Starting /dee2/code/volunteer_pipeline.sh SRR11389771 current disk space = 1546001440768 free memory = 1595274428 SRR11389771 SRAfilesize 388ab28548bc010dcfbfa2cabef07ab0 SRR11389771.sra SRR11389771.sra file validated SRR11389771 is paired end SRR11389771 is conventional basespace SRR11389771 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389771_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.958 32.0 32.0 32.0 32.0 32.0 2 31.05375 32.0 32.0 32.0 32.0 32.0 3 30.97275 32.0 32.0 32.0 32.0 32.0 4 30.87925 32.0 32.0 32.0 32.0 32.0 5 31.00375 32.0 32.0 32.0 32.0 32.0 6 33.97975 36.0 36.0 36.0 32.0 36.0 7 33.96675 36.0 36.0 36.0 32.0 36.0 8 33.88175 36.0 36.0 36.0 32.0 36.0 9 33.945 36.0 36.0 36.0 32.0 36.0 10-11 33.90075 36.0 36.0 36.0 32.0 36.0 12-13 34.043875 36.0 36.0 36.0 32.0 36.0 14-15 33.929 36.0 36.0 36.0 32.0 36.0 16-17 33.955875 36.0 36.0 36.0 32.0 36.0 18-19 33.897875 36.0 36.0 36.0 32.0 36.0 20-21 33.7555 36.0 36.0 36.0 32.0 36.0 22-23 33.868625 36.0 36.0 36.0 32.0 36.0 24-25 33.739374999999995 36.0 36.0 36.0 32.0 36.0 26-27 33.42725 36.0 36.0 36.0 27.0 36.0 28-29 33.564750000000004 36.0 36.0 36.0 29.5 36.0 30-31 33.347375 36.0 36.0 36.0 24.0 36.0 32-33 33.267125 36.0 36.0 36.0 21.0 36.0 34-35 33.302125000000004 36.0 36.0 36.0 21.0 36.0 36-37 33.558704963466866 36.0 36.0 36.0 27.0 36.0 38-39 33.38548752834467 36.0 36.0 36.0 24.0 36.0 40-41 33.181783824640966 36.0 36.0 36.0 17.5 36.0 42-43 33.14348702443941 36.0 36.0 36.0 14.0 36.0 44-45 33.15507684555304 36.0 36.0 36.0 17.5 36.0 46-47 33.04976064499874 36.0 36.0 36.0 14.0 36.0 48-49 32.86318972033258 36.0 36.0 36.0 14.0 36.0 50-51 32.8567649281935 36.0 36.0 36.0 14.0 36.0 52-53 32.55832703451751 36.0 36.0 36.0 14.0 36.0 54-55 32.533131771227005 36.0 32.0 36.0 14.0 36.0 56-57 32.17964222726127 36.0 32.0 36.0 14.0 36.0 58-59 32.3520084650497 36.0 34.0 36.0 14.0 36.0 60-61 32.09362399193549 36.0 32.0 36.0 14.0 36.0 62-63 31.847152217741936 36.0 32.0 36.0 14.0 36.0 64-65 31.80015120967742 36.0 32.0 36.0 14.0 36.0 66-67 31.366953297635398 36.0 32.0 36.0 14.0 36.0 68-69 31.301400593996664 36.0 32.0 36.0 14.0 36.0 70-71 31.46631231541417 36.0 32.0 36.0 14.0 36.0 72-73 31.192220672072573 36.0 32.0 36.0 14.0 36.0 74-75 30.876456782871756 36.0 32.0 36.0 14.0 36.0 76 30.493318887685085 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 31.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 0.0 20 0.0 21 2.0 22 1.0 23 3.0 24 15.0 25 35.0 26 36.0 27 82.0 28 126.0 29 185.0 30 240.0 31 335.0 32 542.0 33 750.0 34 1006.0 35 610.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.325769036812915 13.086232980332829 10.64044377206253 37.94755421079173 2 24.666162761400855 14.714033761652809 35.827664399092974 24.792139077853363 3 22.499370118417737 21.97026958931721 22.826908541194253 32.7034517510708 4 28.49584278155707 26.63139329805996 20.105820105820104 24.76694381456286 5 25.850340136054424 30.410682791635175 22.272612748803226 21.466364323507182 6 22.75132275132275 32.426303854875286 24.36381960191484 20.458553791887123 7 18.871252204585538 23.759133282942805 36.2559838750315 21.11363063744016 8 20.76089695137314 21.61753590325019 30.990173847316704 26.63139329805996 9 20.634920634920633 20.231796422272613 31.64525069286974 27.48803224993701 10-11 24.275636180398084 29.352481733434114 21.415973796926178 24.95590828924162 12-13 23.910304862685816 23.02847064751827 24.842529604434365 