Starting /dee2/code/volunteer_pipeline.sh SRR11389767 current disk space = 1545728782336 free memory = 1602301700 SRR11389767 SRAfilesize 917ebf3578d6979efc4fcfab3fafe078 SRR11389767.sra SRR11389767.sra file validated SRR11389767 is paired end SRR11389767 is conventional basespace SRR11389767 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389767_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.15375 32.0 32.0 32.0 32.0 32.0 2 31.0465 32.0 32.0 32.0 32.0 32.0 3 31.17325 32.0 32.0 32.0 32.0 32.0 4 31.1 32.0 32.0 32.0 32.0 32.0 5 31.22125 32.0 32.0 32.0 32.0 32.0 6 33.92125 36.0 36.0 36.0 32.0 36.0 7 34.3315 36.0 36.0 36.0 32.0 36.0 8 34.276 36.0 36.0 36.0 32.0 36.0 9 34.4155 36.0 36.0 36.0 32.0 36.0 10-11 34.305875 36.0 36.0 36.0 32.0 36.0 12-13 34.44725 36.0 36.0 36.0 32.0 36.0 14-15 34.294624999999996 36.0 36.0 36.0 32.0 36.0 16-17 34.227999999999994 36.0 36.0 36.0 32.0 36.0 18-19 34.461 36.0 36.0 36.0 32.0 36.0 20-21 34.178875000000005 36.0 36.0 36.0 32.0 36.0 22-23 34.266125 36.0 36.0 36.0 32.0 36.0 24-25 34.18025 36.0 36.0 36.0 32.0 36.0 26-27 34.107625 36.0 36.0 36.0 32.0 36.0 28-29 33.99025 36.0 36.0 36.0 32.0 36.0 30-31 33.92375 36.0 36.0 36.0 32.0 36.0 32-33 34.041624999999996 36.0 36.0 36.0 32.0 36.0 34-35 33.9585 36.0 36.0 36.0 32.0 36.0 36-37 34.00062546910183 36.0 36.0 36.0 32.0 36.0 38-39 33.82749562171628 36.0 36.0 36.0 27.0 36.0 40-41 33.97247935951964 36.0 36.0 36.0 32.0 36.0 42-43 33.832207207207205 36.0 36.0 36.0 32.0 36.0 44-45 33.87537537537537 36.0 36.0 36.0 32.0 36.0 46-47 33.75337837837837 36.0 36.0 36.0 27.0 36.0 48-49 33.56206206206206 36.0 36.0 36.0 27.0 36.0 50-51 33.54530663329162 36.0 36.0 36.0 27.0 36.0 52-53 33.72415519399249 36.0 36.0 36.0 27.0 36.0 54-55 33.44749013703375 36.0 36.0 36.0 27.0 36.0 56-57 33.49574254946155 36.0 36.0 36.0 27.0 36.0 58-59 33.28850488354621 36.0 36.0 36.0 27.0 36.0 60-61 33.19867817569491 36.0 34.0 36.0 24.0 36.0 62-63 33.008012985357404 36.0 32.0 36.0 24.0 36.0 64-65 33.02746180381204 36.0 32.0 36.0 24.0 36.0 66-67 33.135702537201595 36.0 34.0 36.0 24.0 36.0 68-69 33.217007919149616 36.0 34.0 36.0 24.0 36.0 70-71 32.94341557813256 36.0 32.0 36.0 21.0 36.0 72-73 33.05000689290294 36.0 34.0 36.0 24.0 36.0 74-75 33.089345469152086 36.0 34.0 36.0 24.0 36.0 76 31.934562545191614 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 5.0 23 6.0 24 14.0 25 25.0 26 49.0 27 58.0 28 99.0 29 123.0 30 181.0 31 260.0 32 327.0 33 455.0 34 837.0 35 1556.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.675256442331744 14.010507880910684 11.683762822116588 40.63047285464098 2 21.99149362021516 15.736802601951464 37.65323992994746 24.618463847885916 3 20.715536652489366 22.241681260945708 23.967975981986488 33.074806104578435 4 27.120340255191394 27.845884413309985 19.514635976982735 25.519139354515886 5 26.194645984488368 29.92244183137353 22.71703777833375 21.165874405804352 6 21.79746835443038 32.303797468354425 24.253164556962027 21.645569620253163 7 18.038528896672503 24.943707780835627 36.202151613710285 20.815611708781585 8 19.53965474105579 21.79134350763072 31.123342506880157 27.545659244433324 9 20.340255191393545 20.490367775831874 32.02401801351013 27.145359019264447 10-11 24.1556167125344 30.022516887665752 21.4160620465349 24.405804353264948 12-13 24.931198398799097 22.942206654991242 24.906179634726044 27.220415311483613 14-15 24.1556167125344 24.96872654490868 25.481611208406306 25.39404553415061 16-17 24.130597948461347 24.655991993995496 24.83112334250688 26.38228671503628 18-19 24.06805103827871 24.943707780835627 