Starting /dee2/code/volunteer_pipeline.sh SRR11389768 current disk space = 1546077093888 free memory = 1600448896 SRR11389768 SRAfilesize 0a3f54f71c9386e8e48e87f1e5345db3 SRR11389768.sra SRR11389768.sra file validated SRR11389768 is paired end SRR11389768 is conventional basespace SRR11389768 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389768_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.1875 32.0 32.0 32.0 32.0 32.0 2 31.18525 32.0 32.0 32.0 32.0 32.0 3 31.11375 32.0 32.0 32.0 32.0 32.0 4 31.32475 32.0 32.0 32.0 32.0 32.0 5 31.278 32.0 32.0 32.0 32.0 32.0 6 34.116 36.0 36.0 36.0 32.0 36.0 7 34.419 36.0 36.0 36.0 32.0 36.0 8 34.43475 36.0 36.0 36.0 32.0 36.0 9 34.41225 36.0 36.0 36.0 32.0 36.0 10-11 34.444500000000005 36.0 36.0 36.0 32.0 36.0 12-13 34.485125 36.0 36.0 36.0 32.0 36.0 14-15 34.423625 36.0 36.0 36.0 32.0 36.0 16-17 34.376 36.0 36.0 36.0 32.0 36.0 18-19 34.39925 36.0 36.0 36.0 32.0 36.0 20-21 34.289125 36.0 36.0 36.0 32.0 36.0 22-23 34.3185 36.0 36.0 36.0 32.0 36.0 24-25 34.30025 36.0 36.0 36.0 32.0 36.0 26-27 34.163125 36.0 36.0 36.0 32.0 36.0 28-29 34.088625 36.0 36.0 36.0 32.0 36.0 30-31 34.05925 36.0 36.0 36.0 32.0 36.0 32-33 34.012375 36.0 36.0 36.0 32.0 36.0 34-35 34.02525 36.0 36.0 36.0 32.0 36.0 36-37 34.020045101478324 36.0 36.0 36.0 32.0 36.0 38-39 33.921448258581805 36.0 36.0 36.0 32.0 36.0 40-41 34.023552994237036 36.0 36.0 36.0 32.0 36.0 42-43 34.03595590077675 36.0 36.0 36.0 32.0 36.0 44-45 34.018898034361776 36.0 36.0 36.0 32.0 36.0 46-47 33.89508648784157 36.0 36.0 36.0 29.5 36.0 48-49 33.79756831286036 36.0 36.0 36.0 27.0 36.0 50-51 33.55828528453247 36.0 36.0 36.0 27.0 36.0 52-53 33.85021308598646 36.0 36.0 36.0 29.5 36.0 54-55 33.498061871752135 36.0 36.0 36.0 27.0 36.0 56-57 33.632581340711376 36.0 36.0 36.0 29.5 36.0 58-59 33.36385195563454 36.0 36.0 36.0 27.0 36.0 60-61 33.46412443552434 36.0 36.0 36.0 27.0 36.0 62-63 33.28632371392723 36.0 36.0 36.0 27.0 36.0 64-65 33.32775842193485 36.0 36.0 36.0 27.0 36.0 66-67 33.17407686510927 36.0 32.0 36.0 24.0 36.0 68-69 33.33643216080402 36.0 34.0 36.0 27.0 36.0 70-71 33.20092988187987 36.0 34.0 36.0 27.0 36.0 72-73 33.25344714926089 36.0 36.0 36.0 27.0 36.0 74-75 33.21511904761905 36.0 34.0 36.0 27.0 36.0 76 31.904656319290467 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.0 22 6.0 23 8.0 24 19.0 25 17.0 26 36.0 27 51.0 28 77.0 29 143.0 30 156.0 31 231.0 32 303.0 33 441.0 34 838.0 35 1662.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.22475570032573 14.63292407917815 9.671761463292409 42.470558757203705 2 23.57805061388123 14.65798045602606 37.334001503382616 24.429967426710096 3 20.496116261588572 21.548484089200702 24.32974191931847 33.625657729892254 4 25.432222500626413 26.73515409671762 20.195439739413683 27.637183663242293 5 25.63267351540967 30.69406163868705 22.90152843898772 20.77173640691556 6 21.554770318021202 31.726400807672896 25.164058556284708 21.554770318021202 7 18.26609872212478 25.00626409421198 36.30669005261839 20.42094713104485 8 18.040591330493612 21.69882235028815 31.946880481082434 28.313705838135807 9 20.245552493109496 20.621398145828113 32.623402655975944 26.509646705086443 