Starting /dee2/code/volunteer_pipeline.sh SRR11389774 current disk space = 1545993338880 free memory = 1476015336 SRR11389774 SRAfilesize 808c916bec36c26c79ad0ef914144654 SRR11389774.sra SRR11389774.sra file validated SRR11389774 is paired end SRR11389774 is conventional basespace SRR11389774 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389774_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.4625 32.0 32.0 32.0 32.0 32.0 2 30.60025 32.0 32.0 32.0 32.0 32.0 3 30.49 32.0 32.0 32.0 32.0 32.0 4 30.52 32.0 32.0 32.0 32.0 32.0 5 30.49375 32.0 32.0 32.0 32.0 32.0 6 33.7205 36.0 36.0 36.0 32.0 36.0 7 33.6265 36.0 36.0 36.0 32.0 36.0 8 33.41025 36.0 36.0 36.0 32.0 36.0 9 33.55075 36.0 36.0 36.0 32.0 36.0 10-11 33.400125 36.0 36.0 36.0 26.5 36.0 12-13 33.576625 36.0 36.0 36.0 32.0 36.0 14-15 33.578374999999994 36.0 36.0 36.0 32.0 36.0 16-17 33.582125000000005 36.0 36.0 36.0 32.0 36.0 18-19 33.4735 36.0 36.0 36.0 32.0 36.0 20-21 33.466499999999996 36.0 36.0 36.0 32.0 36.0 22-23 33.423249999999996 36.0 36.0 36.0 32.0 36.0 24-25 33.287125 36.0 36.0 36.0 26.5 36.0 26-27 33.045625 36.0 36.0 36.0 21.0 36.0 28-29 33.048625 36.0 36.0 36.0 21.0 36.0 30-31 32.945 36.0 36.0 36.0 21.0 36.0 32-33 33.04875 36.0 36.0 36.0 21.0 36.0 34-35 32.786874999999995 36.0 36.0 36.0 14.0 36.0 36-37 33.655336772622405 36.0 36.0 36.0 27.0 36.0 38-39 33.48525765846533 36.0 36.0 36.0 24.0 36.0 40-41 33.39574249807643 36.0 36.0 36.0 24.0 36.0 42-43 33.328417542959734 36.0 36.0 36.0 21.0 36.0 44-45 33.29892280071813 36.0 36.0 36.0 21.0 36.0 46-47 33.29687099256219 36.0 36.0 36.0 21.0 36.0 48-49 33.01910746345217 36.0 36.0 36.0 14.0 36.0 50-51 33.03808668889459 36.0 36.0 36.0 14.0 36.0 52-53 32.97832777635291 36.0 36.0 36.0 14.0 36.0 54-55 32.79282800059458 36.0 36.0 36.0 14.0 36.0 56-57 32.60046189376443 36.0 36.0 36.0 14.0 36.0 58-59 32.37028483448807 36.0 32.0 36.0 14.0 36.0 60-61 32.413394919168596 36.0 34.0 36.0 14.0 36.0 62-63 32.150628688734926 36.0 32.0 36.0 14.0 36.0 64-65 31.862295089309473 36.0 32.0 36.0 14.0 36.0 66-67 31.634496919917865 36.0 32.0 36.0 14.0 36.0 68-69 31.640528747433265 36.0 32.0 36.0 14.0 36.0 70-71 31.86908355359037 36.0 32.0 36.0 14.0 36.0 72-73 31.447141062268102 36.0 32.0 36.0 14.0 36.0 74-75 31.352255204693385 36.0 32.0 36.0 14.0 36.0 76 31.058954393770858 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 96.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 6.0 23 5.0 24 17.0 25 16.0 26 30.0 27 66.0 28 97.0 29 173.0 30 237.0 31 311.0 32 485.0 33 700.0 34 1060.0 35 699.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.73789392774788 13.835511145272866 11.3246220855752 34.10197284140405 2 24.25717213114754 14.702868852459016 33.888319672131146 27.151639344262296 3 22.97643442622951 20.952868852459016 22.61782786885246 33.45286885245902 4 28.970286885245898 26.178278688524593 20.081967213114755 24.769467213114755 5 24.23155737704918 31.147540983606557 24.1547131147541 20.466188524590166 6 22.899590163934427 31.326844262295083 25.40983606557377 20.36372950819672 7 17.725409836065573 23.565573770491806 38.29405737704918 20.414959016393443 8 19.287909836065573 23.79610655737705 31.403688524590162 25.512295081967213 9 19.697745901639344 20.69672131147541 33.99077868852459 25.614754098360653 10-11 21.324282786885245 33.18391393442623 22.63063524590164 22.861168032786885 