Starting /dee2/code/volunteer_pipeline.sh SRR11389770 current disk space = 1546109460480 free memory = 1600433480 SRR11389770 SRAfilesize 53eaa4190e870c55d47d5209ad5a1e96 SRR11389770.sra SRR11389770.sra file validated SRR11389770 is paired end SRR11389770 is conventional basespace SRR11389770 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389770_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.067 32.0 32.0 32.0 32.0 32.0 2 31.14725 32.0 32.0 32.0 32.0 32.0 3 31.0785 32.0 32.0 32.0 32.0 32.0 4 31.03625 32.0 32.0 32.0 32.0 32.0 5 31.01925 32.0 32.0 32.0 32.0 32.0 6 34.302 36.0 36.0 36.0 32.0 36.0 7 34.18025 36.0 36.0 36.0 32.0 36.0 8 34.05025 36.0 36.0 36.0 32.0 36.0 9 34.25525 36.0 36.0 36.0 32.0 36.0 10-11 34.1245 36.0 36.0 36.0 32.0 36.0 12-13 34.200125 36.0 36.0 36.0 32.0 36.0 14-15 34.120625000000004 36.0 36.0 36.0 32.0 36.0 16-17 34.1525 36.0 36.0 36.0 32.0 36.0 18-19 34.058625 36.0 36.0 36.0 32.0 36.0 20-21 33.93075 36.0 36.0 36.0 32.0 36.0 22-23 34.133875 36.0 36.0 36.0 32.0 36.0 24-25 33.888 36.0 36.0 36.0 32.0 36.0 26-27 33.739625000000004 36.0 36.0 36.0 32.0 36.0 28-29 33.839124999999996 36.0 36.0 36.0 32.0 36.0 30-31 33.472875 36.0 36.0 36.0 24.0 36.0 32-33 33.451750000000004 36.0 36.0 36.0 24.0 36.0 34-35 33.467625 36.0 36.0 36.0 24.0 36.0 36-37 33.48389820376145 36.0 36.0 36.0 24.0 36.0 38-39 33.3380988211688 36.0 36.0 36.0 21.0 36.0 40-41 33.21682969651367 36.0 36.0 36.0 21.0 36.0 42-43 33.23463757210936 36.0 36.0 36.0 21.0 36.0 44-45 33.11060948081264 36.0 36.0 36.0 14.0 36.0 46-47 33.15788813644345 36.0 36.0 36.0 14.0 36.0 48-49 32.88362177075496 36.0 36.0 36.0 14.0 36.0 50-51 32.8309505894156 36.0 36.0 36.0 14.0 36.0 52-53 32.58592574009032 36.0 36.0 36.0 14.0 36.0 54-55 32.653537380832915 36.0 34.0 36.0 14.0 36.0 56-57 32.27471149021575 36.0 32.0 36.0 14.0 36.0 58-59 32.2134972403412 36.0 32.0 36.0 14.0 36.0 60-61 32.18866031108881 36.0 32.0 36.0 14.0 36.0 62-63 31.90002508780733 36.0 32.0 36.0 14.0 36.0 64-65 31.775464124435523 36.0 32.0 36.0 14.0 36.0 66-67 31.480933266432515 36.0 32.0 36.0 14.0 36.0 68-69 31.325805658575405 36.0 32.0 36.0 14.0 36.0 70-71 31.483688833124216 36.0 32.0 36.0 14.0 36.0 72-73 31.058649989839353 36.0 32.0 36.0 14.0 36.0 74-75 31.1389957206592 36.0 32.0 36.0 14.0 36.0 76 30.514563106796118 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 3.0 22 3.0 23 7.0 24 13.0 25 23.0 26 52.0 27 79.0 28 111.0 29 189.0 30 255.0 31 336.0 32 490.0 33 771.0 34 1028.0 35 629.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.1765295887663 12.337011033099298 12.036108324974924 33.45035105315948 2 26.197041865129105 13.762847831536726 33.61744798195036 26.422662321383804 3 23.915768362998246 21.408874404612686 22.436700927550763 32.2386563048383 4 29.631486588117323 26.046628227625973 18.851842567059414 25.47004261719729 5 26.57307595888694 29.781900225620454 23.113562296314864 20.53146151917774 6 22.612183504637752 31.737277513161192 23.915768362998246 21.73477061920281 7 17.8992228628729 22.63725244422161 37.854098771621956 21.609425921283528 8 21.25846076710955 21.93532213587365 29.00476309852093 27.801453998495862 9 22.41163198796691 19.72925545249436 32.188518425670594 25.670594133868136 10-11 23.50213085986463 29.71922787666082 22.612183504637752 24.166457758836803 12-13 24.880922536976684 