Starting /dee2/code/volunteer_pipeline.sh SRR11389773 current disk space = 1546000695296 free memory = 1600096676 SRR11389773 SRAfilesize e763b042c7d583af64b739e803e2b95f SRR11389773.sra SRR11389773.sra file validated SRR11389773 is paired end SRR11389773 is conventional basespace SRR11389773 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389773_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.17225 32.0 32.0 32.0 32.0 32.0 2 30.899 32.0 32.0 32.0 32.0 32.0 3 30.8625 32.0 32.0 32.0 32.0 32.0 4 31.1305 32.0 32.0 32.0 32.0 32.0 5 31.0745 32.0 32.0 32.0 32.0 32.0 6 34.16125 36.0 36.0 36.0 32.0 36.0 7 34.1035 36.0 36.0 36.0 32.0 36.0 8 34.00025 36.0 36.0 36.0 32.0 36.0 9 33.98125 36.0 36.0 36.0 32.0 36.0 10-11 33.92425 36.0 36.0 36.0 32.0 36.0 12-13 34.15725 36.0 36.0 36.0 32.0 36.0 14-15 34.08725 36.0 36.0 36.0 32.0 36.0 16-17 34.12825 36.0 36.0 36.0 32.0 36.0 18-19 33.883625 36.0 36.0 36.0 32.0 36.0 20-21 33.864125 36.0 36.0 36.0 32.0 36.0 22-23 33.9685 36.0 36.0 36.0 32.0 36.0 24-25 33.899125 36.0 36.0 36.0 32.0 36.0 26-27 33.703374999999994 36.0 36.0 36.0 32.0 36.0 28-29 33.626375 36.0 36.0 36.0 29.5 36.0 30-31 33.416875000000005 36.0 36.0 36.0 24.0 36.0 32-33 33.3905 36.0 36.0 36.0 24.0 36.0 34-35 33.329375 36.0 36.0 36.0 21.0 36.0 36-37 33.46597759513053 36.0 36.0 36.0 27.0 36.0 38-39 33.480628930817616 36.0 36.0 36.0 24.0 36.0 40-41 33.359748427672955 36.0 36.0 36.0 24.0 36.0 42-43 33.35811320754717 36.0 36.0 36.0 21.0 36.0 44-45 33.2759748427673 36.0 36.0 36.0 21.0 36.0 46-47 33.12503144654088 36.0 36.0 36.0 17.5 36.0 48-49 32.91356316054353 36.0 36.0 36.0 14.0 36.0 50-51 32.90613990941117 36.0 36.0 36.0 14.0 36.0 52-53 32.53636134876699 36.0 34.0 36.0 14.0 36.0 54-55 32.61537493709109 36.0 32.0 36.0 14.0 36.0 56-57 32.56040775232822 36.0 36.0 36.0 14.0 36.0 58-59 32.06342813994463 36.0 32.0 36.0 14.0 36.0 60-61 32.21331487540901 36.0 32.0 36.0 14.0 36.0 62-63 31.891391895293232 36.0 32.0 36.0 14.0 36.0 64-65 31.94205876200336 36.0 32.0 36.0 14.0 36.0 66-67 31.524126496476725 36.0 32.0 36.0 14.0 36.0 68-69 31.55990522490994 36.0 32.0 36.0 14.0 36.0 70-71 31.569368771795375 36.0 32.0 36.0 14.0 36.0 72-73 31.166654193146734 36.0 32.0 36.0 14.0 36.0 74-75 31.013585436118838 36.0 32.0 36.0 14.0 36.0 76 30.665341525117455 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 0.0 21 0.0 22 2.0 23 6.0 24 11.0 25 27.0 26 49.0 27 72.0 28 114.0 29 157.0 30 265.0 31 350.0 32 479.0 33 755.0 34 1063.0 35 625.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.61267605633803 12.977867203219315 11.343058350100604 36.06639839034205 2 24.77364185110664 13.380281690140844 35.73943661971831 26.10663983903421 3 23.06338028169014 20.72434607645875 22.761569416498993 33.45070422535211 4 27.96780684104628 27.96780684104628 19.59255533199195 24.471830985915492 5 26.08148893360161 29.82897384305835 22.912474849094565 21.177062374245473 6 21.780684104627767 30.96076458752515 24.72334004024145 22.535211267605636 7 18.410462776659962 23.113682092555333 38.27967806841046 20.196177062374247 8 19.491951710261567 22.937625754527165 31.841046277665995 25.729376257545272 9 20.598591549295776 20.85010060362173 32.72132796780684 25.829979879275655 10-11 22.950201207243463 30.58350100603622 21.906438631790746 24.55985915492958 12-13 24.13229376257545 23.327464788732392 26.094064386317907 26.446177062374243 14-15 23.050804828973842 24.572434607645878 26.974346076458755 25.402414486921533 