Starting /dee2/code/volunteer_pipeline.sh SRR11389766 current disk space = 1545919008768 free memory = 1603383540 SRR11389766 SRAfilesize 9aa8a2695ef4aceded4e856d148b5e40 SRR11389766.sra SRR11389766.sra file validated SRR11389766 is paired end SRR11389766 is conventional basespace SRR11389766 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389766_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.302 32.0 32.0 32.0 32.0 32.0 2 31.27 32.0 32.0 32.0 32.0 32.0 3 31.17575 32.0 32.0 32.0 32.0 32.0 4 31.3295 32.0 32.0 32.0 32.0 32.0 5 31.367 32.0 32.0 32.0 32.0 32.0 6 34.4625 36.0 36.0 36.0 32.0 36.0 7 34.47075 36.0 36.0 36.0 32.0 36.0 8 34.43 36.0 36.0 36.0 32.0 36.0 9 34.5095 36.0 36.0 36.0 32.0 36.0 10-11 34.489000000000004 36.0 36.0 36.0 32.0 36.0 12-13 34.523125 36.0 36.0 36.0 32.0 36.0 14-15 34.49075 36.0 36.0 36.0 32.0 36.0 16-17 34.321625 36.0 36.0 36.0 32.0 36.0 18-19 34.564625 36.0 36.0 36.0 32.0 36.0 20-21 34.372749999999996 36.0 36.0 36.0 32.0 36.0 22-23 34.430375 36.0 36.0 36.0 32.0 36.0 24-25 34.33225 36.0 36.0 36.0 32.0 36.0 26-27 34.32275 36.0 36.0 36.0 32.0 36.0 28-29 34.217375000000004 36.0 36.0 36.0 32.0 36.0 30-31 34.1165 36.0 36.0 36.0 32.0 36.0 32-33 34.125375000000005 36.0 36.0 36.0 32.0 36.0 34-35 34.09975 36.0 36.0 36.0 32.0 36.0 36-37 34.10075093867334 36.0 36.0 36.0 32.0 36.0 38-39 33.95093867334168 36.0 36.0 36.0 32.0 36.0 40-41 34.173341677096374 36.0 36.0 36.0 32.0 36.0 42-43 34.17797246558197 36.0 36.0 36.0 32.0 36.0 44-45 34.04267834793492 36.0 36.0 36.0 32.0 36.0 46-47 33.92553191489361 36.0 36.0 36.0 29.5 36.0 48-49 33.745403430552585 36.0 36.0 36.0 27.0 36.0 50-51 33.829226246080864 36.0 36.0 36.0 29.5 36.0 52-53 33.91535186576509 36.0 36.0 36.0 29.5 36.0 54-55 33.677229458917836 36.0 36.0 36.0 27.0 36.0 56-57 33.63906289150589 36.0 36.0 36.0 27.0 36.0 58-59 33.55838135805563 36.0 36.0 36.0 27.0 36.0 60-61 33.536777266393244 36.0 36.0 36.0 27.0 36.0 62-63 33.277763850589125 36.0 34.0 36.0 27.0 36.0 64-65 33.359535362165715 36.0 36.0 36.0 27.0 36.0 66-67 33.29141293268367 36.0 36.0 36.0 27.0 36.0 68-69 33.362541099605345 36.0 36.0 36.0 27.0 36.0 70-71 33.21695566503706 36.0 34.0 36.0 24.0 36.0 72-73 33.284090412290375 36.0 36.0 36.0 27.0 36.0 74-75 33.257250745310145 36.0 36.0 36.0 27.0 36.0 76 32.218102508178845 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 0.0 21 0.0 22 2.0 23 8.0 24 13.0 25 20.0 26 39.0 27 63.0 28 88.0 29 124.0 30 159.0 31 191.0 32 301.0 33 428.0 34 822.0 35 1736.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.41927409261577 13.76720901126408 10.963704630788486 39.849812265331664 2 22.35294117647059 15.519399249061328 37.09637046307885 25.03128911138924 3 22.40300375469337 21.451814768460576 23.35419274092616 32.7909887359199 4 27.859824780976222 26.883604505632043 17.872340425531917 27.384230287859822 5 25.056320400500624 31.614518147684606 21.802252816020026 21.526908635794744 6 22.914040836904462 31.66120494076128 24.149231157045627 21.27552306528863 7 19.22403003754693 25.106382978723403 35.469336670838544 20.200250312891114 8 19.44931163954944 22.453066332916144 29.7622027534418 28.335419274092615 9 21.076345431789736 20.851063829787233 30.863579474342927 27.2090112640801 