28.21869488536155 14-15 22.839506172839506 25.119677500629884 25.522801713277904 26.51801461325271 16-17 23.381204333585288 25.258251448727638 24.968505920886873 26.3920382968002 18-19 24.88032249937012 24.300831443688587 23.834719072814313 26.984126984126984 20-21 25.14804082146907 24.88345722565201 24.732266599470833 25.236235353408087 22-23 23.053665910808768 25.963718820861676 25.018896447467874 25.963718820861676 24-25 23.59536407155455 24.981103552532126 24.678760393046105 26.74477198286722 26-27 24.401612496850593 24.35122197026959 24.817334341143866 26.429831191735953 28-29 24.011085915847822 24.6031746031746 24.54018644494835 26.845553036029223 30-31 23.658352229780803 25.296044343663393 24.6031746031746 26.442428823381203 32-33 24.313429075333836 24.439405391786345 25.560594608213655 25.686570924666164 34-35 24.38901486520534 24.5527840765936 23.948097757621568 27.110103300579492 36-37 25.982862903225808 24.546370967741936 23.235887096774192 26.234879032258064 38-39 23.4375 25.365423387096776 23.928931451612904 27.268145161290324 40-41 25.05040322580645 24.382560483870968 24.332157258064516 26.234879032258064 42-43 24.669270505228678 24.127504094746126 24.518079879047498 26.6851455209777 44-45 24.69446894292554 23.81252362353534 25.261433791104952 26.23157364243417 46-47 24.899193548387096 24.596774193548388 23.777721774193548 26.726310483870968 48-49 24.621975806451612 23.563508064516128 24.445564516129032 27.368951612903224 50-51 24.029737903225808 24.130544354838708 24.899193548387096 26.940524193548388 52-53 25.551215824618872 23.409348620385536 23.762126748141615 27.277308806853974 54-55 25.41902961562697 24.322621298046627 23.768115942028984 26.490233144297413 56-57 24.105342741935484 24.00453629032258 25.037802419354836 26.852318548387093 58-59 25.078764965343414 23.944549464398236 24.650283553875234 26.32640201638311 60-61 24.74161835139904 24.35089488278296 24.237459037055707 26.670027728762292 62-63 25.132341820015125 24.363498865641542 24.426518779934458 26.077640534408875 64-65 25.775144945802875 23.367784219813462 24.47693471136879 26.380136123014875 66-67 24.3727146639768 23.36401462615055 24.85184718194427 27.41142352792838 68-69 24.32193768134225 23.464110003784533 24.85177242336319 27.36217989151003 70-71 24.706476454993055 23.70912763539957 24.100492362075496 27.48390354753188 72-73 24.667595289350388 22.996074458655187 24.832214765100673 27.50411548689376 74-75 24.6763646069665 21.086347257440277 25.58387828640064 28.653409849192577 76 28.494041170097507 0.0 32.24990971469845 39.25604911520404 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 32.0 1 16.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 2.5 19 8.0 20 14.0 21 13.5 22 16.0 23 16.5 24 11.0 25 11.0 26 14.5 27 18.5 28 20.5 29 23.0 30 28.5 31 36.5 32 52.5 33 62.0 34 63.5 35 76.0 36 95.5 37 105.0 38 107.0 39 122.5 40 137.0 41 149.0 42 156.0 43 156.0 44 157.5 45 154.0 46 160.0 47 177.5 48 185.5 49 172.5 50 161.5 51 149.5 52 124.5 53 116.5 54 122.5 55 128.5 56 125.0 57 125.0 58 132.0 59 122.0 60 129.0 61 135.5 62 125.5 63 122.5 64 113.0 65 97.0 66 91.0 67 93.0 68 82.5 69 74.5 70 68.0 71 59.5 72 55.5 73 48.0 74 44.0 75 42.0 76 30.5 77 22.0 78 16.5 79 10.5 80 9.5 81 5.5 82 4.0 83 4.5 84 2.0 85 1.0 86 1.5 87 1.0 88 1.5 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.775 3 0.775 4 0.775 5 0.775 6 0.775 7 0.775 8 0.775 9 0.775 10-11 0.775 12-13 0.775 14-15 0.775 