Starting /dee2/code/volunteer_pipeline.sh SRR11389764 current disk space = 1546873511936 free memory = 1598142440 SRR11389764 SRAfilesize 99a6d5c18c9b94685a50b03e860ca9ea SRR11389764.sra SRR11389764.sra file validated SRR11389764 is paired end SRR11389764 is conventional basespace SRR11389764 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389764_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.98375 32.0 32.0 32.0 32.0 32.0 2 31.24225 32.0 32.0 32.0 32.0 32.0 3 31.179 32.0 32.0 32.0 32.0 32.0 4 31.16325 32.0 32.0 32.0 32.0 32.0 5 31.257 32.0 32.0 32.0 32.0 32.0 6 34.23775 36.0 36.0 36.0 32.0 36.0 7 34.25125 36.0 36.0 36.0 32.0 36.0 8 34.32275 36.0 36.0 36.0 32.0 36.0 9 34.44225 36.0 36.0 36.0 32.0 36.0 10-11 34.315749999999994 36.0 36.0 36.0 32.0 36.0 12-13 34.42275 36.0 36.0 36.0 32.0 36.0 14-15 34.37525 36.0 36.0 36.0 32.0 36.0 16-17 34.253 36.0 36.0 36.0 32.0 36.0 18-19 34.385625000000005 36.0 36.0 36.0 32.0 36.0 20-21 34.30025 36.0 36.0 36.0 32.0 36.0 22-23 34.3115 36.0 36.0 36.0 32.0 36.0 24-25 34.320750000000004 36.0 36.0 36.0 32.0 36.0 26-27 34.137249999999995 36.0 36.0 36.0 32.0 36.0 28-29 34.061375 36.0 36.0 36.0 32.0 36.0 30-31 33.945125 36.0 36.0 36.0 32.0 36.0 32-33 34.048375 36.0 36.0 36.0 32.0 36.0 34-35 33.943625 36.0 36.0 36.0 32.0 36.0 36-37 33.92994746059544 36.0 36.0 36.0 32.0 36.0 38-39 33.89241931448586 36.0 36.0 36.0 29.5 36.0 40-41 33.9013009757318 36.0 36.0 36.0 32.0 36.0 42-43 33.974731048286216 36.0 36.0 36.0 32.0 36.0 44-45 33.981361020765576 36.0 36.0 36.0 32.0 36.0 46-47 33.883760950091954 36.0 36.0 36.0 29.5 36.0 48-49 33.60332071950228 36.0 36.0 36.0 27.0 36.0 50-51 33.61492238357536 36.0 36.0 36.0 27.0 36.0 52-53 33.791437155733604 36.0 36.0 36.0 27.0 36.0 54-55 33.50963945918878 36.0 36.0 36.0 27.0 36.0 56-57 33.581572674525106 36.0 36.0 36.0 27.0 36.0 58-59 33.41460950044869 36.0 36.0 36.0 27.0 36.0 60-61 33.36296389167502 36.0 36.0 36.0 27.0 36.0 62-63 33.292126379137414 36.0 34.0 36.0 27.0 36.0 64-65 33.22845760129649 36.0 32.0 36.0 27.0 36.0 66-67 33.222680014941915 36.0 36.0 36.0 24.0 36.0 68-69 33.07578295421959 36.0 34.0 36.0 24.0 36.0 70-71 33.065341535523814 36.0 34.0 36.0 24.0 36.0 72-73 33.03230270651537 36.0 34.0 36.0 21.0 36.0 74-75 33.03022204538326 36.0 34.0 36.0 21.0 36.0 76 31.92730627306273 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 4.0 23 10.0 24 11.0 25 22.0 26 34.0 27 61.0 28 95.0 29 133.0 30 181.0 31 243.0 32 307.0 33 462.0 34 854.0 35 1578.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.021015761821367 19.53965474105579 11.408556417312985 41.030773079809855 2 23.967975981986488 15.13635226419815 37.703277458093574 23.19239429572179 3 19.914936202151615 22.34175631723793 23.042281711283465 34.701025769326996 4 24.69352014010508 28.42131598699024 20.240180135101326 26.64498373780335 5 25.99449587190393 30.047535651738805 24.143107330497873 19.814861145859393 6 20.833333333333336 32.028112449799195 25.251004016064254 21.88755020080321 7 17.162872154115586 24.993745308981737 37.10282712034025 20.740555416562422 8 18.689016762571928 22.366775081310983 32.724543407555664 26.21966474856142 9 20.26519889917438 