Starting /dee2/code/volunteer_pipeline.sh SRR11389765 current disk space = 1545821028352 free memory = 1602987096 SRR11389765 SRAfilesize 7827718444c2855c60b21328f878c1be SRR11389765.sra SRR11389765.sra file validated SRR11389765 is paired end SRR11389765 is conventional basespace SRR11389765 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389765_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.0685 32.0 32.0 32.0 32.0 32.0 2 31.08625 32.0 32.0 32.0 32.0 32.0 3 31.079 32.0 32.0 32.0 32.0 32.0 4 31.208 32.0 32.0 32.0 32.0 32.0 5 31.302 32.0 32.0 32.0 32.0 32.0 6 33.9245 36.0 36.0 36.0 32.0 36.0 7 34.36175 36.0 36.0 36.0 32.0 36.0 8 34.40125 36.0 36.0 36.0 32.0 36.0 9 34.50625 36.0 36.0 36.0 32.0 36.0 10-11 34.34925 36.0 36.0 36.0 32.0 36.0 12-13 34.465375 36.0 36.0 36.0 32.0 36.0 14-15 34.254875 36.0 36.0 36.0 32.0 36.0 16-17 34.244875 36.0 36.0 36.0 32.0 36.0 18-19 34.334 36.0 36.0 36.0 32.0 36.0 20-21 34.307625 36.0 36.0 36.0 32.0 36.0 22-23 34.272375 36.0 36.0 36.0 32.0 36.0 24-25 34.14175 36.0 36.0 36.0 32.0 36.0 26-27 34.113875 36.0 36.0 36.0 32.0 36.0 28-29 33.929125 36.0 36.0 36.0 32.0 36.0 30-31 33.83425 36.0 36.0 36.0 32.0 36.0 32-33 33.909 36.0 36.0 36.0 32.0 36.0 34-35 33.834 36.0 36.0 36.0 32.0 36.0 36-37 33.85437014775858 36.0 36.0 36.0 32.0 36.0 38-39 33.7908840470824 36.0 36.0 36.0 27.0 36.0 40-41 33.88492361632858 36.0 36.0 36.0 32.0 36.0 42-43 33.83045329326321 36.0 36.0 36.0 32.0 36.0 44-45 33.868770348109194 36.0 36.0 36.0 32.0 36.0 46-47 33.812296518908084 36.0 36.0 36.0 27.0 36.0 48-49 33.578406813627254 36.0 36.0 36.0 27.0 36.0 50-51 33.573021042084164 36.0 36.0 36.0 27.0 36.0 52-53 33.66620741482966 36.0 36.0 36.0 27.0 36.0 54-55 33.33387622149837 36.0 36.0 36.0 27.0 36.0 56-57 33.38887496867953 36.0 36.0 36.0 27.0 36.0 58-59 33.24630418441494 36.0 36.0 36.0 24.0 36.0 60-61 33.2455524931095 36.0 36.0 36.0 24.0 36.0 62-63 32.98005518056138 36.0 32.0 36.0 24.0 36.0 64-65 33.0968914514916 36.0 32.0 36.0 24.0 36.0 66-67 33.12188317523426 36.0 34.0 36.0 24.0 36.0 68-69 33.06783071825687 36.0 34.0 36.0 24.0 36.0 70-71 32.86078332914889 36.0 32.0 36.0 17.5 36.0 72-73 32.99587561131679 36.0 34.0 36.0 21.0 36.0 74-75 32.92022782434482 36.0 32.0 36.0 21.0 36.0 76 31.62966993108451 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 3.0 23 8.0 24 12.0 25 21.0 26 58.0 27 61.0 28 80.0 29 139.0 30 205.0 31 244.0 32 301.0 33 509.0 34 858.0 35 1494.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.762584522915105 13.573754069621838 13.298271975957926 37.365389431505136 2 25.99549211119459 15.101427498121714 33.1580265464563 25.7450538442274 3 22.01352366641623 23.140495867768596 23.36589030803907 31.480090157776107 4 27.923866766841975 27.29777109942399 19.709491610318057 25.068870523415974 5 26.82193839218633 29.651890808915603 22.489356373653894 21.036814425244177 6 22.544529262086513 32.137404580152676 24.529262086513995 20.78880407124682 7 18.156774355121463 23.61632857500626 36.764337590783875 21.462559479088405 8 22.21387427998998 22.514400200350615 28.825444527923867 26.446280991735538 9 22.01352366641623 18.482344102178814 32.43175557225144 27.07237665915352 10-11 24.292511895817682 29.41397445529677 