16-17 0.775 18-19 0.775 20-21 0.7875 22-23 0.775 24-25 0.775 26-27 0.775 28-29 0.775 30-31 0.775 32-33 0.775 34-35 0.775 36-37 0.02519526329050139 38-39 0.02519526329050139 40-41 0.02519526329050139 42-43 0.012597631645250695 44-45 0.012597631645250695 46-47 0.02519526329050139 48-49 0.02519526329050139 50-51 0.02519526329050139 52-53 0.012597631645250695 54-55 0.03779289493575208 56-57 0.02519526329050139 58-59 0.025198437696862794 60-61 0.025201612903225805 62-63 0.025201612903225805 64-65 0.025201612903225805 66-67 0.025211143325349804 68-69 0.02522386177323748 70-71 0.012623074981065388 72-73 0.0253196607165464 74-75 0.013344008540165465 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 31.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 1.0 66 1.0 67 1.0 68 1.0 69 1.0 70 4.0 71 2.0 72 15.0 73 65.0 74 260.0 75 848.0 76 2769.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.875 #Duplication Level Percentage of deduplicated Percentage of total 1 97.57496740547587 93.55 2 1.9035202086049543 3.65 3 0.28683181225554105 0.8250000000000001 4 0.07822685788787484 0.3 5 0.02607561929595828 0.125 6 0.02607561929595828 0.15 7 0.02607561929595828 0.17500000000000002 8 0.02607561929595828 0.2 9 0.0 0.0 >10 0.05215123859191656 1.0250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 31 0.775 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 10 0.25 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 8 0.2 No Hit GTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTA 7 0.17500000000000002 No Hit AGAAGAATTACTGCATTTCGTAACTTATTTTTTCTCTTTTTATTTTGTTT 6 0.15 No Hit CAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 57 0.05 0.0 0.0 0.0 0.0 58 0.05 0.0 0.0 0.0 0.0 59 0.05 0.0 0.0 0.0 0.0 60 0.05 0.0 0.0 0.0 0.0 61 0.05 0.0 0.0 0.0 0.0 62 0.05 0.0 0.0 0.0 0.0 63 0.05 0.0 0.0 0.0 0.0 64 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389771 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389771_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.4705 32.0 32.0 32.0 32.0 32.0 2 30.299 32.0 32.0 32.0 32.0 32.0 3 29.9475 32.0 32.0 32.0 21.0 32.0 4 30.1305 32.0 32.0 32.0 21.0 32.0 5 30.09675 32.0 32.0 32.0 21.0 32.0 6 33.217 36.0 36.0 36.0 21.0 36.0 7 33.4125 36.0 36.0 36.0 27.0 36.0 8 33.072 36.0 36.0 36.0 21.0 36.0 9 33.3235 36.0 36.0 36.0 21.0 36.0 10-11 33.251625000000004 36.0 36.0 36.0 21.0 36.0 12-13 33.244 36.0 36.0 36.0 21.0 36.0 14-15 33.023375 36.0 36.0 36.0 21.0 36.0 16-17 32.997375 36.0 36.0 36.0 21.0 36.0 18-19 32.94525 36.0 36.0 36.0 17.5 36.0 20-21 32.89875 36.0 36.0 36.0 17.5 36.0 22-23 32.9655 36.0 36.0 36.0 17.5 36.0 24-25 32.734875 36.0 36.0 36.0 14.0 36.0 26-27 32.775125 36.0 36.0 36.0 14.0 36.0 28-29 32.852000000000004 36.0 36.0 36.0 14.0 36.0 30-31 32.62225 36.0 36.0 36.0 14.0 36.0 32-33 32.447874999999996 36.0 36.0 36.0 14.0 36.0 34-35 32.4225 36.0 36.0 36.0 14.0 36.0 36-37 32.751515917129865 36.0 36.0 36.0 14.0 36.0 38-39 32.76563956937122 36.0 36.0 36.0 14.0 36.0 40-41 32.52249747219413 36.0 36.0 36.0 14.0 36.0 42-43 32.544362992922146 36.0 36.0 36.0 14.0 36.0 44-45 32.39294742163802 36.0 36.0 36.0 14.0 36.0 46-47 32.21309403437816 36.0 34.0 36.0 14.0 36.0 48-49 32.18920626895854 36.0 34.0 36.0 14.0 36.0 50-51 32.05611729019212 36.0 32.0 36.0 14.0 36.0 52-53 31.894337714863497 36.0 32.0 36.0 14.0 36.0 54-55 31.536526794742166 36.0 32.0 36.0 14.0 36.0 56-57 31.523640960809104 36.0 32.0 36.0 14.0 36.0 58-59 