10-11 23.35419274092616 29.198998748435546 22.19023779724656 25.256570713391742 12-13 24.105131414267834 22.102628285356694 25.456821026282856 28.335419274092615 14-15 23.066332916145182 24.69336670838548 26.320400500625784 25.919899874843555 16-17 24.23028785982478 24.881101376720903 24.755944931163956 26.132665832290364 18-19 24.292866082603254 24.743429286608258 24.28035043804756 26.68335419274093 20-21 24.4180225281602 24.30538172715895 25.481852315394242 25.79474342928661 22-23 24.105131414267834 24.993742177722154 24.680851063829788 26.220275344180227 24-25 24.780976220275345 24.55569461827284 24.44305381727159 26.220275344180227 26-27 24.430538172715895 25.556946182728414 24.342928660826033 25.669586983729666 28-29 25.093867334167708 25.056320400500624 24.06758448060075 25.782227784730914 30-31 23.917396745932415 24.53066332916145 25.168961201501876 26.382978723404253 32-33 23.704630788485606 24.69336670838548 25.5819774718398 26.020025031289112 34-35 23.654568210262827 24.60575719649562 25.306633291614517 26.433041301627036 36-37 24.242803504380475 23.804755944931163 24.96871088861076 26.9837296620776 38-39 23.729662077597 25.081351689612013 24.93116395494368 26.25782227784731 40-41 23.90488110137672 24.618272841051315 25.281602002503128 26.195244055068834 42-43 24.705882352941178 24.831038798498124 24.20525657071339 26.25782227784731 44-45 24.267834793491865 25.53191489361702 25.15644555694618 25.043804755944933 46-47 24.292866082603254 24.718397997496872 24.793491864831037 26.195244055068834 48-49 23.895356114657655 24.846664163224432 24.633871573413444 26.62410814870447 50-51 23.863778640290473 24.352072117190435 25.003130086390385 26.78101915612871 52-53 24.60555972952667 23.86676684197345 25.29426496368645 26.233408464813422 54-55 24.423847695390783 24.37374749498998 25.501002004008015 25.701402805611224 56-57 23.878727136056128 24.592833876221498 24.768228514156853 26.76021047356552 58-59 23.101979453770983 25.169130543723377 25.68278626910549 26.04610373340015 60-61 25.23493296579376 23.067284801403332 24.846510462348075 26.851271770454833 62-63 24.63023314113813 25.19428428177488 24.37954374529957 25.795938831787414 64-65 25.260122853202958 24.10680707032719 24.558104550582925 26.074965525886924 66-67 24.535875564475663 23.908680381334673 25.087807325639737 26.467636728549927 68-69 25.141278412658547 23.860354137887732 24.60128092427477 26.397086525178953 70-71 25.021982163044843 23.6904911443286 23.76585856048235 27.5216681321442 72-73 24.981094025712125 24.35089488278296 24.111419208469876 26.55659188303504 74-75 24.639025036428666 21.618757451318054 26.400847794409856 27.34136971784342 76 29.1893856779353 0.0 34.023991275899675 36.786623046165026 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 6.0 1 3.5 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 2.5 19 4.5 20 5.5 21 4.5 22 7.5 23 8.5 24 7.5 25 7.5 26 6.5 27 11.5 28 18.5 29 21.5 30 25.0 31 24.5 32 35.5 33 51.5 34 57.5 35 66.5 36 81.0 37 98.0 38 118.5 39 148.0 40 169.0 41 172.5 42 169.0 43 198.5 44 227.5 45 214.0 46 194.0 47 195.5 48 195.5 49 173.5 50 163.5 51 143.0 52 128.0 53 127.5 54 122.0 55 127.0 56 127.5 57 124.5 58 123.5 59 121.0 60 120.0 61 110.5 62 98.5 63 91.5 64 82.0 65 76.0 66 67.0 67 61.0 68 63.0 69 59.0 70 54.5 71 55.0 72 47.5 73 45.0 74 39.5 75 31.5 76 31.0 77 28.5 78 21.5 79 14.0 80 10.5 81 12.5 82 12.5 83 6.0 84 3.5 85 2.5 86 2.0 87 1.0 88 1.5 89 1.