16-17 23.69215291750503 24.4341046277666 25.99346076458752 25.880281690140844 18-19 22.82444668008048 25.603621730382294 25.414989939637827 26.156941649899395 20-21 23.544208275688593 26.084769211419946 24.965413155577913 25.405609357313548 22-23 23.717303822937627 24.899396378269618 26.7102615694165 24.673038229376257 24-25 23.943661971830984 24.698189134808853 25.591046277665995 25.767102615694164 26-27 23.8682092555332 24.798792756539235 26.395875251509054 24.93712273641851 28-29 23.91851106639839 25.05030181086519 25.616197183098592 25.414989939637827 30-31 23.088531187122737 25.591046277665995 26.094064386317907 25.226358148893357 32-33 22.67354124748491 25.80482897384306 25.62877263581489 25.892857142857146 34-35 23.74245472837022 26.03118712273642 24.59758551307847 25.62877263581489 36-37 22.795320166058623 25.424581708390992 25.500062900993836 26.280035224556546 38-39 23.13789632611978 24.597382989431303 25.80523402113739 26.459486663311527 40-41 24.29542023150478 24.182184197282336 25.71716155007549 25.80523402113739 42-43 24.2168826267455 24.12882123537552 25.198138130582464 26.456158007296516 44-45 23.046924141401433 24.40558560825261 26.544219398666495 26.003270851679456 46-47 23.930548565676897 24.194765978862605 25.603925515853042 26.270759939607448 48-49 23.949156808457086 24.31412031210672 25.43418071985905 26.302542159577147 50-51 22.640322174679085 24.528064434935818 26.65492071482507 26.17669267556003 52-53 23.87064300994086 23.89580973952435 25.405813514533786 26.827733736001008 54-55 24.012081550465645 24.603574125346086 25.83689906871382 25.547445255474454 56-57 22.77190332326284 24.25730110775428 26.120342396777442 26.85045317220544 58-59 23.602719033232628 24.911883182275933 26.271399798590128 25.213997985901308 60-61 23.149546827794563 24.458710976837867 25.969284994964752 26.42245720040282 62-63 23.413897280966765 23.841893252769385 26.611278952668684 26.132930513595166 64-65 23.784328546233308 24.300831443688587 25.736961451247165 26.17787855883094 66-67 23.805923125393825 23.730308758664144 26.43982356647763 26.0239445494644 68-69 24.492625740577335 23.484180007563342 24.58086474221606 27.44232950964326 70-71 23.584310757977043 23.65998234329676 25.576995838062803 27.178711060663385 72-73 24.139240506329113 23.70886075949367 25.63291139240506 26.518987341772153 74-75 24.13196754024212 21.205268059066118 26.912332047359317 27.750432353332442 76 27.502710516805205 0.0 35.59812070834839 36.8991687748464 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 25.0 1 12.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 10.5 19 19.5 20 19.0 21 18.5 22 23.0 23 23.0 24 16.5 25 14.5 26 18.5 27 31.5 28 38.0 29 38.5 30 37.5 31 39.0 32 49.5 33 57.5 34 66.5 35 81.5 36 102.0 37 119.5 38 121.5 39 119.5 40 126.0 41 148.5 42 160.5 43 158.0 44 172.0 45 183.5 46 179.0 47 172.5 48 164.0 49 162.0 50 163.5 51 158.0 52 147.5 53 138.5 54 132.0 55 137.0 56 136.0 57 120.5 58 113.0 59 128.5 60 137.5 61 114.5 62 104.0 63 83.5 64 69.0 65 80.0 66 71.0 67 58.0 68 57.5 69 59.5 70 53.0 71 42.5 72 42.5 73 41.5 74 36.5 75 33.0 76 27.0 77 22.0 78 19.0 79 16.0 80 10.5 81 6.0 82 3.5 83 1.0 84 2.5 85 2.