10-11 23.001753946379353 29.516411926835378 22.826359308444 24.65547481834127 12-13 23.08945126534703 23.552994237033325 25.707842645953395 27.649711851666247 14-15 23.30243046855425 25.206715108995237 26.59734402405412 24.893510398396394 16-17 23.565522425457278 25.331996993234778 24.555249310949637 26.547231270358306 18-19 24.417439238286143 25.206715108995237 25.444750689050366 24.931094963668254 20-21 23.740917063392633 25.407166123778502 24.743172137308946 26.10874467551992 22-23 23.415184164369833 25.26935605111501 25.72037083437735 25.59508895013781 24-25 23.515409671761464 25.344525181658735 25.26935605111501 25.870709095464793 26-27 23.08945126534703 26.384364820846905 24.617890253069405 25.90829366073666 28-29 24.04159358556753 25.59508895013781 25.2442996742671 25.119017790027563 30-31 23.690804309696816 24.805813079428717 25.156602355299423 26.34678025557504 32-33 23.552994237033325 25.582560761713857 25.36958155850664 25.49486344274618 34-35 24.805813079428717 24.267100977198698 25.093961413179656 25.833124530192936 36-37 23.05186670007517 25.131545978451513 24.768228514156853 27.048358807316465 38-39 23.076923076923077 25.36958155850664 24.99373590578802 26.55975945878226 40-41 24.11676271611125 25.294412427962914 25.457278877474316 25.131545978451513 42-43 24.492608368829867 24.71811576046104 25.21924329741919 25.570032573289904 44-45 23.079814559579003 25.823831600050116 24.92168901140208 26.1746648289688 46-47 24.454750564051142 24.46728503384307 24.993732765104035 26.084231637001754 48-49 24.429681624467285 24.95612935572825 23.90323389320632 26.710955126598147 50-51 23.690147906743544 24.58009526197042 25.24442216094259 26.48533467034345 52-53 24.592629731762347 24.918525946352467 24.592629731762347 25.89621459012284 54-55 23.93130249467218 25.335339099912247 24.808825372947226 25.924533032468343 56-57 23.147335423197493 26.959247648902824 24.815047021943574 25.07836990595611 58-59 24.206697604414902 25.084660729963627 24.934152765583846 25.77448890003763 60-61 24.535875564475663 23.494731560461616 25.526843953838434 26.442548921224287 62-63 24.692597239648684 25.094102885821833 24.504391468005018 25.708908406524465 64-65 24.981169972382627 24.46648255084107 25.018830027617373 25.53351744915893 66-67 23.85079125847777 24.152223059532783 25.244913338357193 26.752072343632253 68-69 25.037688442211053 24.082914572864322 25.037688442211053 25.841708542713565 70-71 24.41568233224428 24.591605931138478 25.131942699170644 25.860769037446595 72-73 23.304764305520546 24.678598437106125 25.207965717166626 26.808671540206706 74-75 23.885941644562333 22.59946949602122 26.061007957559685 27.453580901856768 76 27.014042867701406 0.0 34.07243163340724 38.91352549889135 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 10.0 1 5.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 3.0 19 7.0 20 7.5 21 7.0 22 7.5 23 6.0 24 6.0 25 10.0 26 13.0 27 17.0 28 13.5 29 9.0 30 18.0 31 26.5 32 40.5 33 52.5 34 48.5 35 60.0 36 89.5 37 108.5 38 126.5 39 162.5 40 175.0 41 187.5 42 206.5 43 230.5 44 241.5 45 224.5 46 224.0 47 205.0 48 189.0 49 166.0 50 139.0 51 132.5 52 131.0 53 138.0 54 144.5 55 126.0 56 102.0 57 110.0 58 123.5 59 126.0 60 114.5 61 97.0 62 88.5 63 79.0 64 68.5 65 66.0 66 65.0 67 65.5 68 74.5 69 72.0 70 48.5 71 39.0 72 39.5 73 35.0 74 32.5 75 30.0 76 28.5 77 20.5 78 11.5 79 7.5 80 4.5 81 4.0 82 3.5 83 2.5 84 1.0 85 1.5 86 3.0 87 3.0 88 2.5 89 1.