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.125 3 0.125 4 0.125 5 0.125 6 0.8250000000000001 7 0.125 8 0.125 9 0.125 10-11 0.125 12-13 0.125 14-15 0.125 16-17 0.125 18-19 0.125 20-21 0.125 22-23 0.125 24-25 0.125 26-27 0.125 28-29 0.125 30-31 0.125 32-33 0.125 34-35 0.125 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 5.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 1.0 49 0.0 50 1.0 51 0.0 52 0.0 53 1.0 54 0.0 55 1.0 56 0.0 57 0.0 58 0.0 59 0.0 60 1.0 61 1.0 62 0.0 63 0.0 64 1.0 65 1.0 66 2.0 67 3.0 68 1.0 69 0.0 70 1.0 71 8.0 72 10.0 73 67.0 74 241.0 75 903.0 76 2751.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.05 #Duplication Level Percentage of deduplicated Percentage of total 1 98.419173890872 96.5 2 1.3258541560428354 2.6 3 0.17848036715961244 0.525 4 0.025497195308516064 0.1 5 0.025497195308516064 0.125 6 0.025497195308516064 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTAT 6 0.15 TruSeq Adapter, Index 19 (97% over 38bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389766 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389766_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.89475 32.0 32.0 32.0 32.0 32.0 2 30.5635 32.0 32.0 32.0 32.0 32.0 3 30.60375 32.0 32.0 32.0 32.0 32.0 4 30.64425 32.0 32.0 32.0 32.0 32.0 5 30.6405 32.0 32.0 32.0 32.0 32.0 6 33.742 36.0 36.0 36.0 21.0 36.0 7 34.00825 36.0 36.0 36.0 32.0 36.0 8 34.00175 36.0 36.0 36.0 32.0 36.0 9 33.803 36.0 36.0 36.0 32.0 36.0 10-11 33.965625 36.0 36.0 36.0 32.0 36.0 12-13 33.866875 36.0 36.0 36.0 32.0 36.0 14-15 33.84075 36.0 36.0 36.0 32.0 36.0 16-17 33.6115 36.0 36.0 36.0 27.0 36.0 18-19 33.55075 36.0 36.0 36.0 24.0 36.0 20-21 33.710375 36.0 36.0 36.0 32.0 36.0 22-23 33.547250000000005 36.0 36.0 36.0 27.0 36.0 24-25 33.555125000000004 36.0 36.0 36.0 27.0 36.0 26-27 33.522999999999996 36.0 36.0 36.0 24.0 36.0 28-29 33.597875 36.0 36.0 36.0 27.0 36.0 30-31 33.50975 36.0 36.0 36.0 24.0 36.0 32-33 33.511250000000004 36.0 36.0 36.0 27.0 36.0 34-35 33.415375 36.0 36.0 36.0 21.0 36.0 36-37 33.44070552914686 36.0 36.0 36.0 23.0 36.0 38-39 33.52802101576182 36.0 36.0 36.0 24.0 36.0 40-41 33.55241431073305 36.0 36.0 36.0 24.0 36.0 42-43 33.35939454590943 36.0 36.0 36.0 21.0 36.0 44-45 33.382536902677 36.0 36.0 36.0 21.0 36.0 46-47 33.28971728796597 36.0 36.0 36.0 21.0 36.0 48-49 33.20479273368941 36.0 36.0 36.0 17.5 36.0 50-51 33.25192329375683 36.0 36.0 36.0 17.5 36.0 52-53 33.217271589486856 36.0 36.0 36.0 17.5 36.0 54-55 33.19003505257887 36.0 36.0 36.0 17.5 36.0 56-57 32.91697971450037 36.0 34.0 36.0 17.5 36.0 58-59 33.08427247683446 36.0 36.0 36.0 17.5 36.0 60-61 32.796481361169626 36.0 34.0 36.0 14.0 36.0 62-63 32.632798797293916 36.0 32.0 36.0 14.0 36.0 64-65 32.671607388554065 36.0 32.0 36.0 14.0 36.0 66-67 32.719203958076285 36.0 34.0 36.0 14.0 36.0 68-69 32.76495435947051 36.0 32.0 36.0 14.0 36.0 70-71 32.50633887546168 36.0 32.0 36.0 14.0 36.0 72-73 32.57682559044274 36.0 32.0 36.0 14.0 36.0 74-75 32.748480385720384 36.0 36.0 36.0 14.0 36.0 76 31.420664206642066 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 10.0 17 5.0 18 10.0 19 5.0 20 14.0 21 8.0 22 15.0 23 26.0 24 27.0 25 46.0 26 75.0 27 83.0 28 118.0 29 141.0 30 180.0 31 219.0 32 282.0 33 448.0 34 778.0 35 1505.