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.6 3 0.6 4 0.6 5 0.6 6 0.6 7 0.6 8 0.6 9 0.6 10-11 0.6 12-13 0.6 14-15 0.6 16-17 0.6 18-19 0.6 20-21 0.6125 22-23 0.6 24-25 0.6 26-27 0.6 28-29 0.6 30-31 0.6 32-33 0.6 34-35 0.6 36-37 0.025154068670607474 38-39 0.025157232704402514 40-41 0.025157232704402514 42-43 0.012578616352201257 44-45 0.012578616352201257 46-47 0.025157232704402514 48-49 0.025163563160543533 50-51 0.025163563160543533 52-53 0.012581781580271767 54-55 0.025163563160543533 56-57 0.025169896803423106 58-59 0.025169896803423106 60-61 0.025169896803423106 62-63 0.025169896803423106 64-65 0.025188916876574305 66-67 0.025198437696862794 68-69 0.02520478890989288 70-71 0.012610340479192938 72-73 0.012656625743576764 74-75 0.013301409949454644 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 24.0 36 1.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 1.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 2.0 64 2.0 65 0.0 66 1.0 67 0.0 68 1.0 69 1.0 70 2.0 71 6.0 72 15.0 73 51.0 74 266.0 75 859.0 76 2767.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.175 #Duplication Level Percentage of deduplicated Percentage of total 1 97.16312056737588 92.475 2 1.99632256369845 3.8 3 0.4728132387706856 1.35 4 0.18387181507748881 0.7000000000000001 5 0.052534804307853955 0.25 6 0.026267402153926978 0.15 7 0.026267402153926978 0.17500000000000002 8 0.026267402153926978 0.2 9 0.0 0.0 >10 0.052534804307853955 0.8999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 24 0.6 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 12 0.3 No Hit GTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTA 8 0.2 No Hit ATTTTTTCTCTTTTTATTTTGTTTCTTTTTATTTAGACCTTCTTCATATT 7 0.17500000000000002 No Hit GAAGAATTACTGCATTTCGTAACTTATTTTTTCTCTTTTTATTTTGTTTC 6 0.15 No Hit CGTAACTTATTTTTTCTCTTTTTATTTTGTTTCTTTTTATTTAGACCTTC 5 0.125 No Hit CTTATTTTTTCTCTTTTTATTTTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389773 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389773_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.62625 32.0 32.0 32.0 32.0 32.0 2 30.271 32.0 32.0 32.0 32.0 32.0 3 30.2615 32.0 32.0 32.0 27.0 32.0 4 30.2385 32.0 32.0 32.0 21.0 32.0 5 30.24625 32.0 32.0 32.0 21.0 32.0 6 33.41625 36.0 36.0 36.0 21.0 36.0 7 33.349 36.0 36.0 36.0 21.0 36.0 8 33.495 36.0 36.0 36.0 21.0 36.0 9 33.57925 36.0 36.0 36.0 32.0 36.0 10-11 33.364125 36.0 36.0 36.0 24.0 36.0 12-13 33.307500000000005 36.0 36.0 36.0 21.0 36.0 14-15 33.107 36.0 36.0 36.0 21.0 36.0 16-17 33.099625 36.0 36.0 36.0 17.5 36.0 18-19 33.244249999999994 36.0 36.0 36.0 21.0 36.0 20-21 33.12425 36.0 36.0 36.0 21.0 36.0 22-23 32.922625 36.0 36.0 36.0 17.5 36.0 24-25 32.890625 36.0 36.0 36.0 14.0 36.0 26-27 32.942125000000004 36.0 36.0 36.0 17.5 36.0 28-29 32.886250000000004 36.0 36.0 36.0 14.0 36.0 30-31 32.783125 36.0 36.0 36.0 14.0 36.0 32-33 32.584625 36.0 36.0 36.0 14.0 36.0 34-35 32.6655 36.0 36.0 36.0 14.0 36.0 36-37 32.862311679540916 36.0 36.0 36.0 14.0 36.0 38-39 32.621815889029 36.0 36.0 36.0 14.0 36.0 40-41 32.56292559899117 36.0 36.0 36.0 14.0 36.0 42-43 32.53139974779319 36.0 36.0 36.0 14.0 36.0 44-45 32.1484237074401 36.0 34.0 36.0 14.0 36.0 46-47 32.19306431273644 36.0 34.0 36.0 14.0 36.0 48-49 32.18630171543895 36.0 34.0 36.0 14.0 36.0 50-51 31.986503531786077 36.0 32.0 36.0 14.0 36.0 52-53 31.87600908173562 36.0 32.0 36.0 14.0 36.0 54-55 31.758072653884966 36.0 32.0 36.0 14.0 36.0 56-57 31.556634712411707 36.0 32.0 36.0 14.0 36.0 58-59 31.285443995963675 36.0 32.0 36.0 14.0 36.0 60-61 31.072906155398588 36.0 32.0 36.0 14.0 36.0 62-63 31.139022238501294 36.0 32.0 36.0 14.0 36.0 64-65 31.120297266879483 36.0 32.0 36.0 14.0 36.0 66-67 30.955856745493687 36.0 29.5 36.0 14.0 36.0 68-69 30.78423269108103 36.0 29.5 36.0 14.0 36.0 70-71 30.558083540610667 36.0 27.0 36.0 14.0 36.0 72-73 30.692457821681508 36.0 29.5 36.0 14.0 36.0 74-75 30.30086558104218 36.0 27.0 36.0 14.0 36.0 76 29.554606240713223 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 34.0 3 0.0 4 2.0 5 3.