24.7935951963973 26.194645984488368 20-21 24.73104828621466 24.31823867900926 25.706780085063798 25.243932949712285 22-23 23.455091318488865 24.455841881411057 25.11883912934701 26.970227670753065 24-25 23.01726294721041 24.55591693770328 26.09457092819615 26.332249186890166 26-27 24.305729296972732 25.50662997247936 25.243932949712285 24.943707780835627 28-29 25.331498623967974 25.081310983237426 24.293219914936202 25.293970477858394 30-31 24.96872654490868 24.96872654490868 24.64348261195897 25.41906429822367 32-33 23.567675756817614 25.544158118588946 24.7935951963973 26.09457092819615 34-35 24.49337002752064 25.456592444333246 24.59344508381286 25.456592444333246 36-37 24.230673004753562 25.894420815611706 24.405804353264948 25.469101826369776 38-39 23.992994746059544 24.73104828621466 24.91868901676257 26.35726795096322 40-41 24.518388791593697 24.69352014010508 24.768576432324245 26.019514635976982 42-43 24.336836836836838 24.637137137137138 25.412912912912912 25.613113113113112 44-45 23.94894894894895 24.7997997997998 24.737237237237235 26.514014014014016 46-47 23.473473473473476 24.88738738738739 25.212712712712715 26.426426426426424 48-49 24.336836836836838 24.512012012012015 24.84984984984985 26.3013013013013 50-51 24.58072590738423 24.60575719649562 25.056320400500624 25.75719649561952 52-53 24.04255319148936 24.943679599499376 25.193992490613265 25.819774718397998 54-55 24.17678727932891 24.940528358582696 25.31613872542882 25.566545636659573 56-57 24.392687202604556 24.455296769346358 24.818432256448787 26.3335837716003 58-59 24.142248935637365 24.517906336088156 24.75582268970699 26.584022038567497 60-61 24.36427408242515 24.840285606914694 24.639859701866467 26.155580608793688 62-63 24.282671344443052 24.307730860794386 24.833980704172408 26.575617090590153 64-65 24.858969537420084 24.43274413940078 25.134762442020808 25.573523881158327 66-67 24.68934354211121 24.777205974645412 23.559683695242878 26.973766788000503 68-69 24.444165305866097 25.03454339907047 24.218063057404848 26.303228237658587 70-71 24.254998113919278 24.908839431661008 24.75795297372061 26.078209480699105 72-73 24.51661822317705 24.51661822317705 24.13749526096297 26.82926829268293 74-75 24.34655698553801 22.077749767812126 26.20405997081067 27.37163327583919 76 26.53651482284888 0.0 35.86406362979031 37.59942154736081 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 3.0 19 5.0 20 5.0 21 5.5 22 6.5 23 6.0 24 5.0 25 4.5 26 8.5 27 14.0 28 13.5 29 10.5 30 19.5 31 34.5 32 48.0 33 55.5 34 56.0 35 62.5 36 87.0 37 116.5 38 123.0 39 141.5 40 171.0 41 187.0 42 196.0 43 192.5 44 197.5 45 216.0 46 227.0 47 207.5 48 187.5 49 169.5 50 153.0 51 152.5 52 139.0 53 127.0 54 123.5 55 131.5 56 123.0 57 106.0 58 106.5 59 113.5 60 122.0 61 114.5 62 102.5 63 93.5 64 85.5 65 82.0 66 76.0 67 70.0 68 58.0 69 49.5 70 52.5 71 56.5 72 53.5 73 37.5 74 31.0 75 35.0 76 33.5 77 21.5 78 13.0 79 13.5 80 10.5 81 6.0 82 3.5 83 3.0 84 3.0 85 2.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.075 4 0.075 5 0.075 6 1.25 7 0.075 8 0.075 9 0.075 10-11 0.075 12-13 0.075 14-15 0.075 16-17 0.075 18-19 0.075 20-21 0.075 22-23 0.075 24-25 0.075 26-27 0.075 28-29 0.075 30-31 0.075 32-33 0.075 34-35 0.075 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 3.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 1.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 1.0 50 0.0 51 0.0 52 0.0 53 1.0 54 1.0 55 0.0 56 0.0 57 0.0 58 0.0 59 1.0 60 1.0 61 0.0 62 1.0 63 1.0 64 1.0 65 3.0 66 3.0 67 0.0 68 3.0 69 1.0 70 3.0 71 8.0 72 21.0 73 50.0 74 255.0 75 875.0 76 2766.