22.22361494108799 25.28202557031838 27.613436951616947 14-15 24.85585359739283 24.56756079217849 25.24442216094259 25.33216344948609 16-17 23.865630483830532 24.69290549009777 24.504888443218853 26.936575582852846 18-19 24.05364753070945 24.555026322386563 25.14414640260717 26.247179744296815 20-21 23.915768362998246 25.269491100526448 25.457508147405367 25.357232389069946 22-23 23.777889195287038 24.429681624467285 25.03133617447982 26.761093005765858 24-25 24.75557783905741 23.7152168463274 24.85585359739283 26.67335171722236 26-27 23.37678616194535 25.821007771371267 25.056405114063672 25.745800952619703 28-29 25.156680872399097 24.241664577588367 24.931060416144398 25.670594133868136 30-31 23.978440711957884 24.868388067184757 24.843319127600903 26.309852093256453 32-33 23.95337177237403 24.17899222862873 25.507646026573077 26.359989972424163 34-35 24.768112308849336 24.354474805715718 24.241664577588367 26.63574830784658 36-37 24.921649743011155 24.29484768710041 24.733609126237933 26.049893443650497 38-39 24.448068238835926 24.435524335173106 24.686402408429505 26.430005017561463 40-41 24.67385850476668 23.620170597089814 25.01254390366282 26.693426994480685 42-43 24.39177326310509 23.714572360170553 25.42011537496865 26.473539001755707 44-45 24.78053674441936 24.90594431903687 24.467017807875596 25.84650112866817 46-47 25.275965880582035 24.02157551430005 24.109382839939787 26.593075765178124 48-49 24.934152765583846 24.319578577699737 24.7585601404741 25.987708516242318 50-51 24.658221497554244 23.52941176470588 24.771102470839082 27.04126426690079 52-53 25.17877305231464 23.91167983941789 23.91167983941789 26.99786726884958 54-55 25.01882057716437 23.776662484316187 24.93099121706399 26.27352572145546 56-57 24.538953707188558 23.384769790490527 25.053318278760507 27.022958223560405 58-59 25.02822732404968 24.325680592146533 24.25040772801405 26.39568435578974 60-61 24.981179422835634 23.914680050188206 24.203262233375156 26.900878293601004 62-63 24.855708908406523 23.324968632371395 25.821831869510664 25.99749058971142 64-65 25.153682097603813 23.94931627148413 24.564044661899384 26.33295696901267 66-67 25.1693851944793 23.73902132998745 24.755332496863236 26.336260978670012 68-69 25.031367628607278 23.462986198243414 24.178168130489336 27.327478042659976 70-71 25.357590966122963 23.174404015056464 24.66750313676286 26.800501882057716 72-73 24.741748551272362 23.87251196775006 24.829931972789115 26.55580750818846 74-75 25.221531543446634 21.24057664330115 26.345721465414627 27.192170347837585 76 27.687882056814097 0.0 33.5131247752607 38.798993167925204 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 11.0 1 6.0 2 1.0 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.5 17 1.0 18 5.5 19 7.5 20 10.5 21 17.5 22 18.0 23 14.5 24 10.5 25 9.0 26 11.5 27 22.0 28 30.5 29 30.5 30 30.5 31 31.5 32 34.5 33 42.5 34 53.0 35 71.0 36 87.0 37 103.0 38 116.0 39 133.5 40 139.5 41 139.0 42 144.5 43 146.0 44 154.5 45 166.0 46 182.0 47 192.5 48 197.5 49 186.5 50 179.5 51 156.0 52 126.5 53 124.0 54 125.0 55 131.5 56 131.0 57 125.0 58 118.5 59 117.5 60 128.0 61 132.5 62 131.0 63 118.5 64 95.0 65 94.0 66 90.5 67 77.5 68 76.5 69 72.0 70 66.5 71 61.0 72 53.5 73 47.5 74 44.0 75 40.5 76 32.5 77 25.0 78 19.0 79 13.5 80 10.0 81 5.5 82 6.5 83 7.5 84 5.0 85 4.0 86 3.0 87 2.