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 2.0 12 3.0 13 0.0 14 0.0 15 3.0 16 2.0 17 6.0 18 2.0 19 7.0 20 17.0 21 13.0 22 18.0 23 32.0 24 36.0 25 52.0 26 79.0 27 113.0 28 154.0 29 207.0 30 255.0 31 323.0 32 539.0 33 680.0 34 897.0 35 519.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.19162884518406 18.658598083711546 9.833585476550681 31.316187594553707 2 29.046898638426626 23.045890065557238 28.290468986384266 19.61674230963187 3 25.189107413010593 27.88703983862834 20.8018154311649 26.122037317196167 4 28.946041351487644 31.568330811901156 18.129097327281897 21.3565305093293 5 29.374684820978313 32.57690368129097 18.86031265758951 19.188098840141198 6 23.22239031770045 35.95562279374685 20.12102874432678 20.70095814422592 7 21.39253279515641 18.390514631685168 34.93945509586276 25.27749747729566 8 25.39082198688855 21.003530005042865 24.331820474029247 29.27382753403933 9 25.725826811411263 20.87856601868215 25.220903812168643 28.174703357737947 10-11 27.026003534460997 28.061095682908356 19.490027770764957 25.422873011865693 12-13 27.40366392924826 22.00884396715098 23.411244472520533 27.176247631080226 14-15 26.441150386418343 24.477385024705438 24.059293044469783 25.022171544406437 16-17 27.01469842878865 24.062341611758743 22.74455144450076 26.17840851495185 18-19 27.426693629929222 24.40596562184024 23.369565217391305 24.797775530839232 20-21 27.79956978362647 24.977856510186005 22.34594457800835 24.87662912817917 22-23 27.208301695773223 25.208807896735003 23.146038977474056 24.436851430017718 24-25 27.12443095599393 24.557410217501264 23.394031360647446 24.92412746585736 26-27 27.423437104530496 24.66464186281954 23.626929891166792 24.284991141483168 28-29 27.008222643896268 25.14864010120177 22.5426944971537 25.30044275774826 30-31 26.354430379746834 25.037974683544306 22.797468354430382 25.810126582278482 32-33 27.03900709219858 25.07598784194529 23.239614994934144 24.645390070921984 34-35 27.638572513287773 25.082257656289546 22.032396861554037 25.24677296886864 36-37 26.60759493670886 24.89873417721519 23.341772151898734 25.151898734177212 38-39 28.59313663416487 24.98417120425478 22.679498543750793 23.743193617829554 40-41 27.659574468085108 24.544072948328267 22.264437689969604 25.53191489361702 42-43 27.954401519949336 24.35718809373021 22.824572514249525 24.86383787207093 44-45 27.280779450841454 25.914209793749208 22.295330887004937 24.5096798684044 46-47 26.90361750569188 25.183405008854038 23.324057677713128 24.588919807740954 48-49 26.659067882472137 24.189463019250255 24.189463019250255 24.962006079027354 50-51 26.72653680748798 24.728054642044018 23.058436630407286 25.486971920060714 52-53 27.61627906976744 25.0 22.219413549039434 25.164307381193122 54-55 27.3416761471369 25.609910251548477 22.778409809126533 24.270003792188092 56-57 27.076222980659843 25.90064467197573 22.841612944002023 24.181519403362405 58-59 26.825256231810705 25.104390737694548 23.14311021131216 24.927242819182588 60-61 27.798885511651466 24.670719351570416 23.07497467071935 24.455420466058765 62-63 27.97167425392008 