36.0 38-39 33.83997993478806 36.0 36.0 36.0 29.5 36.0 40-41 33.957486832204665 36.0 36.0 36.0 32.0 36.0 42-43 34.02871833458741 36.0 36.0 36.0 32.0 36.0 44-45 34.031493099121704 36.0 36.0 36.0 32.0 36.0 46-47 33.923462986198246 36.0 36.0 36.0 29.5 36.0 48-49 33.73350062735257 36.0 36.0 36.0 27.0 36.0 50-51 33.71656210790464 36.0 36.0 36.0 27.0 36.0 52-53 33.736135508155584 36.0 36.0 36.0 27.0 36.0 54-55 33.5284818067754 36.0 36.0 36.0 27.0 36.0 56-57 33.57979797139336 36.0 36.0 36.0 27.0 36.0 58-59 33.512807634354594 36.0 36.0 36.0 27.0 36.0 60-61 33.44456175623766 36.0 36.0 36.0 27.0 36.0 62-63 33.219166038683746 36.0 34.0 36.0 27.0 36.0 64-65 33.080422216637345 36.0 34.0 36.0 24.0 36.0 66-67 33.1534092346384 36.0 34.0 36.0 24.0 36.0 68-69 33.265938569253606 36.0 34.0 36.0 27.0 36.0 70-71 33.10886247192174 36.0 34.0 36.0 24.0 36.0 72-73 33.03627465579855 36.0 34.0 36.0 24.0 36.0 74-75 33.090470495943464 36.0 34.0 36.0 24.0 36.0 76 32.01360544217687 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 3.0 24 9.0 25 21.0 26 56.0 27 56.0 28 101.0 29 125.0 30 167.0 31 230.0 32 304.0 33 451.0 34 870.0 35 1592.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.164283922748936 13.844996237772762 10.634562327564586 40.35615751191372 2 24.630047654878354 15.174316528718334 34.813142713819914 25.382493102583396 3 21.369450714823177 21.24404314020567 24.103335841484828 33.28317030348633 4 26.787057938299476 27.263606721846003 19.66390770002508 26.285427639829447 5 26.285427639829447 29.721595184349137 21.670428893905193 22.322548281916227 6 21.644803229061555 31.81130171543895 24.167507568113017 22.376387487386477 7 18.058690744920995 24.103335841484828 37.67243541509907 20.165537998495108 8 19.312766491096063 22.473037371457234 31.42713819914723 26.787057938299476 9 21.62026586405819 18.610484073238023 32.932029094557315 26.837220968146475 10-11 24.216202658640583 29.38299473288187 22.686230248306998 23.714572360170553 12-13 23.539001755706046 23.238023576624027 24.76799598695761 28.454978680712316 14-15 23.614246300476548 26.034612490594434 25.28216704288939 25.06897416603963 16-17 24.441936292952093 25.056433408577877 25.62076749435666 24.88086280411337 18-19 23.82743917732631 24.5171808377226 25.21946325558064 26.435916729370458 20-21 23.940305994482067 25.29470780035114 25.545522949586154 25.21946325558064 22-23 23.777276147479306 25.332330072736394 24.91848507649862 25.971908703285678 24-25 24.329069475796338 24.91848507649862 24.91848507649862 25.833960371206423 26-27 23.43867569601204 25.395033860045146 24.667669927263606 26.498620516679207 28-29 24.642588412340103 25.63330825181841 23.5766240280913 26.14747930775019 30-31 23.551542513167796 24.793077501881115 25.80887885628292 25.84650112866817 32-33 22.86180085277151 26.072234762979683 24.931025833960373 26.13493855028844 34-35 24.37923250564334 24.5924253824931 24.818159016804614 26.21018309505894 36-37 24.39177326310509 24.467017807875596 24.429395535490343 26.71181339352897 38-39 23.76473539001756 25.21946325558064 25.30724855781289 25.70855279658891 40-41 23.363431151241535 25.031351893654374 25.63330825181841 25.971908703285678 42-43 24.115876598946574 24.128417356408328 25.696012039127165 26.059694005517937 44-45 22.84818067754078 24.52948557089084 25.420326223337515 27.202007528230865 46-47 23.726474278544543 25.357590966122963 24.49184441656211 26.42409033877039 48-49 24.353826850690087 24.604767879548305 25.04391468005019 25.99749058971142 50-51 24.479297365119194 24.755332496863236 