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.27499999999999997 3 0.27499999999999997 4 0.27499999999999997 5 0.27499999999999997 6 0.27499999999999997 7 0.27499999999999997 8 0.27499999999999997 9 0.27499999999999997 10-11 0.27499999999999997 12-13 0.27499999999999997 14-15 0.27499999999999997 16-17 0.27499999999999997 18-19 0.27499999999999997 20-21 0.27499999999999997 22-23 0.27499999999999997 24-25 0.27499999999999997 26-27 0.27499999999999997 28-29 0.27499999999999997 30-31 0.27499999999999997 32-33 0.27499999999999997 34-35 0.27499999999999997 36-37 0.0 38-39 0.025081514923501375 40-41 0.025081514923501375 42-43 0.0 44-45 0.0 46-47 0.025081514923501375 48-49 0.012540757461750688 50-51 0.012540757461750688 52-53 0.012543903662819869 54-55 0.025087807325639738 56-57 0.012543903662819869 58-59 0.012543903662819869 60-61 0.025087807325639738 62-63 0.025087807325639738 64-65 0.012543903662819869 66-67 0.025087807325639738 68-69 0.012545477355413375 70-71 0.0 72-73 0.012596044841919639 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 11.0 36 1.0 37 1.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 1.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 0.0 70 0.0 71 8.0 72 15.0 73 62.0 74 239.0 75 880.0 76 2781.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 97.83169850283943 94.75 2 1.8069179143004648 3.5000000000000004 3 0.20650490449148168 0.6 4 0.05162622612287042 0.2 5 0.0 0.0 6 0.0 0.0 7 0.02581311306143521 0.17500000000000002 8 0.02581311306143521 0.2 9 0.0 0.0 >10 0.05162622612287042 0.575 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 12 0.3 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 11 0.27499999999999997 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 8 0.2 No Hit CTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389770 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389770_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.48875 32.0 32.0 32.0 32.0 32.0 2 30.094 32.0 32.0 32.0 21.0 32.0 3 30.11 32.0 32.0 32.0 21.0 32.0 4 30.11775 32.0 32.0 32.0 21.0 32.0 5 30.0845 32.0 32.0 32.0 21.0 32.0 6 33.24925 36.0 36.0 36.0 21.0 36.0 7 33.379 36.0 36.0 36.0 21.0 36.0 8 33.21 36.0 36.0 36.0 21.0 36.0 9 33.26525 36.0 36.0 36.0 21.0 36.0 10-11 33.019375 36.0 36.0 36.0 17.5 36.0 12-13 33.154375 36.0 36.0 36.0 21.0 36.0 14-15 32.93575 36.0 36.0 36.0 14.0 36.0 16-17 33.040625000000006 36.0 36.0 36.0 17.5 36.0 18-19 33.09125 36.0 36.0 36.0 17.5 36.0 20-21 32.908 36.0 36.0 36.0 21.0 36.0 22-23 32.87775 36.0 36.0 36.0 14.0 36.0 24-25 32.881625 36.0 36.0 36.0 14.0 36.0 26-27 32.795 36.0 36.0 36.0 14.0 36.0 28-29 32.820375 36.0 36.0 36.0 14.0 36.0 30-31 32.58725 36.0 36.0 36.0 14.0 36.0 32-33 32.479875 36.0 36.0 36.0 14.0 36.0 34-35 32.3305 36.0 34.0 36.0 14.0 36.0 36-37 32.592098853578236 36.0 36.0 36.0 14.0 36.0 38-39 32.461887208842704 36.0 36.0 36.0 14.0 36.0 40-41 32.36322532027129 36.0 34.0 36.0 14.0 36.0 42-43 32.30419492589802 36.0 34.0 36.0 14.0 36.0 44-45 32.040693293142425 36.0 32.0 36.0 14.0 36.0 46-47 32.01230846520975 36.0 34.0 36.0 14.0 36.0 48-49 31.8186385330319 36.0 32.0 36.0 14.0 36.0 50-51 31.77052715221422 36.0 32.0 36.0 14.0 36.0 52-53 31.652299572756974 36.0 32.0 36.0 14.0 36.0 54-55 31.327971852224177 36.0 32.0 36.0 14.0 36.0 56-57 31.238376476501635 