21.750563486100678 24.542950162784873 12-13 25.068870523415974 22.35161532682194 25.41948409717005 27.160030052592038 14-15 23.94189832206361 24.793388429752067 25.582268970698724 25.6824442774856 16-17 24.267468069120962 24.179814675682447 25.569747057350362 25.982970197846235 18-19 23.153017781116954 24.64312546957175 25.469571750563485 26.73428499874781 20-21 24.805910343100425 24.267468069120962 24.467818682694716 26.458802905083896 22-23 24.567993989481593 25.331830703731526 25.068870523415974 25.0313047833709 24-25 24.768344603055347 24.154770848985724 24.63060355622339 26.446280991735538 26-27 25.0313047833709 23.754069621838216 24.843476083145504 26.37114951164538 28-29 25.25669922364137 24.74330077635863 24.417731029301276 25.582268970698724 30-31 24.74330077635863 24.530428249436515 24.693213122965187 26.033057851239672 32-33 23.829201101928373 24.229902329075884 25.65740045078888 26.283496118206862 34-35 24.34259954921112 25.106436263461056 25.118958176809414 25.43200601051841 36-37 24.78086651640371 24.104683195592287 24.480340596043078 26.634109691960933 38-39 24.117205108940645 24.593037816178313 25.41948409717005 25.870272977710997 40-41 25.093914350112694 25.018782870022537 24.01702980215377 25.870272977710997 42-43 25.19408965689958 24.442774855997996 24.64312546957175 25.720010017530683 44-45 24.530428249436515 24.830954169797145 23.916854495366895 26.72176308539945 46-47 25.043826696719258 24.092161282243925 24.355121462559477 26.508890558477333 48-49 25.325651302605213 24.43637274549098 24.298597194388776 25.93937875751503 50-51 24.498997995991985 23.55961923847695 25.30060120240481 26.640781563126254 52-53 25.288076152304612 24.173346693386772 24.010521042084168 26.528056112224448 54-55 24.11676271611125 24.392382861438236 23.966424455023805 27.524429967426713 56-57 25.2442996742671 23.79102981708845 25.46980706589827 25.49486344274618 58-59 24.65547481834127 24.893510398396394 23.690804309696816 26.76021047356552 60-61 25.156602355299423 23.82861438236031 23.778501628664493 27.23628163367577 62-63 24.82456140350877 24.085213032581454 24.097744360902258 26.992481203007518 64-65 25.09400852343946 24.066182000501378 25.00626723489596 25.833542241163197 66-67 24.63949843260188 23.435736677115987 25.01567398119122 26.90909090909091 68-69 25.457967377666247 23.387703889585946 23.97741530740276 27.176913425345045 70-71 25.30755711775044 24.50414260607582 24.0145618880241 26.173738388149637 72-73 25.132275132275133 23.733938019652307 23.922902494331066 27.2108843537415 74-75 26.096199840552753 20.661706085570025 25.950039861812385 27.29205421206484 76 26.949582879941964 0.0 34.7841857091041 38.266231410953935 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 7.0 1 3.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 4.5 20 5.5 21 6.5 22 6.0 23 7.5 24 8.0 25 7.0 26 7.5 27 10.5 28 17.0 29 18.0 30 21.5 31 28.0 32 37.5 33 48.0 34 58.0 35 68.5 36 83.5 37 100.0 38 115.5 39 141.0 40 153.0 41 165.5 42 184.5 43 192.0 44 207.0 45 209.0 46 201.0 47 196.0 48 176.5 49 163.5 50 154.5 51 141.5 52 125.0 53 122.0 54 131.0 55 125.5 56 120.0 57 115.5 58 106.0 59 114.0 60 122.0 61 112.5 62 108.5 63 102.0 64 93.5 65 92.0 66 89.0 67 88.5 68 83.5 69 70.5 70 55.5 71 49.0 72 45.5 73 45.0 74 42.5 75 37.0 76 35.5 77 26.0 78 17.0 79 11.0 80 11.0 81 12.0 82 8.0 83 5.0 84 3.5 85 2.0 86 1.