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.22499999999999998 3 0.22499999999999998 4 0.22499999999999998 5 0.22499999999999998 6 0.95 7 0.22499999999999998 8 0.22499999999999998 9 0.22499999999999998 10-11 0.22499999999999998 12-13 0.22499999999999998 14-15 0.22499999999999998 16-17 0.22499999999999998 18-19 0.22499999999999998 20-21 0.22499999999999998 22-23 0.22499999999999998 24-25 0.22499999999999998 26-27 0.22499999999999998 28-29 0.22499999999999998 30-31 0.22499999999999998 32-33 0.22499999999999998 34-35 0.22499999999999998 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 9.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 1.0 45 1.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 1.0 55 0.0 56 1.0 57 0.0 58 1.0 59 0.0 60 0.0 61 1.0 62 0.0 63 1.0 64 2.0 65 1.0 66 0.0 67 1.0 68 0.0 69 1.0 70 0.0 71 2.0 72 20.0 73 57.0 74 260.0 75 934.0 76 2706.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.26131424188188 96.075 2 1.431858859626694 2.8000000000000003 3 0.25568908207619534 0.75 4 0.0 0.0 5 0.0 0.0 6 0.025568908207619537 0.15 7 0.0 0.0 8 0.0 0.0 9 0.025568908207619537 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit AAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389768 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389768_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.956 32.0 32.0 32.0 32.0 32.0 2 30.4845 32.0 32.0 32.0 32.0 32.0 3 30.5335 32.0 32.0 32.0 32.0 32.0 4 30.6325 32.0 32.0 32.0 32.0 32.0 5 30.59 32.0 32.0 32.0 32.0 32.0 6 33.89625 36.0 36.0 36.0 32.0 36.0 7 33.999 36.0 36.0 36.0 32.0 36.0 8 33.979 36.0 36.0 36.0 32.0 36.0 9 33.77225 36.0 36.0 36.0 32.0 36.0 10-11 33.879374999999996 36.0 36.0 36.0 32.0 36.0 12-13 33.948750000000004 36.0 36.0 36.0 32.0 36.0 14-15 33.826750000000004 36.0 36.0 36.0 32.0 36.0 16-17 33.711124999999996 36.0 36.0 36.0 29.5 36.0 18-19 33.598 36.0 36.0 36.0 26.5 36.0 20-21 33.67 36.0 36.0 36.0 29.5 36.0 22-23 33.740875 36.0 36.0 36.0 32.0 36.0 24-25 33.630125 36.0 36.0 36.0 27.0 36.0 26-27 33.555 36.0 36.0 36.0 24.0 36.0 28-29 33.545 36.0 36.0 36.0 24.0 36.0 30-31 33.59025 36.0 36.0 36.0 29.5 36.0 32-33 33.461749999999995 36.0 36.0 36.0 24.0 36.0 34-35 33.395375 36.0 36.0 36.0 21.0 36.0 36-37 33.40553745928339 36.0 36.0 36.0 20.5 36.0 38-39 33.48020546229015 36.0 36.0 36.0 24.0 36.0 40-41 33.489225757955396 36.0 36.0 36.0 21.0 36.0 42-43 33.32297669756953 36.0 36.0 36.0 21.0 36.0 44-45 33.35730393385117 36.0 36.0 36.0 21.0 36.0 46-47 33.34511278195488 36.0 36.0 36.0 21.0 36.0 48-49 33.25050125313283 36.0 36.0 36.0 21.0 36.0 50-51 33.29803145994845 36.0 36.0 36.0 21.0 36.0 52-53 33.17999498621208 36.0 36.0 36.0 17.5 36.0 54-55 33.11533865195486 36.0 36.0 36.0 14.0 36.0 56-57 32.80287809754822 36.0 34.0 36.0 14.0 36.0 58-59 33.0255545705475 36.0 34.0 36.0 17.5 36.0 60-61 32.771518193224594 36.0 32.0 36.0 14.0 36.0 62-63 32.6566265060241 36.0 32.0 36.0 