20.440330247685765 32.44933700275207 26.845133850387793 10-11 23.417563172379285 29.509632224168126 22.942206654991242 24.130597948461347 12-13 23.58018513885414 23.492619464598448 26.732549412059043 26.194645984488368 14-15 23.39254440830623 25.093820365273956 27.1703777833375 24.34325744308231 16-17 23.44258193645234 25.706780085063798 26.019514635976982 24.83112334250688 18-19 22.95471603702777 25.268951713785338 25.243932949712285 26.53239929947461 20-21 23.34250688016012 25.64423317488116 25.55666750062547 25.456592444333246 22-23 23.458025772550982 26.022769923683224 24.98436131615163 25.534842987614166 24-25 23.48011008256192 25.431573680260193 25.93194896172129 25.156367275456592 26-27 22.979734801100825 25.331498623967974 26.432324243182386 25.25644233174881 28-29 23.48011008256192 26.46985238929197 25.268951713785338 24.78108581436077 30-31 23.73029772329247 25.41906429822367 26.244683512634477 24.605954465849386 32-33 23.00475356517388 25.481611208406306 26.945208906680012 24.568426319739807 34-35 24.130597948461347 25.99449587190393 25.68176132099074 24.193144858643983 36-37 24.10557918438829 24.55591693770328 25.581686264698522 25.756817613209908 38-39 23.34250688016012 25.293970477858394 26.64498373780335 24.718538904178132 40-41 23.517638228671505 24.74355766825119 25.73179884913685 26.007005253940456 42-43 24.96872654490868 24.580935701776333 25.469101826369776 24.981235926945207 44-45 24.7935951963973 24.83112334250688 25.006254691018263 25.369026770077557 46-47 24.183660703115226 25.8726385587389 24.959339421994244 24.98436131615163 48-49 23.206909500563274 25.62273125547628 25.77293778946051 25.397421454499934 50-51 23.322483725588384 25.51326990485729 25.550826239359036 25.61342013019529 52-53 24.87481221832749 24.749624436654983 25.363044566850274 25.01251877816725 54-55 24.824737105658485 24.649474211316978 25.262894341512272 25.262894341512272 56-57 23.29367564182843 25.447714464621164 25.297432686286786 25.96117720726362 58-59 23.994486906402706 24.407968926199725 25.836361358225783 25.761182809171785 60-61 24.799398194583752 24.34804413239719 25.20060180541625 25.651955867602812 62-63 23.432798395185557 24.94984954864594 26.366599799398195 25.25075225677031 64-65 24.58934169278997 24.58934169278997 24.9153605015674 25.905956112852664 66-67 24.12192674360261 25.23833416959358 24.72403411941796 25.91570496738585 68-69 23.681567051732795 25.69060773480663 25.489703666499246 25.13812154696133 70-71 24.085940444779492 25.04083427566277 25.116220630732506 25.757004648825227 72-73 24.93067809427779 25.018905974287875 24.426518779934458 25.623897151499875 74-75 24.305278553383857 21.752426539024068 27.483047467092142 26.459247440499933 76 28.19188191881919 0.0 37.19557195571956 34.61254612546125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 3.0 19 4.0 20 4.0 21 6.5 22 9.5 23 8.5 24 7.5 25 10.0 26 11.5 27 15.0 28 19.0 29 27.0 30 32.5 31 34.5 32 46.0 33 60.0 34 65.0 35 85.5 36 115.0 37 129.5 38 145.5 39 162.5 40 173.5 41 201.5 42 227.5 43 232.5 44 234.0 45 228.0 46 221.0 47 194.5 48 165.0 49 163.5 50 156.0 51 132.5 52 116.0 53 109.5 54 103.0 55 110.0 56 119.0 57 106.5 