Starting /dee2/code/volunteer_pipeline.sh SRR11389763 current disk space = 1546842939392 free memory = 1500829824 SRR11389763 SRAfilesize 51f1b5bda23fbcce793c4e4d102b7bf2 SRR11389763.sra SRR11389763.sra file validated SRR11389763 is paired end SRR11389763 is conventional basespace SRR11389763 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389763_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.1845 32.0 32.0 32.0 32.0 32.0 2 31.21875 32.0 32.0 32.0 32.0 32.0 3 31.20925 32.0 32.0 32.0 32.0 32.0 4 31.21375 32.0 32.0 32.0 32.0 32.0 5 31.257 32.0 32.0 32.0 32.0 32.0 6 34.557 36.0 36.0 36.0 32.0 36.0 7 34.56375 36.0 36.0 36.0 32.0 36.0 8 34.42375 36.0 36.0 36.0 32.0 36.0 9 34.5165 36.0 36.0 36.0 32.0 36.0 10-11 34.394625 36.0 36.0 36.0 32.0 36.0 12-13 34.61225 36.0 36.0 36.0 32.0 36.0 14-15 34.4855 36.0 36.0 36.0 32.0 36.0 16-17 34.448625 36.0 36.0 36.0 32.0 36.0 18-19 34.476625 36.0 36.0 36.0 32.0 36.0 20-21 34.46 36.0 36.0 36.0 32.0 36.0 22-23 34.491375000000005 36.0 36.0 36.0 32.0 36.0 24-25 34.342124999999996 36.0 36.0 36.0 32.0 36.0 26-27 34.408500000000004 36.0 36.0 36.0 32.0 36.0 28-29 34.21875 36.0 36.0 36.0 32.0 36.0 30-31 34.185875 36.0 36.0 36.0 32.0 36.0 32-33 34.16175 36.0 36.0 36.0 32.0 36.0 34-35 34.102000000000004 36.0 36.0 36.0 32.0 36.0 36-37 34.14212371650388 36.0 36.0 36.0 32.0 36.0 38-39 34.02942649636864 36.0 36.0 36.0 32.0 36.0 40-41 34.222389181066866 36.0 36.0 36.0 32.0 36.0 42-43 33.99636930384686 36.0 36.0 36.0 32.0 36.0 44-45 33.98559619238477 36.0 36.0 36.0 32.0 36.0 46-47 34.09857214428858 36.0 36.0 36.0 32.0 36.0 48-49 33.779128038085695 36.0 36.0 36.0 29.5 36.0 50-51 33.84337067298665 36.0 36.0 36.0 32.0 36.0 52-53 33.91942355889724 36.0 36.0 36.0 32.0 36.0 54-55 33.62045625470043 36.0 36.0 36.0 27.0 36.0 56-57 33.60002506893959 36.0 36.0 36.0 27.0 36.0 58-59 33.50922525540001 36.0 36.0 36.0 27.0 36.0 60-61 33.540015052684396 36.0 36.0 36.0 27.0 36.0 62-63 33.25420390795495 36.0 36.0 36.0 27.0 36.0 64-65 33.22310660336566 36.0 34.0 36.0 27.0 36.0 66-67 33.22383910322839 36.0 34.0 36.0 24.0 36.0 68-69 33.347493577819115 36.0 34.0 36.0 27.0 36.0 70-71 33.25941104601292 36.0 34.0 36.0 27.0 36.0 72-73 33.34679721942169 36.0 36.0 36.0 27.0 36.0 74-75 33.33188860950138 36.0 36.0 36.0 27.0 36.0 76 32.10318331503842 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 1.0 22 1.0 23 3.0 24 6.0 25 21.0 26 26.0 27 76.0 28 91.0 29 116.0 30 173.0 31 219.0 32 278.0 33 393.0 34 853.0 35 1734.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.96118206862008 13.223140495867769 12.246431254695718 39.56924618081643 2 23.69146005509642 14.224893563736538 34.109691960931634 27.973954420235415 3 20.861507638367144 21.362384172301528 24.542950162784873 33.233158026546455 4 27.097420485850236 26.120711244678184 19.083395942900076 27.698472326571498 5 26.270974204858504 30.879038317054846 22.389181066867017 20.460806411219636 6 22.642928786359075 31.569709127382144 24.523570712136408 21.263791374122366 7 17.806160781367392 24.893563736538944 36.438767843726524 20.861507638367144 8 19.509140996744303 23.340846481342346 29.251189581768095 27.89882294014525 9 22.01352366641623 20.235411970949162 31.78061607813674 25.97044828449787 10-11 23.59128474830954 