14.0 36.0 64-65 32.85399184287555 36.0 32.0 36.0 17.5 36.0 66-67 32.779773869346734 36.0 32.0 36.0 14.0 36.0 68-69 32.55001256597134 36.0 32.0 36.0 14.0 36.0 70-71 32.423843216199415 36.0 32.0 36.0 14.0 36.0 72-73 32.583817327466015 36.0 32.0 36.0 14.0 36.0 74-75 32.55391048788299 36.0 32.0 36.0 14.0 36.0 76 31.54858223062382 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 6.0 17 3.0 18 10.0 19 5.0 20 3.0 21 7.0 22 20.0 23 20.0 24 27.0 25 55.0 26 64.0 27 84.0 28 126.0 29 137.0 30 179.0 31 218.0 32 327.0 33 467.0 34 784.0 35 1447.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.974191931846654 22.37534452518166 9.045352042094713 35.60511150087697 2 30.844399899774494 21.799047857679778 28.990228013029316 18.36632422951641 3 21.949386118767226 27.136056126284142 24.204460035078927 26.710097719869708 4 25.85818090704084 31.094963668253573 19.669255825607618 23.37759959909797 5 28.514156852919072 31.79654221999499 19.368579303432725 20.32072162365322 6 23.57805061388123 34.678025557504384 20.095214232022048 21.648709596592333 7 24.32974191931847 16.311701327987972 35.52994237033325 23.82861438236031 8 22.199949887246305 21.523427712352795 26.55975945878226 29.716862941618643 9 25.231771485843147 21.047356552242547 25.63267351540967 28.088198446504638 10-11 26.28148890838451 28.938463466599824 20.17796716380499 24.60208046121068 12-13 27.294383149448343 21.74022066198596 23.608324974924773 27.35707121364092 14-15 25.47642928786359 24.448345035105316 25.150451354062188 24.924774322968908 16-17 26.545454545454543 24.288401253918497 23.047021943573668 26.11912225705329 18-19 26.420062695924766 24.238244514106583 23.924764890282134 25.41692789968652 20-21 26.69507457074821 24.501817270334627 23.073066800350922 25.730041358566236 22-23 26.940925623980938 24.95923742631381 23.341276809231154 24.7585601404741 24-25 25.55165496489468 24.811935807422266 24.511033099297894 25.125376128385156 26-27 27.0846394984326 24.63949843260188 23.5987460815047 24.677115987460816 28-29 26.257053291536046 24.677115987460816 22.946708463949843 26.11912225705329 30-31 26.688384914171152 24.95927828592908 23.555945370254356 24.79639142964541 32-33 26.575617090590153 24.50820699160506 23.618594161132688 25.297581756672095 34-35 26.409421197694815 24.943623152092208 23.86619894763217 24.780756702580806 36-37 26.534703081934353 25.018792282635932 23.139564019042847 25.306940616386868 38-39 26.73515409671762 24.805813079428717 23.327486845402152 25.131545978451513 40-41 27.073415184164368 24.455023803558003 23.30243046855425 25.169130543723377 42-43 26.895600952500313 25.078330617871913 22.922672014036845 25.10339641559093 44-45 26.77027196390525 25.81777165058278 23.035468103772402 24.376488281739565 46-47 25.893416927899686 24.952978056426332 23.385579937304072 25.768025078369906 48-49 25.81211589113257 24.419917220619592 24.570425184999372 25.197541703248465 50-51 25.896664158515176 24.39177326310509 23.526460998244296 26.185101580135438 52-53 26.184507395337175 25.00626723489596 22.850338430684385 25.958886939082475 54-55 26.902344239689107 24.683464961765075 23.37971668547073 25.03447411307509 56-57 25.905956112852664 