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.17500000000000002 3 0.17500000000000002 4 0.17500000000000002 5 0.17500000000000002 6 1.7500000000000002 7 0.17500000000000002 8 0.17500000000000002 9 0.17500000000000002 10-11 0.17500000000000002 12-13 0.17500000000000002 14-15 0.17500000000000002 16-17 0.17500000000000002 18-19 0.17500000000000002 20-21 0.17500000000000002 22-23 0.17500000000000002 24-25 0.17500000000000002 26-27 0.17500000000000002 28-29 0.17500000000000002 30-31 0.17500000000000002 32-33 0.17500000000000002 34-35 0.17500000000000002 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 7.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 1.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 2.0 63 0.0 64 0.0 65 1.0 66 1.0 67 1.0 68 2.0 69 1.0 70 0.0 71 5.0 72 18.0 73 68.0 74 258.0 75 877.0 76 2757.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.975 #Duplication Level Percentage of deduplicated Percentage of total 1 98.34141362592497 96.35000000000001 2 1.4544526664965551 2.85 3 0.10206685378923194 0.3 4 0.05103342689461597 0.2 5 0.025516713447307986 0.125 6 0.0 0.0 7 0.025516713447307986 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 5 0.125 TruSeq Adapter, Index 1 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389765 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389765_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.60275 32.0 32.0 32.0 32.0 32.0 2 30.3205 32.0 32.0 32.0 32.0 32.0 3 30.5075 32.0 32.0 32.0 32.0 32.0 4 30.40225 32.0 32.0 32.0 32.0 32.0 5 30.379 32.0 32.0 32.0 21.0 32.0 6 33.4455 36.0 36.0 36.0 21.0 36.0 7 33.73425 36.0 36.0 36.0 32.0 36.0 8 33.61475 36.0 36.0 36.0 32.0 36.0 9 33.5985 36.0 36.0 36.0 27.0 36.0 10-11 33.649125 36.0 36.0 36.0 32.0 36.0 12-13 33.497875 36.0 36.0 36.0 21.0 36.0 14-15 33.423375 36.0 36.0 36.0 21.0 36.0 16-17 33.30075 36.0 36.0 36.0 21.0 36.0 18-19 33.25075 36.0 36.0 36.0 21.0 36.0 20-21 33.2995 36.0 36.0 36.0 21.0 36.0 22-23 33.085499999999996 36.0 36.0 36.0 17.5 36.0 24-25 33.16175 36.0 36.0 36.0 21.0 36.0 26-27 33.119625 36.0 36.0 36.0 17.5 36.0 28-29 33.1085 36.0 36.0 36.0 17.5 36.0 30-31 33.204750000000004 36.0 36.0 36.0 17.5 36.0 32-33 33.217749999999995 36.0 36.0 36.0 14.0 36.0 34-35 33.117999999999995 36.0 36.0 36.0 17.5 36.0 36-37 33.27779168753129 36.0 36.0 36.0 17.5 36.0 38-39 33.31885327991988 36.0 36.0 36.0 21.0 36.0 40-41 33.17388582874312 36.0 36.0 36.0 14.0 36.0 42-43 33.12694041061592 36.0 36.0 36.0 14.0 36.0 44-45 33.00262894341512 36.0 36.0 36.0 14.0 36.0 46-47 32.92050575863796 36.0 36.0 36.0 14.0 36.0 48-49 32.708489857250186 36.0 36.0 36.0 14.0 36.0 50-51 32.80365639869772 36.0 36.0 36.0 14.0 36.0 52-53 32.76296018031555 36.0 36.0 36.0 14.0 36.0 54-55 32.815631262525045 36.0 36.0 36.0 14.0 36.0 56-57 32.555736472945895 36.0 34.0 36.0 14.0 36.0 58-59 32.751252505010015 36.0 34.0 36.0 14.0 36.0 60-61 32.46981462925852 36.0 32.0 36.0 14.0 36.0 62-63 32.46490826264056 36.0 32.0 36.0 14.0 36.0 64-65 32.497869674185466 36.0 32.0 36.0 14.0 36.0 66-67 32.41100526447731 36.0 32.0 36.0 14.0 36.0 68-69 32.383633434382475 36.0 32.0 36.0 14.0 36.0 70-71 32.31460122983795 36.0 32.0 36.0 14.0 36.0 72-73 32.35018698141872 36.0 32.0 36.0 14.0 36.0 74-75 32.381827994279725 36.0 32.0 36.0 14.0 36.0 76 31.356019026710573 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 4.0 15 9.0 16 11.0 17 13.0 18 10.0 19 9.0 20 5.0 21 14.0 22 14.0 23 21.0 24 40.0 25 58.0 26 74.0 27 96.0 28 141.0 29 152.0 30 179.0 31 245.0 32 339.0 33 449.0 34 809.0 35 1301.