24.62986198243413 26.135508155583437 52-53 24.567126725219573 24.102885821831872 24.943538268506902 26.386449184441656 54-55 23.588456712672524 24.441656210790462 24.80552070263488 27.164366373902133 56-57 23.38689430077831 24.930956565402962 25.910118001506405 25.77203113231233 58-59 24.711200401808135 24.183827222501257 24.522852837769964 26.582119537920647 60-61 24.676629411025996 24.525932437523544 23.923144543513754 26.874293607936707 62-63 24.152223059532783 24.74252700326551 24.96860085405677 26.136649083144935 64-65 24.491078160341793 24.993717014325206 24.71726564463433 25.79793918069867 66-67 24.556771029800075 24.254998113919278 25.097447504086507 26.09078335219414 68-69 23.776575669895582 25.311359919486726 24.41816580701975 26.493898603597938 70-71 24.959073164588844 24.89610880241783 24.404986777483945 25.739831255509383 72-73 24.66776357423111 24.085558790026578 24.958865966333377 26.287811669408935 74-75 24.92676431424767 21.025299600532623 26.2982689747004 27.749667110519304 76 27.139276763336913 0.0 34.22842821339062 38.63229502327247 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 13.0 1 6.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 3.0 20 4.5 21 5.0 22 4.0 23 5.0 24 7.5 25 6.5 26 7.0 27 12.0 28 15.5 29 20.5 30 21.5 31 26.5 32 42.0 33 48.5 34 58.5 35 70.5 36 79.0 37 100.5 38 120.0 39 144.5 40 164.5 41 175.0 42 190.0 43 198.5 44 202.0 45 216.5 46 229.5 47 220.0 48 210.5 49 191.0 50 174.5 51 156.0 52 138.0 53 133.5 54 125.5 55 119.5 56 108.5 57 98.5 58 99.5 59 99.0 60 100.5 61 104.5 62 102.0 63 95.0 64 84.0 65 76.0 66 76.0 67 74.0 68 64.0 69 59.0 70 49.5 71 42.0 72 43.0 73 43.5 74 33.5 75 23.5 76 23.0 77 18.0 78 15.5 79 18.5 80 16.5 81 12.0 82 7.5 83 3.0 84 2.0 85 1.5 86 2.0 87 3.0 88 1.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.325 3 0.325 4 0.325 5 0.325 6 0.8999999999999999 7 0.325 8 0.325 9 0.325 10-11 0.325 12-13 0.325 14-15 0.325 16-17 0.325 18-19 0.325 20-21 0.325 22-23 0.325 24-25 0.325 26-27 0.325 28-29 0.325 30-31 0.325 32-33 0.325 34-35 0.325 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 13.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 2.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 2.0 57 0.0 58 0.0 59 0.0 60 1.0 61 0.0 62 0.0 63 2.0 64 0.0 65 2.0 66 1.0 67 1.0 68 1.0 69 2.0 70 3.0 71 5.0 72 27.0 73 68.0 74 228.0 75 848.0 76 2793.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80407124681933 97.075 2 0.9669211195928753 1.9 3 0.1272264631043257 0.375 4 0.05089058524173028 0.2 5 0.02544529262086514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02544529262086514 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 13 0.325 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 5 0.125 TruSeq Adapter, Index 7 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389762 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389762_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.81325 32.0 32.0 32.0 32.0 32.0 2 30.588 32.0 32.0 32.0 32.0 32.0 3 30.56375 32.0 32.0 32.0 32.0 32.0 4 30.376 32.0 32.0 32.0 32.0 32.0 5 30.612 32.0 32.0 32.0 32.0 32.0 6 33.62625 36.0 36.0 36.0 21.0 36.0 7 33.7965 36.0 36.0 36.0 32.0 36.0 8 33.583 36.0 36.0 36.0 32.0 36.0 9 33.57425 36.0 36.0 36.0 21.0 36.0 10-11 33.730625 36.0 36.0 36.0 32.0 36.0 12-13 33.683 36.0 36.0 36.0 32.0 36.0 14-15 33.5425 36.0 36.0 36.0 21.0 36.0 16-17 33.375 36.0 36.0 36.0 24.0 36.0 18-19 33.469375 36.0 36.0 36.0 24.0 36.0 20-21 33.467 36.0 36.0 36.0 24.0 36.0 22-23 33.390875 36.0 36.0 36.0 