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.808618504436 97.45 2 0.988593155893536 1.95 3 0.20278833967046894 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389767 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389767_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.89425 32.0 32.0 32.0 32.0 32.0 2 30.59625 32.0 32.0 32.0 32.0 32.0 3 30.56975 32.0 32.0 32.0 32.0 32.0 4 30.67225 32.0 32.0 32.0 32.0 32.0 5 30.6105 32.0 32.0 32.0 32.0 32.0 6 33.7785 36.0 36.0 36.0 32.0 36.0 7 34.027 36.0 36.0 36.0 32.0 36.0 8 33.79125 36.0 36.0 36.0 32.0 36.0 9 33.835 36.0 36.0 36.0 32.0 36.0 10-11 33.839875 36.0 36.0 36.0 32.0 36.0 12-13 33.68725 36.0 36.0 36.0 32.0 36.0 14-15 33.80475 36.0 36.0 36.0 32.0 36.0 16-17 33.672 36.0 36.0 36.0 29.5 36.0 18-19 33.546875 36.0 36.0 36.0 27.0 36.0 20-21 33.629374999999996 36.0 36.0 36.0 29.5 36.0 22-23 33.497625 36.0 36.0 36.0 24.0 36.0 24-25 33.490625 36.0 36.0 36.0 24.0 36.0 26-27 33.446 36.0 36.0 36.0 21.0 36.0 28-29 33.351124999999996 36.0 36.0 36.0 21.0 36.0 30-31 33.410624999999996 36.0 36.0 36.0 21.0 36.0 32-33 33.53975 36.0 36.0 36.0 27.0 36.0 34-35 33.366875 36.0 36.0 36.0 17.5 36.0 36-37 33.49049286965224 36.0 36.0 36.0 24.0 36.0 38-39 33.34588441330998 36.0 36.0 36.0 21.0 36.0 40-41 33.466474856142106 36.0 36.0 36.0 24.0 36.0 42-43 33.32757757757758 36.0 36.0 36.0 21.0 36.0 44-45 33.11786786786787 36.0 36.0 36.0 17.5 36.0 46-47 33.35447947947948 36.0 36.0 36.0 21.0 36.0 48-49 33.071571571571575 36.0 36.0 36.0 14.0 36.0 50-51 33.23767209011264 36.0 36.0 36.0 21.0 36.0 52-53 33.08735919899875 36.0 36.0 36.0 17.5 36.0 54-55 33.092905762350014 36.0 36.0 36.0 14.0 36.0 56-57 32.81367392937641 36.0 34.0 36.0 14.0 36.0 58-59 32.88367352661747 36.0 34.0 36.0 14.0 36.0 60-61 32.74276203538162 36.0 32.0 36.0 14.0 36.0 62-63 32.60948004883103 36.0 32.0 36.0 14.0 36.0 64-65 32.63272111921418 36.0 32.0 36.0 14.0 36.0 66-67 32.666890517420825 36.0 32.0 36.0 14.0 36.0 68-69 32.65310151882288 36.0 32.0 36.0 14.0 36.0 70-71 32.58315099891345 36.0 32.0 36.0 14.0 36.0 72-73 32.392416483268434 36.0 32.0 36.0 14.0 36.0 74-75 32.66984500199224 36.0 32.0 36.0 14.0 36.0 76 31.403676470588234 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 7.0 17 5.0 18 11.0 19 4.0 20 6.0 21 10.0 22 18.0 23 25.0 24 34.0 25 42.0 26 61.0 27 85.0 28 124.0 29 146.0 30 206.0 31 254.0 32 313.0 33 463.0 34 761.0 35 1420.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.786786786786784 19.894894894894897 10.56056056056056 32.75775775775776 2 29.39704778583938 22.641981486114584 29.321991493620214 18.638979234425822 3 23.942957217913435 27.09532149111834 23.892919689767325 25.068801601200903 4 28.121090818113586 31.273455091318485 17.563172379284463 23.042281711283465 5 28.7215411558669 34.05053790342757 18.23867900925694 18.989241931448586 6 22.59194395796848 35.50162621966475 21.215911933950462 20.690517888416313 7 24.193144858643983 16.987740805604204 35.80185138854141 23.01726294721041 8 23.46760070052539 22.59194395796848 24.718538904178132 29.221916437327994 9 26.169627220415308 21.641230923192396 25.619214410808105 26.56992744558419 10-11 26.9437836484287 28.22085889570552 20.395642919744585 24.439714536121198 12-13 26.891282565130258 21.655811623246493 23.672344689378757 27.78056112224449 14-15 26.55975945878226 24.04159358556753 24.680531195189175 24.71811576046104 16-17 27.81540005016303 23.727113117632307 22.92450464008026 25.532982192124404 18-19 26.178535606820464 25.288365095285858 23.45787362086259 25.075225677031092 20-21 