25.379310344827587 23.53605015673981 25.178683385579937 58-59 26.9568489713999 25.200702458605118 23.733065730055195 24.109382839939787 60-61 26.787954830614808 24.165621079046424 23.889585947302383 25.156838143036385 62-63 26.054216867469883 25.21335341365462 23.31827309236948 25.414156626506024 64-65 26.406328478151682 24.66097438473129 23.380210949271724 25.552486187845304 66-67 25.113065326633166 24.92462311557789 23.907035175879397 26.055276381909547 68-69 25.857950974230043 25.56882463859208 23.871778755499687 24.70144563167819 70-71 26.697686116700204 24.886820925553323 23.69215291750503 24.72334004024145 72-73 25.63583449323042 23.66190054409718 25.117044160445403 25.585220802227006 74-75 26.049399379133487 21.784316371980026 25.05061411796464 27.115670130921853 76 27.372400756143666 0.0 35.65217391304348 36.975425330812854 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 10.0 1 5.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 1.0 15 1.5 16 1.5 17 1.5 18 2.5 19 2.5 20 2.5 21 4.0 22 4.5 23 5.0 24 5.5 25 8.0 26 14.5 27 16.0 28 15.0 29 16.0 30 19.5 31 29.0 32 39.5 33 38.0 34 39.0 35 69.5 36 95.0 37 104.5 38 117.5 39 120.5 40 127.5 41 162.5 42 190.5 43 182.5 44 190.0 45 206.5 46 197.0 47 176.5 48 169.5 49 162.0 50 150.0 51 144.5 52 136.5 53 125.5 54 119.5 55 121.0 56 122.0 57 123.0 58 125.0 59 115.5 60 106.0 61 112.0 62 111.0 63 99.0 64 83.0 65 79.5 66 91.5 67 98.5 68 90.5 69 77.5 70 64.5 71 63.0 72 68.5 73 56.5 74 43.5 75 41.5 76 35.5 77 29.0 78 19.5 79 11.5 80 11.0 81 8.0 82 4.5 83 4.0 84 5.0 85 6.0 86 4.5 87 3.0 88 2.5 89 1.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.5 96 1.0 97 0.5 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.22499999999999998 3 0.22499999999999998 4 0.22499999999999998 5 0.22499999999999998 6 0.22499999999999998 7 0.22499999999999998 8 0.22499999999999998 9 0.22499999999999998 10-11 0.2625 12-13 0.3 14-15 0.3 16-17 0.3125 18-19 0.3125 20-21 0.2625 22-23 0.3375 24-25 0.3 26-27 0.3125 28-29 0.3125 30-31 0.2375 32-33 0.2375 34-35 0.22499999999999998 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.037584565271861686 44-45 0.037584565271861686 46-47 0.06265664160401002 48-49 0.08771929824561403 50-51 0.06266449429753103 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.03769791404875597 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 9.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 1.0 46 0.0 47 0.0 48 0.0 49 0.0 50 1.0 51 0.0 52 0.0 53 0.0 54 1.0 55 0.0 56 1.0 57 0.0 58 2.0 59 0.0 60 0.0 61 1.0 62 0.0 63 1.0 64 2.0 65 1.0 66 0.0 67 1.0 68 0.0 69 1.0 70 4.0 71 9.0 72 27.0 73 86.0 74 295.0 75 912.0 76 2645.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.55 #Duplication Level Percentage of deduplicated Percentage of total 1 97.92414146591491 95.525 2 1.8195797027165557 3.55 3 0.20502306509482315 0.6 4 0.025627883136852894 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025627883136852894 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1488906 spots for SRR11389768.sra Written 1488906 spots for SRR11389768.sra Read 1488906 spots for SRR11389768.sra Written 1488906 spots for SRR11389768.sra Read 1488906 spots for