28.78787878787879 23.040320560981716 24.58051590282995 12-13 23.67893814174806 23.127973954420238 25.569747057350362 27.62334084648134 14-15 23.528675181567742 25.131480090157776 26.496368645128975 24.843476083145504 16-17 24.104683195592287 24.455296769346358 24.818432256448787 26.62158777861257 18-19 23.854244928625093 24.60555972952667 25.29426496368645 26.245930378161788 20-21 23.578762834961182 24.655647382920108 25.7450538442274 26.02053593789131 22-23 24.29555416405761 24.95929868503444 25.184721352536005 25.56042579837195 24-25 24.693213122965187 24.94365138993238 25.206611570247933 25.156523916854496 26-27 24.02955171550213 24.993739043325817 24.893563736538944 26.08314550463311 28-29 24.217380415727526 24.58051590282995 25.444527923866765 25.757575757575758 30-31 23.653894315051343 24.98121712997746 25.28174305033809 26.08314550463311 32-33 23.40345604808415 25.0313047833709 24.693213122965187 26.872026045579766 34-35 24.267468069120962 25.018782870022537 24.27998998246932 26.433759078387176 36-37 24.167292762334082 24.092161282243925 25.331830703731526 26.408715251690456 38-39 24.092161282243925 24.805910343100425 25.169045830202858 25.93288254445279 40-41 24.430252942649634 24.192336589030806 25.845229151014276 25.532181317305287 42-43 23.9073262366938 25.021916092673763 24.245460237946148 26.825297432686284 44-45 24.73697394789579 24.574148296593187 23.835170340681362 26.853707414829657 46-47 23.885270541082164 25.26302605210421 25.288076152304612 25.56362725450902 48-49 24.229516411926834 25.21924329741919 24.56777749937359 25.98346279128038 50-51 24.758802155118406 24.194963037213384 24.82145094599674 26.22478386167147 52-53 24.32330827067669 25.576441102756892 23.984962406015036 26.11528822055138 54-55 23.76535472549511 24.85585359739283 24.37954374529957 26.999247931812487 56-57 24.58009526197042 24.417147154675355 24.75557783905741 26.247179744296815 58-59 24.739811912225708 24.200626959247646 24.978056426332287 26.08150470219436 60-61 24.29754139488209 24.9372804816859 24.372804816859006 26.39237330657301 62-63 24.341279799247175 24.592220828105397 24.993726474278542 26.072772898368886 64-65 25.19774011299435 23.91713747645951 24.43188951663528 26.45323289391086 66-67 23.749685850716258 24.918321186227697 24.164362905252577 27.167630057803464 68-69 24.5881021255188 23.93409634008301 24.31140737014212 27.16639416425607 70-71 25.135237136746763 23.826896464964147 24.43074600578689 26.607120392502203 72-73 24.308973873532754 25.41966426858513 23.728385712482645 26.54297614539947 74-75 25.313945803040315 21.665565102445473 25.750165234633176 27.270323859881028 76 27.22283205268935 0.0 33.51628247347237 39.26088547383827 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 8.0 1 4.