36.0 32.0 36.0 14.0 36.0 58-59 30.959034933400353 36.0 32.0 36.0 14.0 36.0 60-61 30.938929379241017 36.0 32.0 36.0 14.0 36.0 62-63 30.893566222669012 36.0 32.0 36.0 14.0 36.0 64-65 30.678311133450613 36.0 27.0 36.0 14.0 36.0 66-67 30.627293289771302 36.0 27.0 36.0 14.0 36.0 68-69 30.404670997093717 36.0 27.0 36.0 14.0 36.0 70-71 30.09625344472539 36.0 27.0 36.0 14.0 36.0 72-73 30.24973777615807 36.0 27.0 36.0 14.0 36.0 74-75 30.09684027794114 36.0 27.0 36.0 14.0 36.0 76 28.685932388222465 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 0.0 4 1.0 5 3.0 6 0.0 7 0.0 8 0.0 9 0.0 10 3.0 11 0.0 12 0.0 13 0.0 14 1.0 15 6.0 16 5.0 17 7.0 18 7.0 19 9.0 20 10.0 21 19.0 22 24.0 23 33.0 24 57.0 25 75.0 26 90.0 27 140.0 28 176.0 29 206.0 30 273.0 31 346.0 32 521.0 33 671.0 34 881.0 35 419.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.87945755901557 20.09040683073832 9.442491210447011 30.587644399799096 2 30.135610246107486 21.97388247112004 27.95077850326469 19.939728779507785 3 25.960331408486066 25.759477780567412 21.340697966357016 26.93949284458951 4 30.203364298267637 31.333165955310065 16.87170474516696 21.591765001255336 5 27.44162691438614 32.78935475772031 19.28194828019081 20.487070047702737 6 24.654782827014813 32.387647501883 20.66281697213156 22.294752698970623 7 23.324127542053727 16.670851117248304 33.79362289731358 26.211398443384383 8 24.579462716545315 22.093899071051972 23.675621390911374 29.65101682149134 9 26.482412060301506 21.08040201005025 23.819095477386934 28.618090452261306 10-11 27.34355365669766 27.393817542096006 19.163106308117616 26.099522493088717 12-13 27.536778574122973 21.17439959763611 23.36225323777191 27.926568590469003 14-15 26.480221718316955 23.733938019652307 23.683547493071302 26.102292768959433 16-17 26.58100277147896 24.02368354749307 22.789115646258505 26.606198034769463 18-19 26.98692152917505 24.446680080482896 22.686116700201207 25.880281690140844 20-21 26.34625062908908 23.754403623553095 23.188223452440866 26.71112229491696 22-23 27.551919446192574 24.73253618628068 21.97608558842039 25.739458779106357 24-25 27.57796780684105 25.06287726358149 21.780684104627767 25.5784708249497 26-27 27.375707992448078 24.795468848332284 21.522970421648836 26.305852737570802 28-29 27.762396174175684 24.15051598288447 21.50767681852504 26.5794110244148 30-31 27.30246602918973 24.962254655259184 21.51484650226472 26.220432813286358 32-33 27.109040543943593 23.923444976076556 22.38730798287585 26.580206497104005 34-35 26.80594009564561 24.351875157311856 23.219229801157816 25.622954945884725 36-37 27.07022401208155 23.533853511200604 22.45154794865341 26.944374528064436 38-39 26.3946606220879 24.971666037023045 22.11308399445914 26.52058934642992 40-41 27.51196172248804 24.716696046335933 21.732561067741123 26.038781163434905 42-43 27.455919395465994 24.848866498740556 22.090680100755666 25.60453400503778 44-45 26.695181783872187 24.279783620581206 22.44307460057869 26.581959994967917 46-47 27.63654669015857 24.414799899320414 22.53964258746539 25.409010823055628 48-49 27.50503524672709 24.458710976837867 22.318731117824772 25.71752265861027 50-51 26.925012581781584 23.628585807750376 22.810770005032712 26.63563160543533 52-53 27.069182389937108 24.830188679245282 21.78616352201258 26.31446540880503 54-55 