SRR11389768.sra Written 1488906 spots for SRR11389768.sra Read 1488906 spots for SRR11389768.sra Written 1488906 spots for SRR11389768.sra Read 1488906 spots for SRR11389768.sra Written 1488906 spots for SRR11389768.sra Read 1488911 spots for SRR11389768.sra Written 1488911 spots for SRR11389768.sra Read 1488906 spots for SRR11389768.sra Written 1488906 spots for SRR11389768.sra Read 1488906 spots for SRR11389768.sra Written 1488906 spots for SRR11389768.sra Read 1488906 spots for SRR11389768.sra Written 1488906 spots for SRR11389768.sra Read 1488906 spots for SRR11389768.sra Written 1488906 spots for SRR11389768.sra Read 1488906 spots for SRR11389768.sra Written 1488906 spots for SRR11389768.sra Read 1488906 spots for SRR11389768.sra Written 1488906 spots for SRR11389768.sra Read 1488906 spots for SRR11389768.sra Written 1488906 spots for SRR11389768.sra Read 1488906 spots for SRR11389768.sra Written 1488906 spots for SRR11389768.sra Read 1488906 spots for SRR11389768.sra Written 1488906 spots for SRR11389768.sra Read 1488906 spots for SRR11389768.sra Written 1488906 spots for SRR11389768.sra Read 1488906 spots for SRR11389768.sra Written 1488906 spots for SRR11389768.sra Read 1488906 spots for SRR11389768.sra Written 1488906 spots for SRR11389768.sra Read 1488906 spots for SRR11389768.sra Written 1488906 spots for SRR11389768.sra Read 1488906 spots for SRR11389768.sra Written 1488906 spots for SRR11389768.sra SRR ids: ['SRR11389768.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ily695qe SRR11389768.sra spots: 29778125 blocks: [[1, 1488906], [1488907, 2977812], [2977813, 4466718], [4466719, 5955624], [5955625, 7444530], [7444531, 8933436], [8933437, 10422342], [10422343, 11911248], [11911249, 13400154], [13400155, 14889060], [14889061, 16377966], [16377967, 17866872], [17866873, 19355778], [19355779, 20844684], [20844685, 22333590], [22333591, 23822496], [23822497, 25311402], [25311403, 26800308], [26800309, 28289214], [28289215, 29778125]] SRR11389768 file size 5668409 SRR11389768 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389768 SRR11389768_1.fastq SRR11389768_2.fastq Input file: SRR11389768_1.fastq Paired file: SRR11389768_2.fastq trimmed: SRR11389768-trimmed-pair1.fastq, SRR11389768-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 05:34:21 2024 >> started Sat Dec 7 05:34:48 2024 >> done (27.152s) 29778125 read pairs processed; of these: 233 ( 0.00%) short read pairs filtered out after trimming by size control 170273 ( 0.57%) empty read pairs filtered out after trimming by size control 29607619 (99.43%) read pairs available; of these: 13903 ( 0.05%) trimmed read pairs available after processing 29593716 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 584 0.00% 19 5 0.00% 20 670 0.00% 21 2 0.00% 22 680 0.00% 23 9 0.00% 24 736 0.00% 25 7 0.00% 26 637 0.00% 27 11 0.00% 28 550 0.00% 29 10 0.00% 30 435 0.00% 31 12 0.00% 32 280 0.00% 33 16 0.00% 34 216 0.00% 35 348 0.00% 36 766 0.00% 37 447 0.00% 38 615 0.00% 39 518 0.00% 40 724 0.00% 41 706 0.00% 42 859 0.00% 43 957 0.00% 44 1015 0.00% 45 1160 0.00% 46 1304 0.00% 47 1506 0.01% 48 1634 0.01% 49 1787 0.01% 50 2097 0.01% 51 2173 0.01% 52 