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.5 20 6.0 21 9.0 22 9.5 23 7.5 24 5.5 25 7.5 26 10.5 27 11.5 28 16.0 29 21.5 30 24.5 31 35.0 32 46.5 33 52.0 34 61.0 35 68.5 36 72.0 37 84.5 38 113.5 39 152.0 40 176.0 41 175.5 42 171.5 43 189.5 44 207.5 45 203.5 46 194.0 47 208.0 48 208.5 49 173.0 50 150.5 51 136.5 52 132.5 53 134.5 54 128.0 55 125.5 56 112.0 57 102.5 58 107.5 59 116.0 60 129.0 61 114.0 62 96.5 63 93.5 64 89.0 65 80.5 66 77.0 67 81.5 68 75.5 69 67.5 70 52.5 71 39.5 72 40.0 73 40.0 74 38.0 75 36.0 76 28.5 77 20.5 78 18.5 79 18.5 80 16.0 81 10.0 82 5.0 83 3.5 84 2.5 85 1.5 86 1.0 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.17500000000000002 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 0.3 7 0.17500000000000002 8 0.17500000000000002 9 0.17500000000000002 10-11 0.17500000000000002 12-13 0.17500000000000002 14-15 0.17500000000000002 16-17 0.17500000000000002 18-19 0.17500000000000002 20-21 0.17500000000000002 22-23 0.1875 24-25 0.17500000000000002 26-27 0.17500000000000002 28-29 0.17500000000000002 30-31 0.17500000000000002 32-33 0.17500000000000002 34-35 0.17500000000000002 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 7.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 1.0 43 0.0 44 0.0 45 0.0 46 0.0 47 1.0 48 0.0 49 0.0 50 1.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 1.0 58 1.0 59 1.0 60 0.0 61 0.0 62 2.0 63 1.0 64 1.0 65 1.0 66 4.0 67 1.0 68 1.0 69 0.0 70 1.0 71 5.0 72 15.0 73 56.0 74 231.0 75 934.0 76 2733.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.52321981424149 94.5 2 1.9865841073271415 3.85 3 0.38699690402476783 1.125 4 0.05159958720330237 0.2 5 0.0 0.0 6 0.025799793601651185 0.15 7 0.025799793601651185 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit CCCAGGAACAGGCTCGATGTGATAGCATCGTCCTTTGTAACGATCAAGAC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389763 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389763_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.81875 32.0 32.0 32.0 32.0 32.0 2 30.48825 32.0 32.0 32.0 32.0 32.0 3 30.427 32.0 32.0 32.0 32.0 32.0 4 30.5005 32.0 32.0 32.0 32.0 32.0 5 30.37 32.0 32.0 32.0 21.0 32.0 6 33.618 36.0 36.0 36.0 21.0 36.0 7 33.89525 36.0 36.0 36.0 32.0 36.0 8 33.6625 36.0 36.0 36.0 32.0 36.0 9 33.87875 36.0 36.0 36.0 32.0 36.0 10-11 33.83 36.0 36.0 36.0 32.0 36.0 12-13 33.8655 36.0 36.0 36.0 32.0 36.0 14-15 33.674625 36.0 36.0 36.0 26.5 36.0 16-17 33.569874999999996 36.0 36.0 36.0 24.0 36.0 18-19 33.61925 36.0 36.0 36.0 27.0 36.0 20-21 33.457625 36.0 36.0 36.0 24.0 36.0 22-23 33.506375 36.0 36.0 36.0 24.0 36.0 24-25 33.55 36.0 36.0 36.0 24.0 36.0 26-27 33.489625000000004 36.0 36.0 36.0 21.0 36.0 28-29 33.422 36.0 36.0 36.0 21.0 36.0 30-31 33.40375 36.0 36.0 36.0 21.0 36.0 32-33 33.380624999999995 36.0 36.0 36.0 20.5 36.0 34-35 33.40275 36.0 36.0 36.0 21.0 36.0 36-37 33.45078888054094 36.0 36.0 36.0 21.0 36.0 38-39 33.31617831204608 36.0 36.0 36.0 17.5 36.0 40-41 33.38504883546206 36.0 36.0 36.0 17.5 36.0 42-43 33.310970049289665 36.0 36.0 36.0 21.0 36.0 44-45 33.171593186372746 36.0 36.0 36.0 14.0 36.0 46-47 33.21668336673346 36.0 36.0 36.0 14.0 36.0 48-49 33.05412177399148 36.0 36.0 36.0 14.0 36.0 50-51 33.24609676282915 36.0 36.0 36.0 21.0 36.0 52-53 33.10751879699248 36.0 36.0 36.0 17.5 36.0 54-55 32.87239909751817 36.0 36.0 36.0 14.0 36.0 56-57 32.797944346954125 36.0 34.0 36.0 17.5 36.0 58-59 32.78796217471074 36.0 32.0 36.0 14.0 36.0 60-61 32.699071751128955 36.0 34.0 36.0 14.0 36.0 62-63 32.50402695830991 36.0 32.0 36.0 14.0 36.0 64-65 32.52468757538474 36.0 32.0 36.0 14.0 36.0 66-67 32.58615297311508 36.0 32.0 36.0 14.0 36.0 68-69 32.53051653356883 36.0 32.0 36.0 14.0 36.0 70-71 32.494777069611075 36.0 32.0 36.0 14.0 36.0 72-73 32.556105354254605 36.0 32.0 36.0 14.0 36.0 74-75 32.61401856070241 36.0 32.0 36.0 14.0 36.0 76 31.338878842676312 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 4.0 16 9.0 17 4.0 18 8.0 19 8.0 20 4.0 21 10.0 22 14.0 23 29.0 24 35.0 25 45.0 26 79.0 27 73.0 28 113.0 29 145.0 30 187.0 31 260.0 32 314.0 33 482.0 34 823.0 35 1345.