31.334919814273754 36.0 32.0 36.0 14.0 36.0 60-61 31.06550328780981 36.0 32.0 36.0 14.0 36.0 62-63 31.009231158320688 36.0 32.0 36.0 14.0 36.0 64-65 30.917551846231664 36.0 32.0 36.0 14.0 36.0 66-67 30.828880180512524 36.0 32.0 36.0 14.0 36.0 68-69 30.696937343285203 36.0 27.0 36.0 14.0 36.0 70-71 30.390641410075908 36.0 27.0 36.0 14.0 36.0 72-73 30.581191710613602 36.0 29.5 36.0 14.0 36.0 74-75 30.112312053419284 36.0 27.0 36.0 14.0 36.0 76 29.581130690161526 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 40.0 3 0.0 4 1.0 5 3.0 6 0.0 7 0.0 8 0.0 9 1.0 10 4.0 11 3.0 12 1.0 13 1.0 14 2.0 15 1.0 16 4.0 17 3.0 18 5.0 19 4.0 20 15.0 21 17.0 22 21.0 23 32.0 24 47.0 25 58.0 26 87.0 27 96.0 28 158.0 29 208.0 30 264.0 31 361.0 32 494.0 33 677.0 34 899.0 35 493.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.07354056103108 18.44831943391458 9.22415971695729 35.25398028809704 2 30.679807935304527 22.036896638867827 28.708617639625977 18.57467778620167 3 23.03030303030303 28.863636363636363 21.54040404040404 26.565656565656564 4 28.257575757575758 30.277777777777775 17.9040404040404 23.56060606060606 5 28.939393939393938 32.601010101010104 18.737373737373737 19.72222222222222 6 24.267676767676768 31.843434343434346 20.606060606060606 23.282828282828284 7 22.935084617327608 17.655973730740087 33.72063652437484 25.688305127557463 8 25.176767676767675 21.06060606060606 22.803030303030305 30.95959595959596 9 24.26693629929221 20.57633973710819 26.49140546006067 28.665318503538927 10-11 28.078381795195956 26.1314791403287 19.25410872313527 26.536030341340076 12-13 28.133704735376046 21.093947834894912 21.13193213471765 29.640415295011397 14-15 26.767356263485215 24.96509709353979 22.756695012057367 25.51085163091763 16-17 27.8207894402843 23.226297753522022 21.754029699200405 27.19888310699327 18-19 27.001013171225935 23.36626139817629 22.758358662613983 26.874366767983787 20-21 27.591018647722947 24.406951668146647 22.466066218444755 25.53596346568565 22-23 27.40994419076611 24.04870624048706 22.71689497716895 25.82445459157788 24-25 25.96019774369375 25.174293319812396 22.28419318037774 26.58131575611611 26-27 27.832043638208802 24.432322719776735 22.275783331219078 25.459850310795385 28-29 27.68196804463606 23.788993152422012 22.17854425564291 26.350494547299007 30-31 26.867943676265384 24.508435874667008 22.161613598883672 26.46200685018394 32-33 26.037304910544346 25.517066362136788 22.053038954447405 26.39258977287146 34-35 26.58548959918823 24.556062912227294 22.234906139015727 26.623541349568747 36-37 26.813800101471337 23.515981735159816 22.84373414510401 26.82648401826484 38-39 27.578333121907907 25.472535836610426 22.186984650513764 24.762146390967906 40-41 27.85179545742926 23.727953305418094 22.10379393477985 26.316457302372797 42-43 26.973851231276974 23.775069814673774 22.784970804772787 26.46610814927647 44-45 27.687626774847867 23.732251521298174 22.52789046653144 26.052231237322516 46-47 27.45595132462923 24.071491950817595 21.903916846241604 26.568639878311572 48-49 27.53108348134991 22.912966252220247 22.6972849530576 26.858665313372242 50-51 27.499683183373463 23.520466354074262 22.46863515397288 26.511215308579395 52-53 27.108128640162064 23.866801721954925 23.005824259306156 26.019245378576855 54-55 26.668355071546156 24.490312777003926 22.47688995821198 26.364442193237934 56-57 27.06433637284701 24.455420466058765 23.290273556231003 