21.0 36.0 24-25 33.466 36.0 36.0 36.0 24.0 36.0 26-27 33.404375 36.0 36.0 36.0 24.0 36.0 28-29 33.307 36.0 36.0 36.0 21.0 36.0 30-31 33.42425 36.0 36.0 36.0 24.0 36.0 32-33 33.365625 36.0 36.0 36.0 21.0 36.0 34-35 33.346625 36.0 36.0 36.0 21.0 36.0 36-37 33.37261785356068 36.0 36.0 36.0 21.0 36.0 38-39 33.42753259779338 36.0 36.0 36.0 21.0 36.0 40-41 33.48332497492477 36.0 36.0 36.0 21.0 36.0 42-43 33.287111334002006 36.0 36.0 36.0 17.5 36.0 44-45 33.12590920491598 36.0 36.0 36.0 17.5 36.0 46-47 33.32831703034863 36.0 36.0 36.0 21.0 36.0 48-49 33.11123651868573 36.0 36.0 36.0 17.5 36.0 50-51 33.06997742663657 36.0 36.0 36.0 14.0 36.0 52-53 33.07750188111362 36.0 36.0 36.0 17.5 36.0 54-55 32.96175068974166 36.0 36.0 36.0 14.0 36.0 56-57 32.81212601283206 36.0 34.0 36.0 17.5 36.0 58-59 32.90675200803213 36.0 36.0 36.0 14.0 36.0 60-61 32.6338531378842 36.0 32.0 36.0 14.0 36.0 62-63 32.499372332412754 36.0 32.0 36.0 14.0 36.0 64-65 32.64493845767395 36.0 32.0 36.0 14.0 36.0 66-67 32.76284726842064 36.0 32.0 36.0 14.0 36.0 68-69 32.56681751939851 36.0 32.0 36.0 14.0 36.0 70-71 32.51136442290506 36.0 32.0 36.0 14.0 36.0 72-73 32.499729741774985 36.0 32.0 36.0 14.0 36.0 74-75 32.47046939778852 36.0 32.0 36.0 14.0 36.0 76 31.429200293470288 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 7.0 17 7.0 18 9.0 19 6.0 20 8.0 21 17.0 22 13.0 23 34.0 24 25.0 25 41.0 26 63.0 27 101.0 28 109.0 29 156.0 30 188.0 31 256.0 32 307.0 33 456.0 34 835.0 35 1348.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.76028084252758 21.263791374122366 10.080240722166499 31.89568706118355 2 29.638916750250754 23.294884653961887 28.736208625877634 18.32998996990973 3 23.64593781344032 26.83049147442327 23.82146439317954 25.70210631895687 4 28.736208625877634 31.243731193580743 18.079237713139417 21.940822467402207 5 29.33801404212638 32.79839518555667 18.530591775325977 19.332998996990973 6 22.993981945837515 36.2086258776329 19.583751253761285 21.213640922768302 7 22.768304914744235 17.9037111334002 36.33400200601805 22.993981945837515 8 23.746238716148447 20.91273821464393 24.849548645937812 30.49147442326981 9 25.77733199598796 21.13841524573721 25.426278836509532 27.657973921765294 10-11 27.64462291379094 27.293261387878026 20.479357510352617 24.582758187978413 12-13 27.464523420821298 21.675248022102224 23.998493030264974 26.861735526811504 14-15 26.271505713926913 24.53849051864875 24.60128092427477 24.588722843149565 16-17 25.90452261306533 24.258793969849247 24.20854271356784 25.628140703517587 18-19 26.168341708542712 25.27638190954774 23.618090452261306 24.937185929648244 20-21 27.622991967871485 23.255522088353413 23.920682730923694 25.200803212851408 22-23 26.633165829145728 24.195979899497488 22.8643216080402 26.306532663316585 24-25 26.566227244193346 24.595103578154426 23.176396735718768 25.66227244193346 26-27 26.393771973882473 24.861878453038674 23.417880462079356 25.3264691109995 28-29 26.827430293896004 25.307711630243656 22.368751569957297 25.496106505903036 30-31 26.467636728549927 24.88710486703462 23.532363271450073 25.11289513296538 32-33 27.301228994231252 24.805618259342864 23.112616002006522 24.78053674441936 34-35 27.031093279839517 25.351053159478436 23.50802407221665 24.109829488465394 36-37 26.527028721936535 24.056189640035118 23.71754672018061 25.699234917847736 38-39 26.366599799398195 24.059679037111334 24.611334002006018 24.962387161484454 40-41 28.059177532597797 23.42026078234704 23.73370110330993 24.786860581745234 42-43 