26.3961933383421 24.74330077635863 23.065364387678436 25.79514149762084 22-23 25.765178123432015 24.799297541394882 23.532363271450073 25.90316106372303 24-25 26.152304609218437 24.9874749498998 23.822645290581164 25.0375751503006 26-27 26.572287647206217 24.968679528940115 22.826359308444 25.63267351540967 28-29 27.73319959879639 24.648946840521564 22.26680040120361 25.351053159478436 30-31 26.846057571964955 24.6558197747184 23.591989987484354 24.90613266583229 32-33 25.850850850850847 25.462962962962965 23.836336336336338 24.84984984984985 34-35 26.607455591693768 24.706029522141606 23.655241431073303 25.03127345509132 36-37 27.168064072081094 24.114628957577274 22.788136653735453 25.929170316606182 38-39 26.745058794095574 23.980485364023014 23.83037277958469 25.444083062296723 40-41 27.195396547410557 23.817863397548162 23.01726294721041 25.969477107830873 42-43 27.059854745805158 24.505384422739795 22.877535687453044 25.557225144002004 44-45 25.253536997621133 24.652560410667334 23.36296481782897 26.73093777388256 46-47 27.25792308655894 23.625203557559814 23.02392584241513 26.092947513466115 48-49 26.303258145363408 24.67418546365915 23.79699248120301 25.225563909774433 50-51 26.62240040090203 23.82861438236031 24.04159358556753 25.507391631170133 52-53 27.133917396745932 24.030037546933666 22.891113892365457 25.944931163954944 54-55 26.568173281582574 24.66508075622887 23.337924126705897 25.42882183548266 56-57 27.222639619333833 24.492862509391436 22.839969947407965 25.444527923866765 58-59 25.848465873512836 24.88415779586725 23.105823418910457 26.161552911709457 60-61 25.54817692018544 25.122165142212754 24.495677233429394 24.833980704172408 62-63 25.41671888707858 24.539415966913147 24.238626394285 25.805238751723277 64-65 26.269592476489027 24.952978056426332 23.836990595611283 24.940438871473354 66-67 26.48831951770912 24.516453152474252 23.461441848781714 25.533785481034915 68-69 25.223298528116743 25.801987671405207 23.348848911812805 25.62586488866524 70-71 25.831234256926955 24.193954659949622 23.362720403022667 26.61209068010076 72-73 25.892631045834392 25.0822993162826 23.335021524436566 25.69004811344644 74-75 27.010723860589813 21.447721179624665 24.906166219839143 26.635388739946382 76 28.860294117647058 0.0 33.602941176470594 37.536764705882355 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 2.0 20 0.5 21 0.5 22 0.5 23 3.0 24 7.0 25 9.0 26 7.0 27 7.0 28 8.0 29 8.5 30 18.0 31 24.0 32 24.0 33 26.5 34 37.5 35 62.0 36 81.5 37 87.0 38 110.0 39 138.0 40 149.5 41 174.5 42 196.5 43 201.0 44 202.0 45 195.0 46 178.0 47 172.5 48 173.5 49 177.0 50 172.0 51 141.0 52 129.0 53 127.5 54 124.0 55 135.0 56 134.0 57 126.0 58 126.0 59 135.5 60 139.0 61 129.0 62 121.0 63 104.5 64 91.5 65 93.0 66 88.5 67 77.5 68 75.5 69 74.0 70 70.0 71 71.5 72 65.0 73 54.5 74 48.0 75 41.5 76 28.5 77 20.0 78 16.5 79 9.5 80 9.0 81 9.5 82 6.0 83 3.0 84 1.5 85 0.5 86 1.0 87 0.5 88 1.0 89 1.5 90 1.0 91 2.5 92 4.0 93 2.5 94 1.0 95 0.5 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.075 3 0.075 4 0.075 5 0.075 6 0.075 7 0.075 8 0.075 9 0.075 10-11 0.1625 12-13 0.2 14-15 0.22499999999999998 16-17 0.325 18-19 0.3 20-21 0.17500000000000002 22-23 0.35000000000000003 24-25 0.2 26-27 0.22499999999999998 28-29 0.3 30-31 0.125 32-33 0.1 34-35 0.075 36-37 0.03752814610958219 38-39 0.0 40-41 0.0 42-43 0.07507507507507508 44-45 0.06256256256256257 46-47 0.11261261261261261 48-49 0.15015015015015015 50-51 0.10012515644555695 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0628614533568016 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 3.