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.521042084168336 20.240480961923847 11.397795591182366 32.84068136272545 2 30.227898822940148 22.364137240170297 28.900576008014024 18.50738792887553 3 25.219133483596295 27.172551965940393 22.839969947407965 24.768344603055347 4 28.600050087653393 31.605309291259704 17.079889807162534 22.71475081392437 5 28.625093914350114 33.75907838717756 17.680941647883795 19.93488605058853 6 22.61457550713749 34.43526170798898 20.460806411219636 22.489356373653894 7 24.092161282243925 16.829451540195343 34.510393188079135 24.567993989481593 8 25.344352617079892 21.362384172301528 23.99198597545705 29.301277235161532 9 24.467818682694716 22.439268720260454 25.694966190833963 27.39794640621087 10-11 27.326236693800876 27.326236693800876 19.97495303694427 25.372573575453977 12-13 27.342184368737477 21.8812625250501 24.07314629258517 26.703406813627257 14-15 25.876753507014026 24.39879759519038 24.34869739478958 25.37575150300601 16-17 27.304609218436877 23.910320641282564 22.319639278557112 26.465430861723448 18-19 26.427855711422843 24.36122244488978 23.810120240480963 25.400801603206414 20-21 26.65330661322645 23.960420841683366 23.659819639278556 25.726452905811627 22-23 27.74993735905788 23.95389626659985 22.400400902029567 25.895765472312704 24-25 27.467434869739478 24.03557114228457 23.76002004008016 24.73697394789579 26-27 27.355889724310778 24.899749373433583 22.86967418546366 24.87468671679198 28-29 26.31513026052104 24.298597194388776 23.509519038076153 25.876753507014026 30-31 26.102204408817638 25.0 23.10871743486974 25.789078156312623 32-33 26.826212254103492 24.6084450570104 23.994486906402706 24.5708557824834 34-35 26.809416478837967 23.916854495366895 22.890057600801402 26.383671424993736 36-37 26.737633061991232 25.034439574201627 22.542266750156543 25.685660613650597 38-39 26.997245179063363 24.94365138993238 23.879288755321813 24.179814675682447 40-41 27.61081893313298 24.442774855997996 22.201352366641622 25.7450538442274 42-43 26.656645371414257 24.50206689214581 23.487410747839156 25.353876988600778 44-45 26.19316046599023 25.21608417888012 23.1742452712013 25.416510083928344 46-47 26.49711851666249 24.830869456276623 22.738661989476324 25.933350037584564 48-49 26.766917293233085 23.721804511278197 23.984962406015036 25.526315789473685 50-51 26.670008773029203 24.89033713497932 23.01040230605339 25.42925178593809 52-53 27.309186614864018 24.62714625892969 22.44642185737561 25.61724526883068 54-55 26.29731762346453 24.492353973426926 23.577337678616196 25.632990724492355 56-57 26.146903985961394 24.479819503634996 24.028578591125598 25.344697919278016 58-59 27.53605015673981 24.551724137931036 22.194357366771158 25.71786833855799 60-61 26.404917210235823 24.611138986452584 23.783241344706475 25.200702458605118 62-63 26.461731493099123 