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.56156156156156 20.17017017017017 10.485485485485485 32.78278278278278 2 31.423567675756818 22.041531148361273 28.32124093069802 18.21366024518389 3 24.36827620715537 26.594946209657245 22.54190642982237 26.494871153365025 4 29.697272954716038 31.5986990242682 17.312984738553915 21.391043282461847 5 28.34625969477108 32.47435576682512 18.33875406554916 20.84063047285464 6 22.81711283462597 34.85113835376533 21.165874405804352 21.165874405804352 7 24.043032274205654 17.162872154115586 34.30072554415812 24.49337002752064 8 23.667750813109834 21.491118338754063 25.243932949712285 29.597197898423815 9 24.8998998998999 21.67167167167167 25.0 28.428428428428425 10-11 28.00952023048979 27.470875610672678 19.078040836778154 25.441563322059373 12-13 26.812139453222976 21.570102834211184 24.17858038625533 27.43917732631051 14-15 27.17922990091559 24.40737489025461 24.093816631130064 24.319578577699737 16-17 26.445866265211393 24.06222556768285 23.221678584870155 26.270229582235604 18-19 26.834776063229203 23.221678584870155 23.823861497929997 26.119683853970642 20-21 27.43451560345908 24.163429001127962 23.11066549692944 25.29138989848352 22-23 27.452948557089087 24.40401505646173 22.948557089084066 25.19447929736512 24-25 26.486079759217457 24.655129169801857 22.87434161023326 25.984449460747427 26-27 26.47685940047661 25.3104226765333 22.726702621347048 25.486015301643043 28-29 26.947685359427926 24.187680341236984 22.732404968009032 26.132229331326055 30-31 27.347858752817427 24.893563736538944 22.28900576008014 25.469571750563485 32-33 26.518091899336422 24.715162138475023 23.31288343558282 25.453862526605736 34-35 27.05205205205205 24.524524524524523 23.673673673673672 24.74974974974975 36-37 27.04056084126189 24.236354531797698 23.510265398097147 25.212819228843266 38-39 27.070302727045288 23.642732049036777 23.367525644233176 25.91943957968476 40-41 26.857643232424316 23.30497873405054 23.555166374781088 26.28221165874406 42-43 26.268956009525002 24.376488281739565 23.574382754731168 25.78017295400426 44-45 27.076807417616838 25.3351710311991 22.81668963788999 24.771331913294073 46-47 26.53291536050157 24.351097178683386 23.22257053291536 25.893416927899686 48-49 26.881585549422983 24.322629202207725 23.206221776216758 25.589563472152534 50-51 26.903298632885992 23.98093565784523 23.617208077260756 25.49855763200803 52-53 26.885492357805063 25.093961413179656 22.650964670508642 25.36958155850664 54-55 27.090635953930896 24.887330996494743 22.8843264897346 25.137706559839764 56-57 26.746806912096165 24.167292762334082 24.417731029301276 24.66816929626847 58-59 27.31029301277235 23.779113448534936 23.67893814174806 25.231655396944653 60-61 26.3243581715717 24.896681277395118 23.782091421415153 24.996869129618034 62-63 27.023302430468554 23.778501628664493 23.59057880230519 25.60761713856176 64-65 27.151985966670843 24.220022553564714 23.25523117403834 