24.83560950935761 22.698533131006577 24.49418310571573 64-65 27.90579893643961 24.08204608761712 22.739934160546973 25.272220815396302 66-67 26.357766805924797 25.585517154070136 23.129510064565135 24.92720597543993 68-69 27.482269503546096 24.29078014184397 23.56889564336373 24.658054711246198 70-71 26.02131438721137 25.2473991372748 23.78837858411571 24.94290789139812 72-73 26.53762893161849 24.69120081497517 23.494206035909844 25.2769642174965 74-75 27.395048439181917 21.420882669537136 24.542518837459635 26.641550053821312 76 28.975791433891995 0.0 33.74301675977654 37.28119180633147 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 36.0 1 18.0 2 0.0 3 0.0 4 0.0 5 2.0 6 2.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 1.5 15 4.0 16 4.5 17 4.0 18 5.0 19 6.5 20 7.5 21 9.5 22 10.0 23 10.5 24 12.5 25 12.0 26 14.5 27 18.5 28 19.5 29 18.5 30 25.5 31 33.0 32 38.5 33 45.0 34 51.0 35 64.0 36 71.0 37 74.0 38 87.5 39 99.0 40 103.0 41 121.5 42 133.5 43 150.5 44 159.5 45 158.5 46 176.5 47 167.5 48 160.5 49 177.0 50 185.0 51 159.5 52 132.0 53 134.0 54 146.5 55 150.0 56 147.0 57 146.0 58 139.0 59 142.0 60 157.0 61 145.5 62 127.5 63 111.0 64 92.5 65 91.0 66 91.5 67 90.5 68 75.5 69 68.0 70 61.5 71 52.0 72 54.0 73 57.5 74 50.5 75 41.5 76 40.5 77 31.0 78 21.0 79 18.0 80 12.5 81 8.5 82 6.0 83 3.0 84 3.0 85 3.0 86 2.5 87 2.5 88 2.0 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.8500000000000001 3 0.8500000000000001 4 0.8500000000000001 5 0.8500000000000001 6 0.8500000000000001 7 0.8999999999999999 8 0.8500000000000001 9 0.975 10-11 0.975 12-13 1.0625 14-15 1.3375 16-17 1.35 18-19 1.0999999999999999 20-21 1.2125000000000001 22-23 1.225 24-25 1.15 26-27 1.225 28-29 1.1875 30-31 1.25 32-33 1.3 34-35 1.225 36-37 0.3908712646576724 38-39 0.416141235813367 40-41 0.4287515762925599 42-43 0.4413619167717529 44-45 0.34047919293820933 46-47 0.3026481715006305 48-49 0.4036326942482341 50-51 0.277497477295661 52-53 0.20181634712411706 54-55 0.21442986881937434 56-57 0.21442986881937434 58-59 0.3153380423814329 60-61 0.4036326942482341 62-63 0.23968714519994952 64-65 0.2777777777777778 66-67 0.20214782059380923 68-69 0.18960940462646947 70-71 0.2657218777679362 72-73 0.21601016518424396 74-75 0.335255464664074 76 0.26002971768202077 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 34.0 36 1.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 1.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 1.0 63 2.0 64 2.0 65 0.0 66 3.0 67 0.0 68 1.0 69 1.0 70 5.0 71 2.0 72 24.0 73 60.0 74 269.0 75 902.0 76 2692.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.03878406708596 92.575 2 2.2536687631027252 4.3 3 0.5241090146750524 1.5 4 0.052410901467505246 0.2 5 0.052410901467505246 0.25 6 0.026205450733752623 0.15 7 0.026205450733752623 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.026205450733752623 0.8500000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 34 0.8500000000000001 No Hit GAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGA 7 0.17500000000000002 No Hit GGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTG 6 0.15 No Hit AAATTATCCGAGCAGCTTGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCG 5 0.125 No Hit CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1494249 spots for SRR11389773.sra Written 1494249 spots for SRR11389773.sra Read 1494249 spots for SRR11389773.sra Written 1494249 spots for SRR11389773.sra Read 1494249 spots