58 98.5 59 98.0 60 99.0 61 102.5 62 102.5 63 87.0 64 80.5 65 83.0 66 63.5 67 53.5 68 57.0 69 59.0 70 49.0 71 41.5 72 41.5 73 37.0 74 33.5 75 28.5 76 23.5 77 18.0 78 13.5 79 10.0 80 7.5 81 4.5 82 3.0 83 3.0 84 2.0 85 1.5 86 2.0 87 1.5 88 1.0 89 1.0 90 0.5 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.075 4 0.075 5 0.075 6 0.4 7 0.075 8 0.075 9 0.075 10-11 0.075 12-13 0.075 14-15 0.075 16-17 0.075 18-19 0.075 20-21 0.075 22-23 0.08750000000000001 24-25 0.075 26-27 0.075 28-29 0.075 30-31 0.075 32-33 0.075 34-35 0.075 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 3.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 1.0 47 1.0 48 1.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 1.0 57 1.0 58 1.0 59 2.0 60 0.0 61 0.0 62 0.0 63 0.0 64 1.0 65 0.0 66 2.0 67 2.0 68 2.0 69 1.0 70 1.0 71 4.0 72 16.0 73 69.0 74 259.0 75 921.0 76 2710.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.5 #Duplication Level Percentage of deduplicated Percentage of total 1 97.94871794871794 95.5 2 1.7179487179487178 3.35 3 0.1794871794871795 0.525 4 0.1282051282051282 0.5 5 0.02564102564102564 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATTTCACCGGTTTCCGCCTGTGATTTATAAATAGCTTCGGCACAAAAGACAAAACGATCTCTCCAGCGCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389764 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389764_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.83975 32.0 32.0 32.0 32.0 32.0 2 30.5115 32.0 32.0 32.0 32.0 32.0 3 30.67575 32.0 32.0 32.0 32.0 32.0 4 30.55425 32.0 32.0 32.0 32.0 32.0 5 30.558 32.0 32.0 32.0 32.0 32.0 6 33.76925 36.0 36.0 36.0 32.0 36.0 7 34.13525 36.0 36.0 36.0 32.0 36.0 8 33.96425 36.0 36.0 36.0 32.0 36.0 9 33.91725 36.0 36.0 36.0 32.0 36.0 10-11 33.90775 36.0 36.0 36.0 32.0 36.0 12-13 33.89725 36.0 36.0 36.0 32.0 36.0 14-15 33.7505 36.0 36.0 36.0 32.0 36.0 16-17 33.77675 36.0 36.0 36.0 32.0 36.0 18-19 33.62225 36.0 36.0 36.0 27.0 36.0 20-21 33.668125 36.0 36.0 36.0 29.5 36.0 22-23 33.546 36.0 36.0 36.0 27.0 36.0 24-25 33.504875 36.0 36.0 36.0 24.0 36.0 26-27 33.669 36.0 36.0 36.0 29.5 36.0 28-29 33.544 36.0 36.0 36.0 24.0 36.0 30-31 33.5015 36.0 36.0 36.0 24.0 36.0 32-33 33.498374999999996 36.0 36.0 36.0 24.0 36.0 34-35 33.44125 36.0 36.0 36.0 21.0 36.0 36-37 33.47109609609609 36.0 36.0 36.0 24.0 36.0 38-39 33.437312312312315 36.0 36.0 36.0 21.0 36.0 40-41 33.39001501501501 36.0 36.0 36.0 21.0 36.0 42-43 33.347472472472475 36.0 36.0 36.0 17.5 36.0 44-45 33.39852352352352 36.0 36.0 36.0 17.5 36.0 46-47 33.2320031545939 36.0 36.0 36.0 21.0 36.0 48-49 33.14499557375131 36.0 36.0 36.0 17.5 36.0 50-51 33.167417981467565 36.0 36.0 36.0 17.5 36.0 52-53 33.19734535437014 36.0 36.0 36.0 21.0 36.0 54-55 32.98459804658152 36.0 36.0 36.0 14.0 36.0 56-57 32.89787985517515 36.0 34.0 36.0 17.5 36.0 58-59 33.01379269387108 36.0 36.0 36.0 17.5 36.0 60-61 32.82576517812343 36.0 32.0 36.0 14.0 36.0 62-63 32.643502257902654 36.0 32.0 36.0 14.0 36.0 64-65 32.66829983990391 36.0 32.0 36.0 14.0 36.0 66-67 32.60606010299104 36.0 32.0 36.0 14.0 36.0 68-69 32.45603516679094 36.0 32.0 36.0 14.0 36.0 70-71 32.56102964493532 36.0 32.0 36.0 14.0 36.0 72-73 32.56876084737953 36.0 32.0 36.0 14.0 36.0 74-75 32.6093133974249 36.0 32.0 36.0 14.0 36.0 76 31.364854802680565 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 2.0 18 3.0 19 4.0 20 7.0 21 8.0 22 15.0 23 22.0 24 36.0 25 51.0 26 54.0 27 94.0 28 125.0 29 153.0 30 224.0 31 212.0 32 337.0 33 477.0 34 843.0 35 1328.