26.280035224556546 24.946534155239654 21.902126053591648 26.871304566612153 56-57 26.59454019373506 24.065920241539818 23.41174990564851 25.927789659076613 58-59 27.80015101938082 24.4022149509187 22.564812484268813 25.232821545431666 60-61 26.75985392267976 24.7072157159048 22.100491122024934 26.432439239390504 62-63 27.730246602918974 24.081529944640163 22.861097131353798 25.327126321087068 64-65 26.698540513336688 24.647710115752393 22.244589833920482 26.40915953699044 66-67 27.93155510820332 23.930548565676897 22.420734776044288 25.71716155007549 68-69 27.793155510820334 24.49672873678913 22.030699547055864 25.679416205334675 70-71 28.62903225806452 23.777721774193548 21.938004032258064 25.65524193548387 72-73 27.525603742571754 23.70716904792009 22.83474522695663 25.932481982551526 74-75 27.058823529411764 21.176470588235293 23.5427807486631 28.22192513368984 76 30.97925009100837 0.0 31.343283582089555 37.67746632690208 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 17.0 1 9.0 2 2.0 3 3.0 4 2.5 5 1.5 6 1.5 7 1.5 8 1.0 9 1.5 10 2.5 11 2.5 12 1.5 13 1.0 14 1.0 15 1.0 16 1.0 17 3.0 18 7.0 19 7.0 20 6.5 21 8.0 22 9.0 23 10.0 24 8.5 25 8.0 26 10.0 27 12.0 28 16.0 29 17.0 30 18.0 31 29.0 32 37.5 33 41.0 34 45.5 35 55.5 36 67.0 37 75.5 38 75.0 39 84.0 40 108.5 41 120.5 42 124.5 43 137.5 44 153.0 45 155.0 46 159.5 47 163.5 48 162.5 49 164.0 50 155.0 51 137.0 52 127.0 53 127.0 54 130.0 55 134.5 56 134.5 57 136.5 58 141.0 59 135.5 60 134.0 61 132.5 62 128.5 63 119.5 64 105.0 65 109.5 66 117.5 67 119.5 68 120.5 69 101.5 70 86.5 71 87.0 72 76.0 73 64.0 74 54.5 75 44.5 76 34.5 77 25.5 78 24.0 79 23.0 80 17.0 81 12.0 82 10.5 83 9.0 84 7.5 85 5.0 86 2.5 87 2.5 88 2.5 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.44999999999999996 3 0.42500000000000004 4 0.42500000000000004 5 0.42500000000000004 6 0.42500000000000004 7 0.42500000000000004 8 0.42500000000000004 9 0.5 10-11 0.525 12-13 0.5875 14-15 0.775 16-17 0.775 18-19 0.6 20-21 0.65 22-23 0.6875 24-25 0.6 26-27 0.6875 28-29 0.675 30-31 0.65 32-33 0.7250000000000001 34-35 0.675 36-37 0.23854362837413684 38-39 0.2762777847544895 40-41 0.25119316754584275 42-43 0.27631248430042704 44-45 0.1632755589047978 46-47 0.20095453403667418 48-49 0.22607385079125847 50-51 0.163296068333124 52-53 0.10052777079668257 54-55 0.1130937421462679 56-57 0.1130937421462679 58-59 0.15079165619502388 60-61 0.21362151294295048 62-63 0.12565971349585323 64-65 0.12565971349585323 66-67 0.12565971349585323 68-69 0.11310795525951992 70-71 0.18865551502955602 72-73 0.11366506693609499 74-75 0.20013342228152103 76 0.14540167211922936 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 17.0 36 1.0 37 0.0 38 1.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 1.0 51 1.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 1.0 70 3.0 71 8.0 72 14.0 73 79.0 74 251.0 75 871.0 76 2751.