for SRR11389773.sra Written 1494249 spots for SRR11389773.sra Read 1494249 spots for SRR11389773.sra Written 1494249 spots for SRR11389773.sra Read 1494249 spots for SRR11389773.sra Written 1494249 spots for SRR11389773.sra Read 1494249 spots for SRR11389773.sra Written 1494249 spots for SRR11389773.sra Read 1494249 spots for SRR11389773.sra Written 1494249 spots for SRR11389773.sra Read 1494249 spots for SRR11389773.sra Written 1494249 spots for SRR11389773.sra Read 1494249 spots for SRR11389773.sra Written 1494249 spots for SRR11389773.sra Read 1494249 spots for SRR11389773.sra Written 1494249 spots for SRR11389773.sra Read 1494249 spots for SRR11389773.sra Written 1494249 spots for SRR11389773.sra Read 1494249 spots for SRR11389773.sra Written 1494249 spots for SRR11389773.sra Read 1494249 spots for SRR11389773.sra Written 1494249 spots for SRR11389773.sra Read 1494249 spots for SRR11389773.sra Written 1494249 spots for SRR11389773.sra Read 1494249 spots for SRR11389773.sra Written 1494249 spots for SRR11389773.sra Read 1494249 spots for SRR11389773.sra Written 1494249 spots for SRR11389773.sra Read 1494254 spots for SRR11389773.sra Written 1494254 spots for SRR11389773.sra Read 1494249 spots for SRR11389773.sra Written 1494249 spots for SRR11389773.sra Read 1494249 spots for SRR11389773.sra Written 1494249 spots for SRR11389773.sra Read 1494249 spots for SRR11389773.sra Written 1494249 spots for SRR11389773.sra SRR ids: ['SRR11389773.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sk58ursb SRR11389773.sra spots: 29884985 blocks: [[1, 1494249], [1494250, 2988498], [2988499, 4482747], [4482748, 5976996], [5976997, 7471245], [7471246, 8965494], [8965495, 10459743], [10459744, 11953992], [11953993, 13448241], [13448242, 14942490], [14942491, 16436739], [16436740, 17930988], [17930989, 19425237], [19425238, 20919486], [20919487, 22413735], [22413736, 23907984], [23907985, 25402233], [25402234, 26896482], [26896483, 28390731], [28390732, 29884985]] SRR11389773 file size 5688944 SRR11389773 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389773 SRR11389773_1.fastq SRR11389773_2.fastq Input file: SRR11389773_1.fastq Paired file: SRR11389773_2.fastq trimmed: SRR11389773-trimmed-pair1.fastq, SRR11389773-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 05:40:35 2024 >> started Sat Dec 7 05:40:58 2024 >> done (23.065s) 29884985 read pairs processed; of these: 685 ( 0.00%) short read pairs filtered out after trimming by size control 164216 ( 0.55%) empty read pairs filtered out after trimming by size control 29720084 (99.45%) read pairs available; of these: 32876 ( 0.11%) trimmed read pairs available after processing 29687208 (99.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 314 0.00% 19 35 0.00% 20 502 0.00% 21 55 0.00% 22 691 0.00% 23 69 0.00% 24 834 0.00% 25 57 0.00% 26 941 0.00% 27 66 0.00% 28 992 0.00% 29 88 0.00% 30 868 0.00% 31 78 0.00% 32 776 0.00% 33 50 0.00% 34 653 0.00% 35 298 0.00% 36 1835 0.01% 37 279 0.00% 38 1293 0.00% 39 333 0.00% 40 910 0.00% 41 416 0.00% 42 728 0.00% 43 499 0.00% 44 677 0.00% 45 626 0.00% 46 669 0.00% 47 749 0.00% 48 766 0.00% 49 811 0.00% 50 1046 0.00% 51 1097 0.00% 52 1299 0.00% 53 1235 0.00% 54 1426 0.00% 55 1889 0.01% 56 2349 0.01% 57 2740 0.01% 58 2576 0.01% 59 2780 0.01% 60 3007 0.01% 61 3111 0.01% 62 3484 0.01% 63 3959 0.01% 64 4658 0.02% 65 4548 0.02% 66 5131 0.02% 67 5718 0.02% 68 5407 0.02% 69 6298 