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.930844399899776 19.143071911801552 12.47807567025808 32.44800801804059 2 31.74762143214822 22.43365047571357 26.364546820230345 19.45418127190786 3 24.912368552829246 25.43815723585378 22.508763144717076 27.1407110665999 4 30.49574361542313 30.696044066099148 16.675012518778168 22.13319979969955 5 30.220330495743614 31.3970956434652 18.627941912869304 19.754631947921883 6 22.658988482724084 34.75212819228843 19.078617926890335 23.510265398097147 7 23.00951427140711 16.850275413119682 34.026039058587884 26.114171256885328 8 24.086129193790686 20.931397095643465 24.41161742613921 30.57085628442664 9 26.021559288042116 22.56204562547004 24.69290549009777 26.72348959639007 10-11 28.218318695106646 27.766624843161857 19.196988707653702 24.81806775407779 12-13 27.061337355455002 21.958270487682253 23.79336349924585 27.187028657616892 14-15 25.39283469516028 24.349465744814584 24.186046511627907 26.071653048397238 16-17 27.412253113599196 23.625613284689898 22.20405082400302 26.758082777707887 18-19 27.028046786567728 25.191799773613383 22.31165891082883 25.468494528990064 20-21 27.514755745322116 23.872912219012935 23.282682406128345 25.329649629536604 22-23 26.955974842767294 23.89937106918239 23.559748427672954 25.58490566037736 24-25 27.076265862545547 24.714160070360595 22.251539138082673 25.95803492901118 26-27 25.637803192157847 24.84604750534121 23.38821163755184 26.1279376649491 28-29 26.618885954985537 25.42436816295737 22.57009933358481 25.386646548472275 30-31 26.55466399197593 24.849548645937812 22.755767301905717 25.840020060180542 32-33 26.92982456140351 24.69924812030075 23.05764411027569 25.31328320802005 34-35 27.076807417616838 24.43302844255106 22.54103495802531 25.94912918180679 36-37 27.181544633901705 23.35757271815446 23.28234704112337 26.178535606820464 38-39 26.477215823735605 24.32398597896845 22.633950926389584 26.564847270906363 40-41 27.378567851777667 23.69804707060591 23.272408612919378 25.650976464697045 42-43 26.132797790887413 24.312790259821764 23.28354462156395 26.270867327726872 44-45 26.36865896534405 24.39728779507785 23.066298342541437 26.167754897036666 46-47 27.911066448938577 23.489511367918603 22.723275970355484 25.876146212787337 48-49 27.244153884837818 23.52275584611516 23.296454614030676 25.936635655016342 50-51 26.026881045094836 24.88380856676297 22.949378218816733 26.139932169325462 52-53 27.41530740276035 25.1693851944793 21.693851944792975 25.72145545796738 54-55 26.390280561122243 24.68687374749499 22.23196392785571 26.690881763527052 56-57 25.86422845691383 25.137775551102205 23.72244488977956 25.275551102204407 58-59 26.490480961923847 24.511523046092183 23.09619238476954 