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 1.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 1.0 50 0.0 51 0.0 52 0.0 53 1.0 54 1.0 55 0.0 56 0.0 57 0.0 58 1.0 59 1.0 60 1.0 61 0.0 62 1.0 63 1.0 64 1.0 65 4.0 66 4.0 67 0.0 68 4.0 69 0.0 70 10.0 71 5.0 72 22.0 73 70.0 74 276.0 75 872.0 76 2720.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.23709759836484 96.125 2 1.430761369443025 2.8000000000000003 3 0.22994379151762903 0.675 4 0.1021972406745018 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2249958 spots for SRR11389767.sra Written 2249958 spots for SRR11389767.sra Read 2249958 spots for SRR11389767.sra Written 2249958 spots for SRR11389767.sra Read 2249958 spots for SRR11389767.sra Written 2249958 spots for SRR11389767.sra Read 2249958 spots for SRR11389767.sra Read 2249958 spots for SRR11389767.sra Written 2249958 spots for SRR11389767.sra Written 2249958 spots for SRR11389767.sra Read 2249958 spots for SRR11389767.sra Written 2249958 spots for SRR11389767.sra Read 2249958 spots for SRR11389767.sra Written 2249958 spots for SRR11389767.sra Read 2249958 spots for SRR11389767.sra Written 2249958 spots for SRR11389767.sra Read 2249958 spots for SRR11389767.sra Written 2249958 spots for SRR11389767.sra Read 2249958 spots for SRR11389767.sra Written 2249958 spots for SRR11389767.sra Read 2249958 spots for SRR11389767.sra Written 2249958 spots for SRR11389767.sra Read 2249958 spots for SRR11389767.sra Written 2249958 spots for SRR11389767.sra Read 2249958 spots for SRR11389767.sra Written 2249958 spots for SRR11389767.sra Read 2249976 spots for SRR11389767.sra Written 2249976 spots for SRR11389767.sra Read 2249958 spots for SRR11389767.sra Written 2249958 spots for SRR11389767.sra Read 2249958 spots for SRR11389767.sra Written 2249958 spots for SRR11389767.sra Read 2249958 spots for SRR11389767.sra Written 2249958 spots for SRR11389767.sra Read 2249958 spots for SRR11389767.sra Written 2249958 spots for SRR11389767.sra Read 2249958 spots for SRR11389767.sra Written 2249958 spots for SRR11389767.sra Read 2249958 spots for SRR11389767.sra Written 2249958 spots for SRR11389767.sra SRR ids: ['SRR11389767.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a1cwl04b SRR11389767.sra spots: 44999178 blocks: [[1, 2249958], [2249959, 4499916], [4499917, 6749874], [6749875, 8999832], [8999833, 11249790], [11249791, 13499748], [13499749, 15749706], [15749707, 17999664], [17999665, 20249622], [20249623, 22499580], [22499581, 24749538], [24749539, 26999496], [26999497, 29249454], [29249455, 31499412], [31499413, 33749370], [33749371, 35999328], [35999329, 38249286], [38249287, 40499244], [40499245, 42749202], [42749203, 44999178]] SRR11389767 file size 8583216 SRR11389767 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389767 SRR11389767_1.fastq SRR11389767_2.fastq Input file: SRR11389767_1.fastq Paired file: SRR11389767_2.fastq trimmed: SRR11389767-trimmed-pair1.fastq, SRR11389767-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 05:26:48 2024 >> started Sat Dec 7 05:27:24 2024 >> done (35.596s) 44999178 read pairs processed; of these: 171 ( 0.00%) short read pairs filtered out after trimming by size control 193215 ( 0.43%) empty read pairs filtered out after trimming by size control 44805792 (99.57%) read pairs available; of these: 16242 ( 0.04%) trimmed read pairs available after processing 44789550 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 429 0.00% 19 7 0.00% 20 498 0.00% 21 6 0.00% 22 482 0.00% 23 11 0.00% 24 502 0.00% 