0.02% 70 7666 0.03% 71 11881 0.04% 72 38109 0.13% 73 264892 0.89% 74 2064228 6.95% 75 13385522 45.04% 76 13866070 46.66% 29720084 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=24 prefix-density=0.66 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=9.45 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=1.7 sequence=AGAAATTACAACCTTCCAAATAGGAACTAGCCAATCCATGGGTATACCAAGAAGTTACAAAAGTTGTCCCTGTAAACCACCCTCCTAAAGCGAAATAAGCACAAGGAAAGAGCAATAAGCCGGACCATCCTACAAAAACGAAACGGTCCCTTCGTAACCAGTCGTCCACAGTATCAAATAGATCCTTTTCTTCTTTAGGAATTCTACCAAGGGCTATAGTCATAGTGATCCTCCTATTCAATTACTTCAACCATTTCCGAGCACCTCGTATCACTTCCAAGGCATATGATAGTTTGATTATCTGTGGACGATTTCTTTCTCGTGCAATGCCGTTTTTCAATGGTCTCGAAGATATAAATTTTTTCATTTTTATCTATGGAGTCACAACCGAGGTCGTGGTAAATCCATAAATTGGATTCGATTTTTTTCTTAT criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=17 prefix-density=0.67 prefix-fanout=2.3 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=16.26 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.7 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC SRR11389773 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 05:41:32 Started mapping on | Dec 07 05:41:32 Finished on | Dec 07 05:43:48 Mapping speed, Million of reads per hour | 786.71 Number of input reads | 29720084 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 22719777 Uniquely mapped reads % | 76.45% Average mapped length | 150.01 Number of splices: Total | 7636524 Number of splices: Annotated (sjdb) | 7263072 Number of splices: GT/AG | 7534434 Number of splices: GC/AG | 86347 Number of splices: AT/AC | 2331 Number of splices: Non-canonical | 13412 Mismatch rate per base, % | 1.02% Deletion rate per base | 0.01% Deletion average length | 1.72 Insertion rate per base | 0.01% Insertion average length | 1.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 4407262 % of reads mapped to multiple loci | 14.83% Number of reads mapped to too many loci | 257968 % of reads mapped to too many loci | 0.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.62% % of reads unmapped: other | 4.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2593096 2593096 2593096 N_multimapping 4407262 4407262 4407262 N_noFeature 1338527 21998214 1539239 N_ambiguous 774006 4339 282099 UnstrandedReadsAssigned:20607244 PositiveStrandReadsAssigned:717224 NegativeStrandReadsAssigned:20898439 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389773 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389773-trimmed-pair1.fastq SRR11389773-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,720,084 reads, 24,140,421 reads pseudoaligned [quant] estimated average fragment length: 204.18 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,250 rounds 52973 SRR11389773.ke.tsv 35125 SRR11389773.se.tsv 88098 total ==> SRR11389773.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 732.995 4.79659 0.324614 PNS24247 1044 840.82 20.7942 1.2268 PNS24249 1928 1724.82 60.3118 1.73458 PNS24246 1044 840.82 20.7942 1.2268 PNS24248 1044 840.82 20.7942 1.2268 PNS24244 1471 1267.82 197.509 7.72795 PNS24243 293 105.635 2 0.939194 KQK14069 1603 1399.82 1517.25 53.7677 KQK14071 474 272.52 29.636 5.39456 ==> SRR11389773.se.tsv <== BRADI_1g14170v3 1621 BRADI_1g53295v3 16 BRADI_1g59795v3 506 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 208 BRADI_1g74790v3 368 BRADI_1g09890v3 0 BRADI_1g77505v3 450 BRADI_1g48960v3 0 SRR11389773 completed mapping pipeline successfully