25.90180360721443 60-61 27.617735470941884 24.9749498997996 22.319639278557112 25.087675350701407 62-63 27.148584314708092 24.906038586820344 22.500626409421198 25.444750689050366 64-65 26.854636591478698 24.12280701754386 22.343358395989977 26.67919799498747 66-67 26.259714214088742 23.65254449736776 24.141388819252946 25.946352469290552 68-69 27.28871028506844 22.830591485620996 23.684541002134875 26.196157227175686 70-71 27.393650395281714 23.440833228761452 23.00163132137031 26.163885054586522 72-73 26.461693548387093 23.550907258064516 23.727318548387096 26.26008064516129 74-75 27.605483828031414 20.963662984160788 23.85198988420072 27.578863303607083 76 29.692082111436953 0.0 33.79765395894428 36.510263929618766 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 6.0 1 3.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 2.5 17 4.5 18 3.0 19 1.5 20 3.0 21 4.5 22 5.0 23 4.5 24 6.0 25 8.0 26 9.5 27 9.0 28 10.5 29 17.0 30 19.5 31 21.0 32 25.5 33 28.5 34 38.5 35 53.0 36 71.0 37 96.5 38 112.0 39 117.0 40 126.0 41 154.0 42 178.5 43 185.5 44 193.5 45 185.5 46 171.0 47 170.0 48 166.5 49 152.0 50 145.0 51 136.0 52 119.5 53 134.0 54 145.0 55 130.5 56 116.0 57 123.0 58 141.0 59 144.0 60 141.5 61 135.0 62 131.0 63 116.0 64 98.0 65 98.5 66 108.0 67 110.0 68 89.0 69 75.0 70 78.0 71 78.0 72 70.5 73 61.0 74 50.0 75 41.0 76 39.0 77 33.0 78 26.5 79 22.5 80 17.0 81 10.0 82 4.5 83 1.5 84 1.0 85 1.5 86 2.5 87 3.0 88 1.5 89 1.0 90 1.5 91 0.5 92 0.0 93 0.5 94 1.5 95 1.0 96 0.0 97 1.0 98 2.0 99 5.0 100 8.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.15 3 0.15 4 0.15 5 0.15 6 0.15 7 0.15 8 0.15 9 0.27499999999999997 10-11 0.375 12-13 0.5499999999999999 14-15 0.5625 16-17 0.6375 18-19 0.6125 20-21 0.46249999999999997 22-23 0.625 24-25 0.5125000000000001 26-27 0.5375 28-29 0.5875 30-31 0.3 32-33 0.25 34-35 0.2375 36-37 0.15022533800701052 38-39 0.0 40-41 0.0 42-43 0.26289434151226837 44-45 0.30045067601402103 46-47 0.33800701051577364 48-49 0.4007012271475081 50-51 0.31304783370899075 52-53 0.20035061357375405 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.1629889669007021 70-71 0.0 72-73 0.0 74-75 0.06650704974727321 76 0.18294914013904134 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 6.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 1.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 2.0 63 0.0 64 0.0 65 1.0 66 0.0 67 0.0 68 2.0 69 1.0 70 3.0 71 3.0 72 24.0 73 73.0 74 248.0 75 902.0 76 2733.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.34056676027572 96.3 2 1.404135818228236 2.75 3 0.17870819504723004 0.525 4 0.025529742149604292 0.1 5 0.0 0.0 6 0.025529742149604292 0.15 7 0.025529742149604292 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCCTAC 15 0.0021179097 69.5625 43 >>END_MODULE Read 2791899 spots for SRR11389765.sra Written 2791899 spots for SRR11389765.sra Read 2791899 spots for SRR11389765.sra Written 2791899 spots for SRR11389765.sra Read 2791899 spots for SRR11389765.sra Written 2791899 spots for SRR11389765.sra Read 2791899 spots for SRR11389765.sra Written 2791899 spots for SRR11389765.sra Read 2791899 spots for SRR11389765.sra Written 2791899 spots for SRR11389765.sra Read 2791899 spots