25.3727603057261 66-67 26.902344239689107 23.79340604237182 23.81847812460825 25.485771593330824 68-69 26.43548184445282 24.374921472546802 23.960296519663274 25.229300163337104 70-71 26.484247521024223 23.810719216769172 23.28354462156395 26.42148864064265 72-73 26.80438342360499 23.567199899231642 24.461519083007936 25.166897594155436 74-75 27.39432851792402 19.743178170144464 25.374531835205993 27.48796147672552 76 28.23920265780731 0.0 33.3702473237357 38.39055001845699 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 2.5 18 2.0 19 2.0 20 2.0 21 1.5 22 3.5 23 4.0 24 4.5 25 7.0 26 5.0 27 8.5 28 11.5 29 11.0 30 15.5 31 24.0 32 31.5 33 35.5 34 47.5 35 63.0 36 78.5 37 88.5 38 96.5 39 119.5 40 133.0 41 151.5 42 177.5 43 189.0 44 212.5 45 204.5 46 178.0 47 173.5 48 172.0 49 149.5 50 129.0 51 139.0 52 141.0 53 126.0 54 108.0 55 98.0 56 111.0 57 120.5 58 116.0 59 128.0 60 145.0 61 152.0 62 151.5 63 128.5 64 101.0 65 88.0 66 88.5 67 101.0 68 90.0 69 75.0 70 71.5 71 64.5 72 60.5 73 56.5 74 45.0 75 33.0 76 30.0 77 29.0 78 22.5 79 15.0 80 11.0 81 9.0 82 8.0 83 6.5 84 5.0 85 2.0 86 3.5 87 6.5 88 3.5 89 1.5 90 1.0 91 0.0 92 0.0 93 0.0 94 0.5 95 1.5 96 2.0 97 1.5 98 0.5 99 3.5 100 7.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.075 3 0.075 4 0.075 5 0.075 6 0.075 7 0.075 8 0.075 9 0.1 10-11 0.21250000000000002 12-13 0.325 14-15 0.3375 16-17 0.36250000000000004 18-19 0.36250000000000004 20-21 0.2625 22-23 0.375 24-25 0.325 26-27 0.3375 28-29 0.36250000000000004 30-31 0.17500000000000002 32-33 0.1625 34-35 0.1 36-37 0.07505629221916438 38-39 0.0 40-41 0.0 42-43 0.18764073054791094 44-45 0.16262196647485613 46-47 0.2376782586940205 48-49 0.262729888652571 50-51 0.22525341008634714 52-53 0.10012515644555695 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.12548625925461163 70-71 0.0 72-73 0.0 74-75 0.02674511901577962 76 0.03690036900369004 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 3.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 1.0 49 0.0 50 1.0 51 0.0 52 0.0 53 1.0 54 0.0 55 1.0 56 0.0 57 0.0 58 0.0 59 0.0 60 1.0 61 1.0 62 0.0 63 0.0 64 1.0 65 1.0 66 1.0 67 3.0 68 1.0 69 0.0 70 1.0 71 3.0 72 21.0 73 78.0 74 284.0 75 887.0 76 2710.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.10693271936557 95.875 2 1.6116653875671527 3.15 3 0.17907393195190585 0.525 4 0.051163980557687394 0.2 5 0.051163980557687394 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATTTTACCAAAGATGATGAAAACGTAAACTCACAACCATTTATGCG 5 0.125 No Hit AGAAGAGCCAAGCAGCAATGGCCGCCCAGCTTTCCTCTGCCGCCGTCACC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 940501 spots for SRR11389766.sra Written 940501 spots for SRR11389766.sra Read 940501 spots for SRR11389766.sra Written 940501 spots for SRR11389766.sra Read 940501 spots for SRR11389766.sra Written 940501 spots for SRR11389766.sra Read 940501 spots for SRR11389766.sra Written 940501 spots for SRR11389766.sra Read 940501 spots for SRR11389766.sra Written 940501 spots for SRR11389766.sra Read 940501 spots for SRR11389766.sra Written 940501 spots for SRR11389766.sra Read 940501 spots for SRR11389766.sra Written 940501 spots for SRR11389766.sra Read 940501 spots for SRR11389766.sra Written 940501 spots