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.82499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.38998211091234 96.25 2 1.4055711730130336 2.75 3 0.1533350370559673 0.44999999999999996 4 0.0 0.0 5 0.025555839509327882 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025555839509327882 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 17 0.42500000000000004 No Hit TGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTTCGCGCCGGTAGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1160903 spots for SRR11389770.sra Written 1160903 spots for SRR11389770.sra Read 1160903 spots for SRR11389770.sra Written 1160903 spots for SRR11389770.sra Read 1160903 spots for SRR11389770.sra Written 1160903 spots for SRR11389770.sra Read 1160903 spots for SRR11389770.sra Written 1160903 spots for SRR11389770.sra Read 1160903 spots for SRR11389770.sra Written 1160903 spots for SRR11389770.sra Read 1160903 spots for SRR11389770.sra Written 1160903 spots for SRR11389770.sra Read 1160903 spots for SRR11389770.sra Written 1160903 spots for SRR11389770.sra Read 1160903 spots for SRR11389770.sra Written 1160903 spots for SRR11389770.sra Read 1160903 spots for SRR11389770.sra Written 1160903 spots for SRR11389770.sra Read 1160903 spots for SRR11389770.sra Written 1160903 spots for SRR11389770.sra Read 1160903 spots for SRR11389770.sra Written 1160903 spots for SRR11389770.sra Read 1160903 spots for SRR11389770.sra Written 1160903 spots for SRR11389770.sra Read 1160903 spots for SRR11389770.sra Written 1160903 spots for SRR11389770.sra Read 1160903 spots for SRR11389770.sra Written 1160903 spots for SRR11389770.sra Read 1160903 spots for SRR11389770.sra Written 1160903 spots for SRR11389770.sra Read 1160918 spots for SRR11389770.sra Written 1160918 spots for SRR11389770.sra Read 1160903 spots for SRR11389770.sra Written 1160903 spots for SRR11389770.sra Read 1160903 spots for SRR11389770.sra Written 1160903 spots for SRR11389770.sra Read 1160903 spots for SRR11389770.sra Written 1160903 spots for SRR11389770.sra Read 1160903 spots for SRR11389770.sra Written 1160903 spots for SRR11389770.sra SRR ids: ['SRR11389770.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3fdru1a9 SRR11389770.sra spots: 23218075 blocks: [[1, 1160903], [1160904, 2321806], [2321807, 3482709], [3482710, 4643612], [4643613, 5804515], [5804516, 6965418], [6965419, 8126321], [8126322, 9287224], [9287225, 10448127], [10448128, 11609030], [11609031, 12769933], [12769934, 13930836], [13930837, 15091739], [15091740, 16252642], [16252643, 17413545], [17413546, 18574448], [18574449, 19735351], [19735352, 20896254], [20896255, 22057157], [22057158, 23218075]] SRR11389770 file size 4418849 SRR11389770 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389770 SRR11389770_1.fastq SRR11389770_2.fastq Input file: SRR11389770_1.fastq Paired file: SRR11389770_2.fastq trimmed: SRR11389770-trimmed-pair1.fastq, SRR11389770-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 05:33:52 2024 >> started Sat Dec 7 05:34:12 2024 >> done (19.517s) 23218075 read pairs processed; of these: 521 ( 0.00%) short read pairs filtered out after trimming by size control 99427 ( 0.43%) empty read pairs filtered out after trimming by size control 23118127 (99.57%) read pairs available; of these: 20168 ( 0.09%) trimmed read pairs available after processing 23097959 (99.