25 16 0.00% 26 492 0.00% 27 18 0.00% 28 379 0.00% 29 16 0.00% 30 317 0.00% 31 16 0.00% 32 196 0.00% 33 24 0.00% 34 135 0.00% 35 578 0.00% 36 806 0.00% 37 706 0.00% 38 830 0.00% 39 913 0.00% 40 1044 0.00% 41 1271 0.00% 42 1438 0.00% 43 1651 0.00% 44 1682 0.00% 45 1919 0.00% 46 2205 0.00% 47 2390 0.01% 48 2851 0.01% 49 3004 0.01% 50 3325 0.01% 51 3792 0.01% 52 3996 0.01% 53 4580 0.01% 54 4941 0.01% 55 5491 0.01% 56 6190 0.01% 57 6775 0.02% 58 7389 0.02% 59 8066 0.02% 60 8933 0.02% 61 9369 0.02% 62 10303 0.02% 63 10955 0.02% 64 12066 0.03% 65 13295 0.03% 66 14260 0.03% 67 16015 0.04% 68 16795 0.04% 69 18244 0.04% 70 20488 0.05% 71 25710 0.06% 72 64345 0.14% 73 413281 0.92% 74 3149789 7.03% 75 20021054 44.68% 76 20899513 46.64% 44805792 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=11 prefix-density=0.60 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=16.69 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=2.5 sequence=TCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATATGATCTCCCCCAGAC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=19 prefix-density=0.61 prefix-fanout=2.1 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=8.40 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=1.9 sequence=CAACTGCGGGTCATCCTGCAAGTGCGGCA SRR11389767 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 05:27:57 Started mapping on | Dec 07 05:27:57 Finished on | Dec 07 05:30:43 Mapping speed, Million of reads per hour | 971.69 Number of input reads | 44805792 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 38799577 Uniquely mapped reads % | 86.60% Average mapped length | 150.37 Number of splices: Total | 18305931 Number of splices: Annotated (sjdb) | 17532615 Number of splices: GT/AG | 18056458 Number of splices: GC/AG | 228507 Number of splices: AT/AC | 7605 Number of splices: Non-canonical | 13361 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.01% Deletion average length | 1.35 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3682536 % of reads mapped to multiple loci | 8.22% Number of reads mapped to too many loci | 113855 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.22% % of reads unmapped: other | 0.72% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2323679 2323679 2323679 N_multimapping 3682536 3682536 3682536 N_noFeature 1269612 37746007 1626072 N_ambiguous 996680 5841 317064 UnstrandedReadsAssigned:36533285 PositiveStrandReadsAssigned:1047729 NegativeStrandReadsAssigned:36856441 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389767 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389767-trimmed-pair1.fastq SRR11389767-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 44,805,792 reads, 40,331,858 reads pseudoaligned [quant] estimated average fragment length: 192.041 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,439 rounds 52973 SRR11389767.ke.tsv 35125 SRR11389767.se.tsv 88098 total ==> SRR11389767.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 745.05 0 0 PNS24247 1044 852.959 59.2231 2.42699 PNS24249 1928 1736.96 265.392 5.34076 PNS24246 1044 852.959 59.2231 2.42699 PNS24248 1044 852.959 59.2231 2.42699 PNS24244 1471 1279.96 96.9384 2.6473 PNS24243 293 116.736 1 0.299432 KQK14069 1603 1411.96 1123.99 27.8255 KQK14071 474 284.9 47.089 5.77738 ==> SRR11389767.se.tsv <== BRADI_1g14170v3 1227 BRADI_1g53295v3 83 BRADI_1g59795v3 509 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 430 BRADI_1g74790v3 619 BRADI_1g09890v3 0 BRADI_1g77505v3 536 BRADI_1g48960v3 0 SRR11389767 completed mapping pipeline successfully