26.87915673233781 24.97176559166771 23.31534696950684 24.83373070648764 44-45 27.28756118990837 24.212376051211244 22.743818250282416 25.756244508597963 46-47 26.757910597689605 25.288799598191865 23.593671521848318 24.359618282270215 48-49 26.13065326633166 24.49748743718593 23.99497487437186 25.376884422110553 50-51 26.506780512305372 24.648417880462077 23.455549974886992 25.389251632345555 52-53 26.91584096325097 24.507713533174464 23.57958108616581 24.996864417408755 54-55 26.787057938299476 25.20692249811889 23.338349636318036 24.667669927263606 56-57 26.474278544542035 25.094102885821833 23.099121706398996 25.332496863237143 58-59 27.133534136546185 24.246987951807228 23.569277108433734 25.050200803212853 60-61 26.15790134304004 24.965482615790137 23.998995857913894 24.87762018325593 62-63 26.299271905598793 24.855636454933467 23.914135074064774 24.930956565402962 64-65 26.814870635518712 24.905802562170308 23.72519467470485 24.554132127606128 66-67 26.58036948598718 24.09199447027774 24.16739977378409 25.160236269950985 68-69 25.905888273779563 24.974836436839457 23.225968797181682 25.893306492199297 70-71 26.686807653575023 24.446122860020143 23.40130916414904 25.465760322255793 72-73 25.297543681944795 24.563180552038492 24.474550519118765 25.66472524689795 74-75 27.139037433155078 21.283422459893046 24.81283422459893 26.764705882352942 76 29.713866471019813 0.0 34.92296404988995 35.36316947909024 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 12.0 1 6.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.5 18 2.5 19 3.5 20 4.0 21 4.5 22 3.0 23 3.0 24 5.5 25 8.0 26 11.5 27 10.5 28 8.0 29 12.0 30 19.0 31 20.5 32 28.5 33 39.5 34 38.0 35 65.5 36 93.5 37 97.5 38 111.5 39 123.0 40 143.0 41 167.0 42 181.5 43 195.5 44 207.0 45 200.0 46 186.0 47 187.0 48 182.0 49 182.5 50 190.0 51 161.5 52 137.0 53 126.0 54 114.0 55 121.5 56 124.0 57 112.5 58 105.5 59 115.5 60 109.0 61 106.0 62 125.5 63 110.0 64 86.5 65 86.0 66 81.5 67 82.0 68 73.5 69 65.5 70 75.5 71 74.5 72 58.0 73 50.5 74 52.5 75 47.0 76 34.0 77 27.0 78 25.0 79 21.5 80 19.5 81 13.0 82 5.5 83 2.5 84 4.5 85 4.5 86 3.5 87 4.0 88 3.0 89 2.5 90 2.5 91 1.0 92 0.0 93 1.5 94 1.5 95 0.5 96 1.0 97 1.0 98 1.0 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.3 3 0.3 4 0.3 5 0.3 6 0.3 7 0.3 8 0.3 9 0.3 10-11 0.3875 12-13 0.46249999999999997 14-15 0.46249999999999997 16-17 0.5 18-19 0.5 20-21 0.4 22-23 0.5 24-25 0.43750000000000006 26-27 0.44999999999999996 28-29 0.475 30-31 0.35000000000000003 32-33 0.325 34-35 0.3 36-37 0.037612838515546636 38-39 0.0 40-41 0.0 42-43 0.08776328986960882 44-45 0.08778530223225482 46-47 0.1254075746175069 48-49 0.17557060446450964 50-51 0.1254075746175069 52-53 0.012540757461750688 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0628693574751666 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 12.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 1.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 2.0 57 0.0 58 0.0 59 0.0 60 1.0 61 0.0 62 0.0 63 2.0 64 0.0 65 2.0 66 1.0 67 1.0 68 1.0 69 2.0 70 4.0 71 5.0 72 32.0 73 59.0 74 268.0 75 880.0 76 2726.