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 225 0.00% 19 13 0.00% 20 246 0.00% 21 32 0.00% 22 372 0.00% 23 29 0.00% 24 458 0.00% 25 36 0.00% 26 511 0.00% 27 43 0.00% 28 558 0.00% 29 46 0.00% 30 490 0.00% 31 29 0.00% 32 407 0.00% 33 38 0.00% 34 329 0.00% 35 209 0.00% 36 911 0.00% 37 257 0.00% 38 554 0.00% 39 260 0.00% 40 429 0.00% 41 268 0.00% 42 389 0.00% 43 337 0.00% 44 445 0.00% 45 407 0.00% 46 364 0.00% 47 385 0.00% 48 461 0.00% 49 479 0.00% 50 511 0.00% 51 591 0.00% 52 596 0.00% 53 612 0.00% 54 670 0.00% 55 781 0.00% 56 1018 0.00% 57 1232 0.01% 58 1145 0.00% 59 1188 0.01% 60 1324 0.01% 61 1401 0.01% 62 1507 0.01% 63 1743 0.01% 64 1881 0.01% 65 1799 0.01% 66 2116 0.01% 67 2300 0.01% 68 2140 0.01% 69 2495 0.01% 70 3287 0.01% 71 5475 0.02% 72 25031 0.11% 73 195430 0.85% 74 1553323 6.72% 75 10117272 43.76% 76 11181242 48.37% 23118127 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=32 prefix-density=0.52 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.13 sequence-density-rank=14 fanout-score=54.13 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=11.0 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=22 prefix-density=0.46 prefix-fanout=2.6 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.15 sequence-density-rank=18 fanout-score=97.61 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=15.4 sequence=GCCGCCGCCGCC SRR11389770 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 05:34:45 Started mapping on | Dec 07 05:34:45 Finished on | Dec 07 05:36:35 Mapping speed, Million of reads per hour | 756.59 Number of input reads | 23118127 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 19327797 Uniquely mapped reads % | 83.60% Average mapped length | 150.02 Number of splices: Total | 6863209 Number of splices: Annotated (sjdb) | 6563868 Number of splices: GT/AG | 6778613 Number of splices: GC/AG | 73413 Number of splices: AT/AC | 1625 Number of splices: Non-canonical | 9558 Mismatch rate per base, % | 1.12% Deletion rate per base | 0.01% Deletion average length | 1.71 Insertion rate per base | 0.01% Insertion average length | 1.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2544770 % of reads mapped to multiple loci | 11.01% Number of reads mapped to too many loci | 67897 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.72% % of reads unmapped: other | 1.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1245602 1245602 1245602 N_multimapping 2544770 2544770 2544770 N_noFeature 744538 18720924 943319 N_ambiguous 595035 3047 208728 UnstrandedReadsAssigned:17988224 PositiveStrandReadsAssigned:603826 NegativeStrandReadsAssigned:18175750 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389770 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389770-trimmed-pair1.fastq SRR11389770-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,118,127 reads, 20,428,134 reads pseudoaligned [quant] estimated average fragment length: 220.341 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52973 SRR11389770.ke.tsv 35125 SRR11389770.se.tsv 88098 total ==> SRR11389770.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 716.76 0 0 PNS24247 1044 824.659 18.4503 1.34886 PNS24249 1928 1708.66 74.7547 2.63768 PNS24246 1044 824.659 18.4503 1.34886 PNS24248 1044 824.659 18.4503 1.34886 PNS24244 1471 1251.66 81.8945 3.94465 PNS24243 293 94.6356 0 0 KQK14069 1603 1383.66 134.714 5.86981 KQK14071 474 257.125 0 0 ==> SRR11389770.se.tsv <== BRADI_1g14170v3 143 BRADI_1g53295v3 16 BRADI_1g59795v3 139 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 146 BRADI_1g74790v3 216 BRADI_1g09890v3 0 BRADI_1g77505v3 187 BRADI_1g48960v3 0 SRR11389770 completed mapping pipeline successfully