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.086357947434294 26.107634543178975 10.888610763454318 33.917396745932415 2 30.180180180180184 23.14814814814815 29.654654654654657 17.017017017017018 3 21.42142142142142 28.603603603603606 23.3983983983984 26.576576576576578 4 25.825825825825827 31.38138138138138 18.21821821821822 24.574574574574577 5 27.952952952952952 31.98198198198198 20.17017017017017 19.894894894894897 6 21.77177177177177 35.53553553553554 21.12112112112112 21.57157157157157 7 20.82082082082082 17.81781781781782 37.487487487487485 23.873873873873876 8 22.32232232232232 22.047047047047048 26.55155155155155 29.07907907907908 9 24.074074074074073 21.97197197197197 27.952952952952952 26.001001001001 10-11 27.275003129302792 27.562898986105893 20.778570534484917 24.383527350106394 12-13 26.67167543200601 22.33909341347358 24.805910343100425 26.183320811419986 14-15 24.61808164287503 24.380165289256198 26.08314550463311 24.91860756323566 16-17 27.36038066616579 23.97946406210869 23.929376408715253 24.73077886301027 18-19 25.6824442774856 23.99198597545705 25.79514149762084 24.530428249436515 20-21 26.4021031547321 24.661992989484226 23.71056584877316 25.225338007010517 22-23 26.180633846924717 25.316297131404237 23.512463985970186 24.990605035700863 24-25 24.46475522724427 26.50557155377488 23.96394140478277 25.065731814198074 26-27 24.98121712997746 25.845229151014276 24.04207362885049 25.131480090157776 28-29 26.408715251690456 24.75582268970699 22.877535687453044 25.957926371149508 30-31 24.871698585555137 26.03579922393291 24.02052822631118 25.07197396420078 32-33 26.211040180247842 25.84804105645262 24.533733884090626 23.407184879208913 34-35 25.988488488488485 25.225225225225223 23.373373373373376 25.412912912912912 36-37 25.444305381727162 24.680851063829788 24.242803504380475 25.632040050062578 38-39 26.826826826826828 25.11261261261261 24.31181181181181 23.74874874874875 40-41 26.351351351351347 24.96246246246246 23.435935935935937 25.25025025025025 42-43 25.826239359038556 25.0250375563345 24.661992989484226 24.486730095142715 44-45 25.222180498185004 25.234697709350357 25.322318187507825 24.220803604956814 46-47 25.920360631104433 25.45704983721513 24.00450788880541 24.61808164287503 48-49 25.870709095464793 25.181658732147334 24.818341267852666 24.129290904535207 50-51 26.033575544976195 25.394637935354545 24.53019293410173 24.04159358556753 52-53 25.501002004008015 25.288076152304612 24.899799599198396 24.311122244488978 54-55 25.65740045078888 26.30853994490358 23.40345604808415 24.63060355622339 56-57 25.441563322059373 24.276587748966556 25.86746837028686 24.41438055868721 58-59 25.04387064427175 25.169215342191027 25.169215342191027 24.617698671346204 60-61 25.639739086803814 25.878073256397393 24.197190165579528 24.28499749121927 62-63 26.05368790767687 