for SRR11389765.sra Written 2791899 spots for SRR11389765.sra Read 2791899 spots for SRR11389765.sra Written 2791899 spots for SRR11389765.sra Read 2791899 spots for SRR11389765.sra Written 2791899 spots for SRR11389765.sra Read 2791899 spots for SRR11389765.sra Written 2791899 spots for SRR11389765.sra Read 2791899 spots for SRR11389765.sra Written 2791899 spots for SRR11389765.sra Read 2791899 spots for SRR11389765.sra Written 2791899 spots for SRR11389765.sra Read 2791899 spots for SRR11389765.sra Written 2791899 spots for SRR11389765.sra Read 2791899 spots for SRR11389765.sra Written 2791899 spots for SRR11389765.sra Read 2791899 spots for SRR11389765.sra Written 2791899 spots for SRR11389765.sra Read 2791899 spots for SRR11389765.sra Written 2791899 spots for SRR11389765.sra Read 2791899 spots for SRR11389765.sra Written 2791899 spots for SRR11389765.sra Read 2791899 spots for SRR11389765.sra Written 2791899 spots for SRR11389765.sra Read 2791899 spots for SRR11389765.sra Written 2791899 spots for SRR11389765.sra Read 2791911 spots for SRR11389765.sra Written 2791911 spots for SRR11389765.sra Read 2791899 spots for SRR11389765.sra Written 2791899 spots for SRR11389765.sra SRR ids: ['SRR11389765.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1zrz2vps SRR11389765.sra spots: 55837992 blocks: [[1, 2791899], [2791900, 5583798], [5583799, 8375697], [8375698, 11167596], [11167597, 13959495], [13959496, 16751394], [16751395, 19543293], [19543294, 22335192], [22335193, 25127091], [25127092, 27918990], [27918991, 30710889], [30710890, 33502788], [33502789, 36294687], [36294688, 39086586], [39086587, 41878485], [41878486, 44670384], [44670385, 47462283], [47462284, 50254182], [50254183, 53046081], [53046082, 55837992]] SRR11389765 file size 10653914 SRR11389765 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389765 SRR11389765_1.fastq SRR11389765_2.fastq Input file: SRR11389765_1.fastq Paired file: SRR11389765_2.fastq trimmed: SRR11389765-trimmed-pair1.fastq, SRR11389765-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 05:33:02 2024 >> started Sat Dec 7 05:33:46 2024 >> done (44.473s) 55837992 read pairs processed; of these: 350 ( 0.00%) short read pairs filtered out after trimming by size control 371991 ( 0.67%) empty read pairs filtered out after trimming by size control 55465651 (99.33%) read pairs available; of these: 20766 ( 0.04%) trimmed read pairs available after processing 55444885 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 446 0.00% 19 7 0.00% 20 650 0.00% 21 19 0.00% 22 784 0.00% 23 16 0.00% 24 867 0.00% 25 27 0.00% 26 805 0.00% 27 34 0.00% 28 708 0.00% 29 26 0.00% 30 554 0.00% 31 37 0.00% 32 411 0.00% 33 33 0.00% 34 313 0.00% 35 578 0.00% 36 1250 0.00% 37 686 0.00% 38 1051 0.00% 39 923 0.00% 40 1166 0.00% 41 1264 0.00% 42 1543 0.00% 43 1725 0.00% 44 1917 0.00% 45 2079 0.00% 46 2272 0.00% 47 2675 0.00% 48 2969 0.01% 49 3166 0.01% 50 3544 0.01% 51 3799 0.01% 52 4374 0.01% 53 4703 0.01% 54 4904 0.01% 55 5988 0.01% 56 6777 0.01% 57 7125 0.01% 58 7368 0.01% 59 8428 0.02% 60 8657 0.02% 61 9429 0.02% 62 10162 0.02% 63 10853 0.02% 64 11713 0.02% 65 13090 0.02% 66 14256 0.03% 67 15469 0.03% 68 16077 0.03% 69 