24.441656210790462 23.475533249686322 25.62107904642409 64-65 26.490897677338353 24.469554300062775 23.477715003138734 25.56183301946014 66-67 27.249874308697837 24.1955756661639 23.466566113624935 25.087983911513323 68-69 26.29592350276799 24.421238047307497 24.28283844992451 25.0 70-71 27.115869017632242 23.41309823677582 23.778337531486144 25.692695214105793 72-73 26.455696202531648 23.911392405063292 23.455696202531644 26.177215189873415 74-75 27.901696273540804 21.53065313209563 24.629357553092028 25.93829304127154 76 30.307414104882458 0.0 30.669077757685354 39.02350813743219 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 7.0 1 3.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 2.5 17 3.5 18 3.0 19 2.5 20 2.5 21 1.5 22 4.0 23 4.5 24 3.5 25 6.5 26 12.0 27 14.5 28 14.5 29 15.0 30 17.0 31 26.5 32 35.0 33 37.0 34 45.5 35 68.0 36 86.0 37 98.0 38 108.5 39 125.5 40 145.0 41 164.0 42 175.5 43 182.0 44 194.5 45 184.5 46 169.5 47 160.0 48 142.5 49 131.0 50 136.5 51 136.0 52 124.0 53 135.5 54 150.5 55 135.5 56 125.0 57 131.5 58 130.5 59 125.0 60 118.5 61 123.5 62 128.5 63 105.0 64 93.5 65 97.0 66 91.0 67 91.5 68 95.0 69 89.0 70 67.5 71 52.0 72 62.5 73 68.5 74 47.5 75 35.5 76 33.0 77 19.5 78 16.5 79 19.5 80 19.0 81 17.5 82 11.5 83 8.0 84 7.0 85 4.5 86 2.5 87 2.0 88 1.5 89 1.5 90 1.0 91 2.0 92 4.0 93 3.0 94 1.5 95 2.0 96 3.0 97 2.0 98 1.5 99 3.5 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.17500000000000002 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 0.17500000000000002 7 0.17500000000000002 8 0.17500000000000002 9 0.17500000000000002 10-11 0.1875 12-13 0.2 14-15 0.2 16-17 0.2 18-19 0.2 20-21 0.2 22-23 0.22499999999999998 24-25 0.2 26-27 0.25 28-29 0.2 30-31 0.2 32-33 0.2375 34-35 0.17500000000000002 36-37 0.012521913348359628 38-39 0.0 40-41 0.0 42-43 0.025046963055729492 44-45 0.0125250501002004 46-47 0.0250501002004008 48-49 0.025056376847907794 50-51 0.02505951635133442 52-53 0.012531328320802004 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.01258019876714052 70-71 0.0 72-73 0.012656625743576764 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 7.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 1.0 43 0.0 44 0.0 45 0.0 46 0.0 47 1.0 48 0.0 49 0.0 50 1.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 1.0 58 1.0 59 1.0 60 0.0 61 0.0 62 2.0 63 1.0 64 1.0 65 2.0 66 4.0 67 1.0 68 1.0 69 0.0 70 8.0 71 4.0 72 23.0 73 59.0 74 273.0 75 842.0 76 2765.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.1 #Duplication Level Percentage of deduplicated Percentage of total 1 97.83728115345005 95.0 2 1.776519052523172 3.45 3 0.15447991761071062 0.44999999999999996 4 0.10298661174047373 0.4 5 0.07723995880535531 0.375 6 0.025746652935118432 0.15 7 0.025746652935118432 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit ACGAATTCCCCCTACTTATTCAAAAACTTTCCAAGGCCCGCCTCACGGTA 5 0.125 No Hit TATTAAGCCAAAATTGGGATTATCTGCAAAAAATTACGGTAGAGCGTGTT 5 0.125 No Hit GTGAAATCAAGGGGCATTACTTGAATGCAACTGCGGGTACATGTGAAGAAATGATGAAGAGAGCTGTTTTTGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGCTC 20 0.0066304086 52.153126 9 >>END_MODULE Read 324441 spots for SRR11389763.sra Written 324441 spots for SRR11389763.sra Read 324441 spots for SRR11389763.sra