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.41877072175465 96.475 2 1.4027033919918388 2.75 3 0.12751849018107625 0.375 4 0.02550369803621525 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02550369803621525 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 12 0.3 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 899696 spots for SRR11389762.sra Written 899696 spots for SRR11389762.sra Read 899696 spots for SRR11389762.sra Written 899696 spots for SRR11389762.sra Read 899696 spots for SRR11389762.sra Written 899696 spots for SRR11389762.sra Read 899696 spots for SRR11389762.sra Written 899696 spots for SRR11389762.sra Read 899696 spots for SRR11389762.sra Written 899696 spots for SRR11389762.sra Read 899696 spots for SRR11389762.sra Written 899696 spots for SRR11389762.sra Read 899696 spots for SRR11389762.sra Written 899696 spots for SRR11389762.sra Read 899696 spots for SRR11389762.sra Written 899696 spots for SRR11389762.sra Read 899696 spots for SRR11389762.sra Written 899696 spots for SRR11389762.sra Read 899696 spots for SRR11389762.sra Written 899696 spots for SRR11389762.sra Read 899696 spots for SRR11389762.sra Written 899696 spots for SRR11389762.sra Read 899696 spots for SRR11389762.sra Written 899696 spots for SRR11389762.sra Read 899696 spots for SRR11389762.sra Written 899696 spots for SRR11389762.sra Read 899696 spots for SRR11389762.sra Written 899696 spots for SRR11389762.sra Read 899696 spots for SRR11389762.sra Written 899696 spots for SRR11389762.sra Read 899696 spots for SRR11389762.sra Written 899696 spots for SRR11389762.sra Read 899707 spots for SRR11389762.sra Written 899707 spots for SRR11389762.sra Read 899696 spots for SRR11389762.sra Written 899696 spots for SRR11389762.sra Read 899696 spots for SRR11389762.sra Written 899696 spots for SRR11389762.sra Read 899696 spots for SRR11389762.sra Written 899696 spots for SRR11389762.sra SRR ids: ['SRR11389762.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yaev3tqi SRR11389762.sra spots: 17993931 blocks: [[1, 899696], [899697, 1799392], [1799393, 2699088], [2699089, 3598784], [3598785, 4498480], [4498481, 5398176], [5398177, 6297872], [6297873, 7197568], [7197569, 8097264], [8097265, 8996960], [8996961, 9896656], [9896657, 10796352], [10796353, 11696048], [11696049, 12595744], [12595745, 13495440], [13495441, 14395136], [14395137, 15294832], [15294833, 16194528], [16194529, 17094224], [17094225, 17993931]] SRR11389762 file size 3415703 SRR11389762 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389762 SRR11389762_1.fastq SRR11389762_2.fastq Input file: SRR11389762_1.fastq Paired file: SRR11389762_2.fastq trimmed: SRR11389762-trimmed-pair1.fastq, SRR11389762-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 05:06:09 2024 >> started Sat Dec 7 05:06:23 2024 >> done (13.567s) 17993931 read pairs processed; of these: 147 ( 0.00%) short read pairs filtered out after trimming by size control 152771 ( 0.85%) empty read pairs filtered out after trimming by size control 17841013 (99.15%) read pairs available; of these: 8147 ( 0.05%) trimmed read pairs available after processing 17832866 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 214 0.00% 19 6 0.00% 20 316 0.00% 21 5 0.00% 22 404 0.00% 23 12 0.00% 24 486 0.00% 25 8 0.00% 26 458 0.00% 27 14 0.00% 28 376 0.00% 29 13 0.00% 30 314 0.00% 31 14 0.00% 32 208 0.00% 33 9 0.00% 34 130 0.00% 35 266 0.00% 36 446 0.00% 37 298 0.00% 38 374 0.00% 39 384 0.00% 40 485 0.00% 41 516 0.00% 42 648 0.00% 43 730 0.00% 44 852 0.00% 45 930 0.01% 46 987 0.01% 47 1072 0.01% 48 1306 0.01% 49 1336 0.01% 50 1513 0.01% 51 1671 0.01% 52 1760 0.01% 53 1936 0.01% 54 1993 0.01% 55 2429 0.01% 56 2709 0.02% 57 2812 0.02% 58 2993 0.02% 59 3422 0.02% 60 3524 0.02% 61 3706 0.02% 62 3978 0.02% 63 4420 0.02% 64 4807 0.03% 65 5098 0.03% 66 5601 0.03% 67 5947 0.03% 68 6230 0.03% 69 7019 0.04% 70 8036 0.05% 71 9727 