2357 0.01% 53 2595 0.01% 54 2768 0.01% 55 3100 0.01% 56 3673 0.01% 57 3806 0.01% 58 4192 0.01% 59 4607 0.02% 60 4871 0.02% 61 5247 0.02% 62 5534 0.02% 63 6125 0.02% 64 6668 0.02% 65 7113 0.02% 66 7720 0.03% 67 8432 0.03% 68 8803 0.03% 69 9529 0.03% 70 10969 0.04% 71 13865 0.05% 72 41591 0.14% 73 275254 0.93% 74 2082793 7.03% 75 13287238 44.88% 76 13775293 46.53% 29607619 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=26 prefix-density=0.53 prefix-fanout=2.0 sequence=TTAGGCCTTGCCGGACTCCTCGCAGCCTGGAGGCTTGAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=49.91 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.4 sequence=ATATATTACTGTTCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=18 prefix-density=0.51 prefix-fanout=2.2 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=5.75 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.3 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC SRR11389768 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 05:35:13 Started mapping on | Dec 07 05:35:13 Finished on | Dec 07 05:37:28 Mapping speed, Million of reads per hour | 789.54 Number of input reads | 29607619 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 25184329 Uniquely mapped reads % | 85.06% Average mapped length | 150.39 Number of splices: Total | 12161540 Number of splices: Annotated (sjdb) | 11630042 Number of splices: GT/AG | 11995847 Number of splices: GC/AG | 151766 Number of splices: AT/AC | 4595 Number of splices: Non-canonical | 9332 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.01% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2812219 % of reads mapped to multiple loci | 9.50% Number of reads mapped to too many loci | 57968 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.66% % of reads unmapped: other | 0.59% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1611071 1611071 1611071 N_multimapping 2812219 2812219 2812219 N_noFeature 853839 24446470 1124519 N_ambiguous 695427 4324 242096 UnstrandedReadsAssigned:23635063 PositiveStrandReadsAssigned:733535 NegativeStrandReadsAssigned:23817714 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389768 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389768-trimmed-pair1.fastq SRR11389768-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,607,619 reads, 26,571,953 reads pseudoaligned [quant] estimated average fragment length: 196.142 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,259 rounds 52973 SRR11389768.ke.tsv 35125 SRR11389768.se.tsv 88098 total ==> SRR11389768.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 741.052 0 0 PNS24247 1044 848.858 35.4347 2.22824 PNS24249 1928 1732.86 150.984 4.65089 PNS24246 1044 848.858 35.4347 2.22824 PNS24248 1044 848.858 35.4347 2.22824 PNS24244 1471 1275.86 91.7123 3.83703 PNS24243 293 113.14 0 0 KQK14069 1603 1407.86 7472.41 283.316 KQK14071 474 280.886 424.048 80.5851 ==> SRR11389768.se.tsv <== BRADI_1g14170v3 8455 BRADI_1g53295v3 68 BRADI_1g59795v3 365 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 312 BRADI_1g74790v3 300 BRADI_1g09890v3 0 BRADI_1g77505v3 285 BRADI_1g48960v3 1 SRR11389768 completed mapping pipeline successfully