Written 324441 spots for SRR11389763.sra Read 324441 spots for SRR11389763.sra Written 324441 spots for SRR11389763.sra Read 324441 spots for SRR11389763.sra Written 324441 spots for SRR11389763.sra Read 324441 spots for SRR11389763.sra Written 324441 spots for SRR11389763.sra Read 324441 spots for SRR11389763.sra Written 324441 spots for SRR11389763.sra Read 324441 spots for SRR11389763.sra Written 324441 spots for SRR11389763.sra Read 324441 spots for SRR11389763.sra Written 324441 spots for SRR11389763.sra Read 324441 spots for SRR11389763.sra Written 324441 spots for SRR11389763.sra Read 324441 spots for SRR11389763.sra Written 324441 spots for SRR11389763.sra Read 324441 spots for SRR11389763.sra Written 324441 spots for SRR11389763.sra Read 324441 spots for SRR11389763.sra Written 324441 spots for SRR11389763.sra Read 324441 spots for SRR11389763.sra Written 324441 spots for SRR11389763.sra Read 324441 spots for SRR11389763.sra Written 324441 spots for SRR11389763.sra Read 324441 spots for SRR11389763.sra Written 324441 spots for SRR11389763.sra Read 324441 spots for SRR11389763.sra Written 324441 spots for SRR11389763.sra Read 324441 spots for SRR11389763.sra Written 324441 spots for SRR11389763.sra Read 324441 spots for SRR11389763.sra Written 324441 spots for SRR11389763.sra Read 324447 spots for SRR11389763.sra Written 324447 spots for SRR11389763.sra Read 324441 spots for SRR11389763.sra Written 324441 spots for SRR11389763.sra SRR ids: ['SRR11389763.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cmep5mwa SRR11389763.sra spots: 6488826 blocks: [[1, 324441], [324442, 648882], [648883, 973323], [973324, 1297764], [1297765, 1622205], [1622206, 1946646], [1946647, 2271087], [2271088, 2595528], [2595529, 2919969], [2919970, 3244410], [3244411, 3568851], [3568852, 3893292], [3893293, 4217733], [4217734, 4542174], [4542175, 4866615], [4866616, 5191056], [5191057, 5515497], [5515498, 5839938], [5839939, 6164379], [6164380, 6488826]] SRR11389763 file size 1225879 SRR11389763 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389763 SRR11389763_1.fastq SRR11389763_2.fastq Input file: SRR11389763_1.fastq Paired file: SRR11389763_2.fastq trimmed: SRR11389763-trimmed-pair1.fastq, SRR11389763-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 04:56:32 2024 >> started Sat Dec 7 04:57:23 2024 >> done (50.895s) 6488826 read pairs processed; of these: 37 ( 0.00%) short read pairs filtered out after trimming by size control 32076 ( 0.49%) empty read pairs filtered out after trimming by size control 6456713 (99.51%) read pairs available; of these: 2744 ( 0.04%) trimmed read pairs available after processing 6453969 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 39 0.00% 19 0 0.00% 20 58 0.00% 21 1 0.00% 22 62 0.00% 23 3 0.00% 24 94 0.00% 25 1 0.00% 26 88 0.00% 27 2 0.00% 28 65 0.00% 29 5 0.00% 30 68 0.00% 31 1 0.00% 32 40 0.00% 33 3 0.00% 34 29 0.00% 35 59 0.00% 36 119 0.00% 37 88 0.00% 38 119 0.00% 39 111 0.00% 40 122 0.00% 41 156 0.00% 42 179 0.00% 43 206 0.00% 44 225 0.00% 45 254 0.00% 46 269 0.00% 47 253 0.00% 48 333 0.01% 49 370 0.01% 50 374 0.01% 51 446 0.01% 52 509 0.01% 53 503 0.01% 54 618 0.01% 55 683 0.01% 56 815 0.01% 57 906 0.01% 58 938 0.01% 59 