0.05% 72 25490 0.14% 73 163890 0.92% 74 1259361 7.06% 75 7976200 44.71% 76 8311124 46.58% 17841013 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=26 prefix-density=0.47 prefix-fanout=2.0 sequence=TTAGGCCTTGCCGGACTCCTCGCAGCCTGGAGGCTTGAAGGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=26 fanout-score=21.58 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=6.4 sequence=CCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCGACGAAGTGGAAGCTGTCATCTGCACCATCCTTGAGCGAGAGGAGTGCCTTGATTCCACCGCAGCGGCTGTGGCCAATCACCACGATGACCTCAACCTTGAGGGCACACACGGCGTACTCGATGGCCGACCCAACACCGGCGTACTTGTTCTTGCAGTAGGACGGGACCATGTTGGCGATGTTGCGGACGGTGAAGGCCTCACCGGGCTCCAGGCCCAGGGTCACCGACGGGCACACACGTGAGTCGGCGCAGGCGAACACCATGTACTTGGGGGCCTGGCCGGCCTTGAGCGGCTCGAAGACATCCGGCTTCTTGTCGTAGACCTCGGTCTTGAACTTCTCGAACCCGGTCTTGAGGCGCTCCACGGCGGCGTCCATCAATGCGGGCGCGACGGGCGCGGCCTGGACGGGGGCGTTCCTGATGAGCCTGGGCCGGAAGCTGCCGGAAGAGGACGGGGCCGGGGTGCCGAG criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=25 prefix-density=0.46 prefix-fanout=2.1 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=7.88 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.7 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC SRR11389762 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 05:06:50 Started mapping on | Dec 07 05:06:50 Finished on | Dec 07 05:08:02 Mapping speed, Million of reads per hour | 892.05 Number of input reads | 17841013 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 15407539 Uniquely mapped reads % | 86.36% Average mapped length | 150.24 Number of splices: Total | 7507894 Number of splices: Annotated (sjdb) | 7178971 Number of splices: GT/AG | 7401636 Number of splices: GC/AG | 94687 Number of splices: AT/AC | 2784 Number of splices: Non-canonical | 8787 Mismatch rate per base, % | 0.53% Deletion rate per base | 0.01% Deletion average length | 1.68 Insertion rate per base | 0.01% Insertion average length | 1.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1554539 % of reads mapped to multiple loci | 8.71% Number of reads mapped to too many loci | 38283 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.06% % of reads unmapped: other | 0.65% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 878935 878935 878935 N_multimapping 1554539 1554539 1554539 N_noFeature 525369 14948554 699158 N_ambiguous 395121 2570 115866 UnstrandedReadsAssigned:14487049 PositiveStrandReadsAssigned:456415 NegativeStrandReadsAssigned:14592515 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389762 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389762-trimmed-pair1.fastq SRR11389762-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,841,013 reads, 16,043,745 reads pseudoaligned [quant] estimated average fragment length: 192.515 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52973 SRR11389762.ke.tsv 35125 SRR11389762.se.tsv 88098 total ==> SRR11389762.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 744.602 0 0 PNS24247 1044 852.485 24.688 2.53771 PNS24249 1928 1736.49 122.37 6.17514 PNS24246 1044 852.485 24.688 2.53771 PNS24248 1044 852.485 24.688 2.53771 PNS24244 1471 1279.49 36.5656 2.50426 PNS24243 293 115.584 0 0 KQK14069 1603 1411.49 3991.99 247.831 KQK14071 474 284.515 287.305 88.4871 ==> SRR11389762.se.tsv <== BRADI_1g14170v3 4631 BRADI_1g53295v3 19 BRADI_1g59795v3 266 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 192 BRADI_1g74790v3 198 BRADI_1g09890v3 0 BRADI_1g77505v3 247 BRADI_1g48960v3 0 SRR11389762 completed mapping pipeline successfully