25.765178123432015 23.79578524836929 24.385348720521826 64-65 25.81859239744072 25.116045665537573 24.162589386526157 24.90277255049555 66-67 24.84939759036145 25.602409638554217 24.824297188755022 24.723895582329316 68-69 24.579039959788894 26.036692636340792 24.252324704699674 25.131942699170644 70-71 25.604229607250755 25.56646525679758 24.496475327291037 24.332829808660623 72-73 25.90483421918502 23.66489496330043 25.537838521893192 24.89243229562136 74-75 25.586382522450073 22.463476745744536 25.358531028012333 26.591609703793058 76 27.14072970960536 0.0 35.81533879374534 37.04393149664929 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 1.0 17 2.0 18 2.0 19 1.5 20 2.0 21 3.0 22 5.0 23 7.0 24 9.5 25 10.0 26 10.0 27 14.0 28 18.0 29 21.5 30 29.5 31 40.0 32 45.5 33 45.5 34 53.5 35 75.0 36 98.5 37 114.5 38 131.0 39 156.5 40 177.5 41 183.0 42 181.5 43 201.0 44 227.5 45 224.0 46 210.0 47 190.5 48 165.0 49 163.0 50 162.0 51 148.5 52 132.0 53 114.5 54 107.0 55 100.0 56 94.5 57 94.0 58 93.0 59 115.0 60 128.0 61 108.0 62 92.5 63 92.0 64 93.5 65 89.5 66 85.5 67 83.5 68 80.0 69 72.0 70 60.0 71 52.0 72 52.0 73 45.0 74 36.5 75 31.0 76 28.0 77 22.0 78 13.5 79 9.5 80 6.5 81 6.5 82 4.5 83 2.5 84 2.5 85 3.0 86 3.0 87 2.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.1 3 0.1 4 0.1 5 0.1 6 0.1 7 0.1 8 0.1 9 0.1 10-11 0.13749999999999998 12-13 0.17500000000000002 14-15 0.17500000000000002 16-17 0.17500000000000002 18-19 0.17500000000000002 20-21 0.15 22-23 0.21250000000000002 24-25 0.1625 26-27 0.17500000000000002 28-29 0.17500000000000002 30-31 0.13749999999999998 32-33 0.13749999999999998 34-35 0.1 36-37 0.025025025025025023 38-39 0.0 40-41 0.0 42-43 0.050050050050050046 44-45 0.03753753753753754 46-47 0.06257039169065198 48-49 0.06260172780768748 50-51 0.050087653393438514 52-53 0.025043826696719257 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.02512562814070352 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 4.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 1.0 47 1.0 48 1.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 1.0 57 1.0 58 2.0 59 2.0 60 0.0 61 0.0 62 0.0 63 0.0 64 1.0 65 0.0 66 2.0 67 2.0 68 2.0 69 2.0 70 10.0 71 8.0 72 16.0 73 80.0 74 265.0 75 912.0 76 2686.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.225 #Duplication Level Percentage of deduplicated Percentage of total 1 97.7372075083569 95.025 2 1.8770892260221137 3.65 3 0.282849061455387 0.8250000000000001 4 0.05142710208279763 0.2 5 0.025713551041398816 0.125 6 0.0 0.0 7 0.025713551041398816 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGATTCACCGCAAATACTACTTTGGCTCATTATTGCCGCGACAATGGCTTACTTCTTCACATTCACCGTGCA 7 0.17500000000000002 No Hit GTGAAATCAAGGGGCATTACTTGAATGCAACTGCGGGTACATGTGAAGAAATGATGAAGAGAGCTGTTTTTGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 735993 spots for SRR11389764.sra Written 735993 spots for SRR11389764.sra Read 735993 spots for SRR11389764.sra Written 735993 spots for SRR11389764.sra Read 735993 spots for SRR11389764.sra Written 735993 spots for SRR11389764.sra Read 735993 spots for SRR11389764.sra Written 735993 spots for SRR11389764.sra Read 735993 