18043 0.03% 70 20293 0.04% 71 25681 0.05% 72 71444 0.13% 73 486864 0.88% 74 3826542 6.90% 75 24462301 44.10% 76 26356766 47.52% 55465651 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=18 prefix-density=0.43 prefix-fanout=2.0 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=90.81 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=5.4 sequence=GTTCTCCTTCTAATGCAAACAGCACGCATTCAAGAGGAGAGAGAAATGAACAAGTGAGCAGAAGAACAAAGATGCCCGGATTCATCTCACAAATAACCGAGGGATATTACACAAACACCATCTTTAGTGTACAACACCAACTCCTCATCTCTGACTTTCACATGCAACATCTATCAGTCCTGACTCCTGACTCAATCTCGACACATGCAGCAGCATCCATCATCAACAATGACGTCGTCGGCCAAGCGCCTCAGCATAGAGCAGGCGCTGGAGCTTGCTAACTAAGCTCACTTGCCGGGG criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=30 prefix-density=0.37 prefix-fanout=2.0 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=13.42 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=2.3 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGCTCCTTTCCA SRR11389765 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 05:34:27 Started mapping on | Dec 07 05:34:27 Finished on | Dec 07 05:39:04 Mapping speed, Million of reads per hour | 720.85 Number of input reads | 55465651 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 46583929 Uniquely mapped reads % | 83.99% Average mapped length | 150.40 Number of splices: Total | 19776324 Number of splices: Annotated (sjdb) | 18922951 Number of splices: GT/AG | 19518041 Number of splices: GC/AG | 233774 Number of splices: AT/AC | 7044 Number of splices: Non-canonical | 17465 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.01% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 4798453 % of reads mapped to multiple loci | 8.65% Number of reads mapped to too many loci | 110100 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.60% % of reads unmapped: other | 0.56% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4083269 4083269 4083269 N_multimapping 4798453 4798453 4798453 N_noFeature 1582288 45300894 2010330 N_ambiguous 1173314 6114 334810 UnstrandedReadsAssigned:43828327 PositiveStrandReadsAssigned:1276921 NegativeStrandReadsAssigned:44238789 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389765 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389765-trimmed-pair1.fastq SRR11389765-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 55,465,651 reads, 48,924,655 reads pseudoaligned [quant] estimated average fragment length: 198.411 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,196 rounds 52973 SRR11389765.ke.tsv 35125 SRR11389765.se.tsv 88098 total ==> SRR11389765.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 738.804 0 0 PNS24247 1044 846.589 48.7138 1.61808 PNS24249 1928 1730.59 409.663 6.65661 PNS24246 1044 846.589 48.7138 1.61808 PNS24248 1044 846.589 48.7138 1.61808 PNS24244 1471 1273.59 93.1955 2.05772 PNS24243 293 112.363 0 0 KQK14069 1603 1405.59 7089.74 141.838 KQK14071 474 278.942 631.859 63.6979 ==> SRR11389765.se.tsv <== BRADI_1g14170v3 8181 BRADI_1g53295v3 101 BRADI_1g59795v3 1174 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 451 BRADI_1g74790v3 559 BRADI_1g09890v3 2 BRADI_1g77505v3 542 BRADI_1g48960v3 0 SRR11389765 completed mapping pipeline successfully