1054 0.02% 60 1105 0.02% 61 1168 0.02% 62 1271 0.02% 63 1403 0.02% 64 1473 0.02% 65 1632 0.03% 66 1760 0.03% 67 2024 0.03% 68 2104 0.03% 69 2151 0.03% 70 2590 0.04% 71 3232 0.05% 72 9831 0.15% 73 60683 0.94% 74 446223 6.91% 75 2881255 44.62% 76 3026540 46.87% 6456713 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=23 prefix-density=0.72 prefix-fanout=2.0 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=29.12 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.0 sequence=TTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATATGATCTCCCC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=19 prefix-density=0.54 prefix-fanout=2.3 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=6.53 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=2.0 sequence=ACCAGAGCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCGACCGCCACCATGGCCCTCTCCTCCTCGACCTTCGCCGGGAAGGCGGTGAAGAACCTGCCGGCGCTCGGAGAGGCCCGCATCACCA SRR11389763 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 05:02:15 Started mapping on | Dec 07 05:02:16 Finished on | Dec 07 05:11:50 Mapping speed, Million of reads per hour | 40.50 Number of input reads | 6456713 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 5255641 Uniquely mapped reads % | 81.40% Average mapped length | 150.38 Number of splices: Total | 2370703 Number of splices: Annotated (sjdb) | 2261034 Number of splices: GT/AG | 2339560 Number of splices: GC/AG | 28418 Number of splices: AT/AC | 771 Number of splices: Non-canonical | 1954 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.01% Deletion average length | 1.35 Insertion rate per base | 0.00% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 772891 % of reads mapped to multiple loci | 11.97% Number of reads mapped to too many loci | 14068 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.77% % of reads unmapped: other | 0.65% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 428181 428181 428181 N_multimapping 772891 772891 772891 N_noFeature 188951 5095073 250384 N_ambiguous 146226 960 49964 UnstrandedReadsAssigned:4920464 PositiveStrandReadsAssigned:159608 NegativeStrandReadsAssigned:4955293 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389763 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389763-trimmed-pair1.fastq SRR11389763-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,456,713 reads, 5,720,871 reads pseudoaligned [quant] estimated average fragment length: 190.83 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,039 rounds 52973 SRR11389763.ke.tsv 35125 SRR11389763.se.tsv 88098 total ==> SRR11389763.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 746.324 1.40164e-08 4.60815e-09 PNS24247 1044 854.17 8.02288 2.30464 PNS24249 1928 1738.17 47.0037 6.63525 PNS24246 1044 854.17 8.02288 2.30464 PNS24248 1044 854.17 8.02288 2.30464 PNS24244 1471 1281.17 14.9277 2.85893 PNS24243 293 116.999 0 0 KQK14069 1603 1413.17 1455.93 252.793 KQK14071 474 286.045 98.1686 84.2085 ==> SRR11389763.se.tsv <== BRADI_1g14170v3 1670 BRADI_1g53295v3 16 BRADI_1g59795v3 69 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 35 BRADI_1g74790v3 52 BRADI_1g09890v3 0 BRADI_1g77505v3 69 BRADI_1g48960v3 0 SRR11389763 completed mapping pipeline successfully