spots for SRR11389764.sra Written 735993 spots for SRR11389764.sra Read 735993 spots for SRR11389764.sra Written 735993 spots for SRR11389764.sra Read 735993 spots for SRR11389764.sra Written 735993 spots for SRR11389764.sra Read 735993 spots for SRR11389764.sra Written 735993 spots for SRR11389764.sra Read 735993 spots for SRR11389764.sra Written 735993 spots for SRR11389764.sra Read 735993 spots for SRR11389764.sra Written 735993 spots for SRR11389764.sra Read 735993 spots for SRR11389764.sra Written 735993 spots for SRR11389764.sra Read 735993 spots for SRR11389764.sra Written 735993 spots for SRR11389764.sra Read 735993 spots for SRR11389764.sra Written 735993 spots for SRR11389764.sra Read 735993 spots for SRR11389764.sra Written 735993 spots for SRR11389764.sra Read 735993 spots for SRR11389764.sra Written 735993 spots for SRR11389764.sra Read 735997 spots for SRR11389764.sra Written 735997 spots for SRR11389764.sra Read 735993 spots for SRR11389764.sra Written 735993 spots for SRR11389764.sra Read 735993 spots for SRR11389764.sra Written 735993 spots for SRR11389764.sra Read 735993 spots for SRR11389764.sra Written 735993 spots for SRR11389764.sra Read 735993 spots for SRR11389764.sra Written 735993 spots for SRR11389764.sra SRR ids: ['SRR11389764.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6jyz3u29 SRR11389764.sra spots: 14719864 blocks: [[1, 735993], [735994, 1471986], [1471987, 2207979], [2207980, 2943972], [2943973, 3679965], [3679966, 4415958], [4415959, 5151951], [5151952, 5887944], [5887945, 6623937], [6623938, 7359930], [7359931, 8095923], [8095924, 8831916], [8831917, 9567909], [9567910, 10303902], [10303903, 11039895], [11039896, 11775888], [11775889, 12511881], [12511882, 13247874], [13247875, 13983867], [13983868, 14719864]] SRR11389764 file size 2793282 SRR11389764 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389764 SRR11389764_1.fastq SRR11389764_2.fastq Input file: SRR11389764_1.fastq Paired file: SRR11389764_2.fastq trimmed: SRR11389764-trimmed-pair1.fastq, SRR11389764-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 05:04:58 2024 >> started Sat Dec 7 05:05:10 2024 >> done (11.955s) 14719864 read pairs processed; of these: 66 ( 0.00%) short read pairs filtered out after trimming by size control 38169 ( 0.26%) empty read pairs filtered out after trimming by size control 14681629 (99.74%) read pairs available; of these: 5518 ( 0.04%) trimmed read pairs available after processing 14676111 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 90 0.00% 19 0 0.00% 20 110 0.00% 21 2 0.00% 22 159 0.00% 23 5 0.00% 24 216 0.00% 25 2 0.00% 26 206 0.00% 27 6 0.00% 28 151 0.00% 29 7 0.00% 30 154 0.00% 31 7 0.00% 32 111 0.00% 33 6 0.00% 34 86 0.00% 35 93 0.00% 36 236 0.00% 37 128 0.00% 38 208 0.00% 39 184 0.00% 40 231 0.00% 41 243 0.00% 42 261 0.00% 43 340 0.00% 44 376 0.00% 45 474 0.00% 46 478 0.00% 47 586 0.00% 48 642 0.00% 49 699 0.00% 50 759 0.01% 51 879 0.01% 52 886 0.01% 53 1079 0.01% 54 1191 0.01% 55 1395 0.01% 56 1514 0.01% 57 1677 0.01% 58 1819 0.01% 59 1935 0.01% 60 2179 0.01% 61 2300 0.02% 62 2605 0.02% 63 2756 0.02% 64 3141 0.02% 65 3351 0.02% 