25.189969604863222 58-59 27.399518194497276 24.546722454672246 22.01090401927222 26.04285533155826 60-61 26.560913705583754 24.67005076142132 21.814720812182742 26.954314720812185 62-63 26.815359270054493 23.837282980610823 22.798124445570902 26.54923330376378 64-65 27.573529411764707 24.201318458417852 21.843306288032455 26.38184584178499 66-67 27.19209325899645 24.42980233147491 22.009630005068423 26.368474404460212 68-69 27.434077079107507 23.504056795131845 22.489858012170387 26.57200811359026 70-71 27.981709640543627 23.993395147974088 22.278673948939414 25.746221262542868 72-73 25.970719287078293 23.74283895607893 23.06810948440484 27.21833227243794 74-75 26.790522347872916 21.499730748519116 23.774905761981692 27.934841141626276 76 30.978660779985283 0.0 31.199411331861665 37.821927888153056 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 42.0 1 21.0 2 0.5 3 0.5 4 0.5 5 1.0 6 1.0 7 3.0 8 5.0 9 2.5 10 0.0 11 0.5 12 1.5 13 2.0 14 3.0 15 2.5 16 1.0 17 2.0 18 3.0 19 6.0 20 8.0 21 7.5 22 6.5 23 7.0 24 11.5 25 12.0 26 13.5 27 15.5 28 16.0 29 25.5 30 33.0 31 39.5 32 44.0 33 37.5 34 33.5 35 52.5 36 75.5 37 76.0 38 77.5 39 86.5 40 91.0 41 98.5 42 111.5 43 133.5 44 150.5 45 141.0 46 134.0 47 143.0 48 142.0 49 144.5 50 147.5 51 141.0 52 144.0 53 139.5 54 132.5 55 126.5 56 131.5 57 138.0 58 136.0 59 152.0 60 154.0 61 152.0 62 153.0 63 136.0 64 114.5 65 111.0 66 118.0 67 110.0 68 105.0 69 96.5 70 83.0 71 76.5 72 73.5 73 69.0 74 60.0 75 52.5 76 38.0 77 24.0 78 18.5 79 15.5 80 12.5 81 12.0 82 11.0 83 7.0 84 3.5 85 1.0 86 0.5 87 0.0 88 0.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.075 2 1.075 3 1.0 4 1.0 5 1.0 6 1.0 7 1.0250000000000001 8 1.0 9 1.0999999999999999 10-11 1.125 12-13 1.275 14-15 1.5125 16-17 1.5125 18-19 1.3 20-21 1.4625000000000001 22-23 1.4500000000000002 24-25 1.3875 26-27 1.4625000000000001 28-29 1.425 30-31 1.4625000000000001 32-33 1.4874999999999998 34-35 1.4500000000000002 36-37 0.404244567963618 38-39 0.3917108920899671 40-41 0.3918099089989888 42-43 0.4297269969666329 44-45 0.3033367037411527 46-47 0.29069767441860467 48-49 0.3791708796764408 50-51 0.2654196157735086 52-53 0.1769464105156724 54-55 0.1895854398382204 56-57 0.17699115044247787 58-59 0.27816411682892905 60-61 0.3540718259989884 62-63 0.21497218007081437 64-65 0.25290844714213456 66-67 0.1897053243961047 68-69 0.1898013412628116 70-71 0.30391287830821834 72-73 0.2286294932046234 74-75 0.26852846401718583 76 0.22026431718061676 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 42.0 36 0.0 37 0.0 38 2.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 1.0 68 1.0 69 1.0 70 3.0 71 2.0 72 17.0 73 68.0 74 272.0 75 864.0 76 2724.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.65380604796663 93.65 2 1.7987486965589154 3.45 3 0.31282586027111575 0.8999999999999999 4 0.10427528675703858 0.4 5 0.026068821689259645 0.125 6 0.05213764337851929 0.3 7 0.026068821689259645 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.026068821689259645 1.