for SRR11389766.sra Read 940501 spots for SRR11389766.sra Written 940501 spots for SRR11389766.sra Read 940501 spots for SRR11389766.sra Written 940501 spots for SRR11389766.sra Read 940501 spots for SRR11389766.sra Written 940501 spots for SRR11389766.sra Read 940501 spots for SRR11389766.sra Written 940501 spots for SRR11389766.sra Read 940501 spots for SRR11389766.sra Written 940501 spots for SRR11389766.sra Read 940501 spots for SRR11389766.sra Written 940501 spots for SRR11389766.sra Read 940501 spots for SRR11389766.sra Written 940501 spots for SRR11389766.sra Read 940501 spots for SRR11389766.sra Written 940501 spots for SRR11389766.sra Read 940501 spots for SRR11389766.sra Written 940501 spots for SRR11389766.sra Read 940501 spots for SRR11389766.sra Written 940501 spots for SRR11389766.sra Read 940501 spots for SRR11389766.sra Written 940501 spots for SRR11389766.sra Read 940508 spots for SRR11389766.sra Written 940508 spots for SRR11389766.sra SRR ids: ['SRR11389766.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c9_cpqwu SRR11389766.sra spots: 18810027 blocks: [[1, 940501], [940502, 1881002], [1881003, 2821503], [2821504, 3762004], [3762005, 4702505], [4702506, 5643006], [5643007, 6583507], [6583508, 7524008], [7524009, 8464509], [8464510, 9405010], [9405011, 10345511], [10345512, 11286012], [11286013, 12226513], [12226514, 13167014], [13167015, 14107515], [14107516, 15048016], [15048017, 15988517], [15988518, 16929018], [16929019, 17869519], [17869520, 18810027]] SRR11389766 file size 3577443 SRR11389766 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389766 SRR11389766_1.fastq SRR11389766_2.fastq Input file: SRR11389766_1.fastq Paired file: SRR11389766_2.fastq trimmed: SRR11389766-trimmed-pair1.fastq, SRR11389766-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 05:31:01 2024 >> started Sat Dec 7 05:31:19 2024 >> done (18.375s) 18810027 read pairs processed; of these: 45 ( 0.00%) short read pairs filtered out after trimming by size control 75841 ( 0.40%) empty read pairs filtered out after trimming by size control 18734141 (99.60%) read pairs available; of these: 5619 ( 0.03%) trimmed read pairs available after processing 18728522 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 126 0.00% 19 1 0.00% 20 96 0.00% 21 2 0.00% 22 98 0.00% 23 3 0.00% 24 109 0.00% 25 5 0.00% 26 119 0.00% 27 5 0.00% 28 71 0.00% 29 10 0.00% 30 55 0.00% 31 7 0.00% 32 37 0.00% 33 8 0.00% 34 29 0.00% 35 143 0.00% 36 226 0.00% 37 196 0.00% 38 279 0.00% 39 292 0.00% 40 351 0.00% 41 391 0.00% 42 501 0.00% 43 485 0.00% 44 564 0.00% 45 599 0.00% 46 665 0.00% 47 739 0.00% 48 815 0.00% 49 950 0.01% 50 1048 0.01% 51 1187 0.01% 52 1334 0.01% 53 1372 0.01% 54 1477 0.01% 55 1675 0.01% 56 1878 0.01% 57 2066 0.01% 58 2331 0.01% 59 2535 0.01% 60 2715 0.01% 61 2813 0.02% 62 3001 0.02% 63 3271 0.02% 64 3640 0.02% 65 3997 0.02% 66 4261 0.02% 67 4654 0.02% 68 4914 0.03% 69 5567 0.03% 70 6438 0.03% 71 8231 0.04% 72 25202 0.13% 73 170283 0.91% 74 1295782 6.92% 75 8314863 44.38% 76 8849629 47.24% 18734141 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=13 prefix-density=0.69 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=24.45 