66 3689 0.03% 67 4147 0.03% 68 4288 0.03% 69 4762 0.03% 70 5631 0.04% 71 7075 0.05% 72 21476 0.15% 73 138740 0.94% 74 1045538 7.12% 75 6685990 45.54% 76 6724330 45.80% 14681629 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=18 prefix-density=0.59 prefix-fanout=2.0 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=10.32 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=2.2 sequence=AGCATGGCCCACCTGCAGTGGATCACCTCCAGC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=20 prefix-density=0.42 prefix-fanout=2.4 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.13 sequence-density-rank=25 fanout-score=67.27 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=13.3 sequence=GCCGCCGCCGCCTCCACCGTCTCCGGCCTCGCCGGCGCCACCCTGGCCCGCCGGCCAGCCTTCTCTACCAACTTCACGACGGGTGGCCGGGTGTCAGCGAGGAACCCCTTGATGACGAGGAACCTGGAGAGGAACGGCAGGATC SRR11389764 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 05:06:00 Started mapping on | Dec 07 05:06:00 Finished on | Dec 07 05:08:13 Mapping speed, Million of reads per hour | 397.40 Number of input reads | 14681629 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 11047039 Uniquely mapped reads % | 75.24% Average mapped length | 150.40 Number of splices: Total | 4989670 Number of splices: Annotated (sjdb) | 4749995 Number of splices: GT/AG | 4925482 Number of splices: GC/AG | 58247 Number of splices: AT/AC | 1807 Number of splices: Non-canonical | 4134 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.01% Deletion average length | 1.34 Insertion rate per base | 0.00% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1774717 % of reads mapped to multiple loci | 12.09% Number of reads mapped to too many loci | 35270 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.52% % of reads unmapped: other | 0.91% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1859873 1859873 1859873 N_multimapping 1774717 1774717 1774717 N_noFeature 432143 10714125 558964 N_ambiguous 316225 2228 116925 UnstrandedReadsAssigned:10298671 PositiveStrandReadsAssigned:330686 NegativeStrandReadsAssigned:10371150 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389764 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389764-trimmed-pair1.fastq SRR11389764-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,681,629 reads, 12,091,607 reads pseudoaligned [quant] estimated average fragment length: 192.966 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52973 SRR11389764.ke.tsv 35125 SRR11389764.se.tsv 88098 total ==> SRR11389764.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 744.231 9.76276e-05 1.56094e-05 PNS24247 1044 852.034 15.9534 2.22801 PNS24249 1928 1736.03 90.9234 6.23215 PNS24246 1044 852.034 15.9534 2.22801 PNS24248 1044 852.034 15.9534 2.22801 PNS24244 1471 1279.03 24.2163 2.25292 PNS24243 293 117.049 0 0 KQK14069 1603 1411.03 3856.31 325.203 KQK14071 474 284.266 204.6 85.6449 ==> SRR11389764.se.tsv <== BRADI_1g14170v3 4504 BRADI_1g53295v3 30 BRADI_1g59795v3 212 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 65 BRADI_1g74790v3 84 BRADI_1g09890v3 0 BRADI_1g77505v3 141 BRADI_1g48960v3 0 SRR11389764 completed mapping pipeline successfully