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 40 1.0 No Hit AAATTATCCGAGCAGCTTGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCG 7 0.17500000000000002 No Hit GAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGA 6 0.15 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 6 0.15 No Hit CTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1114840 spots for SRR11389771.sra Written 1114840 spots for SRR11389771.sra Read 1114840 spots for SRR11389771.sra Written 1114840 spots for SRR11389771.sra Read 1114840 spots for SRR11389771.sra Written 1114840 spots for SRR11389771.sra Read 1114840 spots for SRR11389771.sra Written 1114840 spots for SRR11389771.sra Read 1114840 spots for SRR11389771.sra Written 1114840 spots for SRR11389771.sra Read 1114840 spots for SRR11389771.sra Written 1114840 spots for SRR11389771.sra Read 1114840 spots for SRR11389771.sra Written 1114840 spots for SRR11389771.sra Read 1114840 spots for SRR11389771.sra Written 1114840 spots for SRR11389771.sra Read 1114840 spots for SRR11389771.sra Written 1114840 spots for SRR11389771.sra Read 1114840 spots for SRR11389771.sra Written 1114840 spots for SRR11389771.sra Read 1114840 spots for SRR11389771.sra Written 1114840 spots for SRR11389771.sra Read 1114840 spots for SRR11389771.sra Written 1114840 spots for SRR11389771.sra Read 1114857 spots for SRR11389771.sra Written 1114857 spots for SRR11389771.sra Read 1114840 spots for SRR11389771.sra Written 1114840 spots for SRR11389771.sra Read 1114840 spots for SRR11389771.sra Written 1114840 spots for SRR11389771.sra Read 1114840 spots for SRR11389771.sra Written 1114840 spots for SRR11389771.sra Read 1114840 spots for SRR11389771.sra Written 1114840 spots for SRR11389771.sra Read 1114840 spots for SRR11389771.sra Written 1114840 spots for SRR11389771.sra Read 1114840 spots for SRR11389771.sra Written 1114840 spots for SRR11389771.sra Read 1114840 spots for SRR11389771.sra Written 1114840 spots for SRR11389771.sra SRR ids: ['SRR11389771.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6_ge5ozm SRR11389771.sra spots: 22296817 blocks: [[1, 1114840], [1114841, 2229680], [2229681, 3344520], [3344521, 4459360], [4459361, 5574200], [5574201, 6689040], [6689041, 7803880], [7803881, 8918720], [8918721, 10033560], [10033561, 11148400], [11148401, 12263240], [12263241, 13378080], [13378081, 14492920], [14492921, 15607760], [15607761, 16722600], [16722601, 17837440], [17837441, 18952280], [18952281, 20067120], [20067121, 21181960], [21181961, 22296817]] SRR11389771 file size 4232235 SRR11389771 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389771 SRR11389771_1.fastq SRR11389771_2.fastq Input file: SRR11389771_1.fastq Paired file: SRR11389771_2.fastq trimmed: SRR11389771-trimmed-pair1.fastq, SRR11389771-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 05:38:41 2024 >> started Sat Dec 7 05:39:03 2024 >> done (22.122s) 22296817 read pairs processed; of these: 605 ( 0.00%) short read pairs filtered out after trimming by size control 219988 ( 0.99%) empty read pairs filtered out after trimming by size control 22076224 (99.01%) read pairs available; of these: 21756 ( 0.10%) trimmed read pairs available after processing 22054468 (99.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 541 0.00% 19 12 0.00% 20 828 0.00% 21 35 0.00% 22 918 0.00% 23 23 0.00% 24 1174 0.01% 25 26 0.00% 26 1154 0.01% 27 33 0.00% 28 1042 0.00% 29 39 0.00% 30 930 0.00% 31 35 0.00% 32 754 0.00% 33 26 0.00% 34 602 0.00% 35 194 0.00% 36 1454 0.01% 37 259 0.00% 38 872 0.00% 39 232 0.00% 40 566 0.00% 41 269 0.00% 42 431 0.00% 43 355 0.00% 44 451 0.00% 45 405 0.00% 46 411 0.00% 47 463 0.00% 48 470 0.00% 49 551 0.00% 50 643 0.00% 51 604 0.00% 52 720 0.00% 53 709 0.00% 54 740 0.00% 55 1077 0.00% 56 1475 0.01% 57 1553 0.01% 58 1402 0.01% 59 1389 0.01% 60 1551 0.01% 61 1612 