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.1 sequence=TCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATATGATCTCCCCCAGAC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=17 prefix-density=0.68 prefix-fanout=2.0 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=34.86 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=1.8 sequence=CATCGAGTAGACCTTGTTATTGTGAGAATTCTTAATTCAAGAGTTGTAAGGAGGGACTTATGTCACCACAAACAGAAACTAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAAGATTATAGATTGACTTACTACACCCCGGAGTATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTATCTCCTCAACCTGGGGTTCCGCCCGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATGGACTTACTAGTCTTGATCGTTACAAAGGACGATGCTATCACATCGAGCCTGTTCCTGGGGAAGACAGTCAATGGATCTGTTATGTAGCTTATCCATTAGATCTATTTGAAGAGGGTTCCGTTACTAACATGTTTACTTCCATTGTAGGTAACGTATTTGGTTTCAAAGCCCTACGTGCTCTACGTCTGGAGGATCTACGAATTCCCCCTACTTATTCAAAAACTTTCCAAGGCCC SRR11389766 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 05:31:57 Started mapping on | Dec 07 05:31:57 Finished on | Dec 07 05:33:09 Mapping speed, Million of reads per hour | 936.71 Number of input reads | 18734141 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 16175570 Uniquely mapped reads % | 86.34% Average mapped length | 150.42 Number of splices: Total | 7295164 Number of splices: Annotated (sjdb) | 6986053 Number of splices: GT/AG | 7198107 Number of splices: GC/AG | 88923 Number of splices: AT/AC | 2578 Number of splices: Non-canonical | 5556 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.01% Deletion average length | 1.34 Insertion rate per base | 0.00% Insertion average length | 1.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1649959 % of reads mapped to multiple loci | 8.81% Number of reads mapped to too many loci | 40745 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.04% % of reads unmapped: other | 0.59% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 908612 908612 908612 N_multimapping 1649959 1649959 1649959 N_noFeature 539492 15722859 690969 N_ambiguous 428070 2586 134531 UnstrandedReadsAssigned:15208008 PositiveStrandReadsAssigned:450125 NegativeStrandReadsAssigned:15350070 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389766 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389766-trimmed-pair1.fastq SRR11389766-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,734,141 reads, 16,964,895 reads pseudoaligned [quant] estimated average fragment length: 198.321 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,209 rounds 52973 SRR11389766.ke.tsv 35125 SRR11389766.se.tsv 88098 total ==> SRR11389766.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 738.859 0 0 PNS24247 1044 846.679 29.3549 2.82855 PNS24249 1928 1730.68 145.113 6.84058 PNS24246 1044 846.679 29.3549 2.82855 PNS24248 1044 846.679 29.3549 2.82855 PNS24244 1471 1273.68 21.8221 1.39778 PNS24243 293 111.309 0 0 KQK14069 1603 1405.68 1451.38 84.2361 KQK14071 474 278.843 87.1423 25.4959 ==> SRR11389766.se.tsv <== BRADI_1g14170v3 1629 BRADI_1g53295v3 15 BRADI_1g59795v3 244 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 161 BRADI_1g74790v3 315 BRADI_1g09890v3 0 BRADI_1g77505v3 215 BRADI_1g48960v3 0 SRR11389766 completed mapping pipeline successfully