0.01% 62 1721 0.01% 63 2041 0.01% 64 2306 0.01% 65 2180 0.01% 66 2582 0.01% 67 2707 0.01% 68 2648 0.01% 69 3032 0.01% 70 3965 0.02% 71 6519 0.03% 72 25921 0.12% 73 186164 0.84% 74 1435135 6.50% 75 9585728 43.42% 76 10784545 48.85% 22076224 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=27 prefix-density=0.66 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=51.23 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.1 sequence=GTTCTCCTTCTAATGCAAACAGCACGCATTCAAGAGGAGAGAGAAATGAACAAGTGAGCAGAAGAACAAAGATGCCCGGATTCATCTCACAAATAACCGAGGGATATTACACAAACACCATCTTTAGTGTACAACACCAACTCCTCATCTCTGACTTTCACATGCAACATCTATCAGTCCTGACTCCTGACTCAATCTCGACACATGCAGCAGCATCCATCATCAACAATGACGTCGTCGGCCAAGCGCCTCAGCATAGAGCAGGCGCTGGAGCTTGCTAACTAAGCTCACTTGCCGGGG criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.22 fanout-score-rank=19 prefix-density=0.61 prefix-fanout=2.7 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTATGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=17.77 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.3 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC SRR11389771 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 05:39:59 Started mapping on | Dec 07 05:39:59 Finished on | Dec 07 05:41:54 Mapping speed, Million of reads per hour | 691.08 Number of input reads | 22076224 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 18101124 Uniquely mapped reads % | 81.99% Average mapped length | 150.11 Number of splices: Total | 6342054 Number of splices: Annotated (sjdb) | 6081115 Number of splices: GT/AG | 6261107 Number of splices: GC/AG | 70608 Number of splices: AT/AC | 1265 Number of splices: Non-canonical | 9074 Mismatch rate per base, % | 1.06% Deletion rate per base | 0.01% Deletion average length | 1.69 Insertion rate per base | 0.01% Insertion average length | 1.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2647262 % of reads mapped to multiple loci | 11.99% Number of reads mapped to too many loci | 107693 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.32% % of reads unmapped: other | 2.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1327872 1327872 1327872 N_multimapping 2647262 2647262 2647262 N_noFeature 679199 17579407 832996 N_ambiguous 549606 2346 198872 UnstrandedReadsAssigned:16872319 PositiveStrandReadsAssigned:519371 NegativeStrandReadsAssigned:17069256 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389771 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389771-trimmed-pair1.fastq SRR11389771-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,076,224 reads, 19,243,036 reads pseudoaligned [quant] estimated average fragment length: 213.454 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52973 SRR11389771.ke.tsv 35125 SRR11389771.se.tsv 88098 total ==> SRR11389771.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 723.632 0 0 PNS24247 1044 831.546 11.1495 0.846499 PNS24249 1928 1715.55 45.1162 1.6603 PNS24246 1044 831.546 11.1495 0.846499 PNS24248 1044 831.546 11.1495 0.846499 PNS24244 1471 1258.55 67.4353 3.38278 PNS24243 293 100.271 0 0 KQK14069 1603 1390.55 608.256 27.6158 KQK14071 474 263.833 32.2996 7.72901 ==> SRR11389771.se.tsv <== BRADI_1g14170v3 665 BRADI_1g53295v3 3 BRADI_1g59795v3 578 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 101 BRADI_1g74790v3 33 BRADI_1g09890v3 0 BRADI_1g77505v3 179 BRADI_1g48960v3 0 SRR11389771 completed mapping pipeline successfully