12-13 22.553790983606557 24.24436475409836 26.793032786885245 26.408811475409838 14-15 22.784323770491806 26.03739754098361 26.536885245901637 24.64139344262295 16-17 23.46311475409836 25.384221311475407 25.998975409836067 25.153688524590162 18-19 22.22079918032787 25.550717213114755 26.639344262295083 25.589139344262296 20-21 22.68186475409836 26.434426229508194 26.255122950819672 24.62858606557377 22-23 21.83657786885246 26.088627049180328 27.676741803278688 24.398053278688526 24-25 23.309426229508194 25.678790983606557 26.114241803278688 24.897540983606557 26-27 21.657274590163937 27.62551229508197 25.794057377049178 24.92315573770492 28-29 22.886782786885245 25.653176229508194 26.485655737704917 24.97438524590164 30-31 22.886782786885245 25.755635245901637 26.5625 24.795081967213115 32-33 22.97643442622951 27.177254098360653 25.81967213114754 24.026639344262296 34-35 23.07889344262295 26.703381147540984 25.153688524590162 25.064036885245898 36-37 22.70339525944907 27.200512491992313 25.30429212043562 24.791800128122997 38-39 23.205128205128204 26.384615384615383 25.076923076923073 25.333333333333336 40-41 22.249294690946396 25.763016157989227 26.493972813541934 25.493716337522443 42-43 22.73659912798153 24.762759681969737 27.19928186714542 25.30135932290331 44-45 22.55706591433701 24.762759681969737 26.609387022313413 26.07078738137984 46-47 23.467555783534237 25.30135932290331 25.224416517055655 26.0066683765068 48-49 22.63400872018466 24.839702487817387 27.41728648371377 25.109002308284172 50-51 23.172608361118236 24.39086945370608 26.827391638881764 25.609130546293922 52-53 23.313670171838933 24.03180302641703 25.96819697358297 26.686329828161064 54-55 22.14239897370109 25.182809493264912 26.452854393842205 26.22193713919179 56-57 22.453169104439315 26.943802925327176 24.377726456248396 26.225301513985116 58-59 22.696946369001797 24.108288426995124 27.598152424942263 25.596612779060816 60-61 23.19733128047216 25.352835514498334 26.058506543494996 25.391326661534514 62-63 23.04336669232743 24.775468308955606 27.49550936617911 24.685655632537852 64-65 23.161811882458615 24.470678814320543 26.408315154625946 25.959194148594893 66-67 22.882443531827516 24.25564681724846 26.463039014373717 26.39887063655031 68-69 23.203285420944557 23.613963039014372 26.578542094455855 26.604209445585212 70-71 22.595968673770702 23.90550776736423 26.961098985749132 26.53742457311593 72-73 23.270521424883842 23.696437790397525 26.703665462054726 26.32937532266391 74-75 23.502304147465438 22.838167525074546 26.755218216318788 26.904310111141232 76 24.842417500926956 0.0 38.26473859844272 36.89284390063033 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 104.0 1 53.5 2 2.0 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 2.0 18 11.0 19 19.5 20 18.5 21 24.0 22 29.0 23 24.5 24 20.0 25 18.0 26 25.5 27 54.0 28 54.5 29 39.0 30 47.0 31 56.5 32 60.5 33 64.5 34 68.0 35 72.5 36 94.5 37 112.0 38 128.0 39 136.0 40 129.5 41 148.0 42 160.5 43 168.0 44 187.0 45 193.5 46 198.5 47 176.5 48 160.5 49 165.0 50 155.5 51 138.5 52 134.5 53 120.5 54 104.0 55 115.5 56 120.5 57 109.5 58 98.0 59 109.5 60 121.0 61 116.5 62 110.0 63 88.0 64 70.5 65 63.0 66 59.0 67 63.0 68 54.0 69 45.5 70 38.5 71 30.5 72 36.5 73 36.0 74 27.5 75 25.5 76 24.5 77 20.5 78 15.0 79 14.0 80 15.0 81 11.5 82 6.0 83 4.0 84 3.0 85 3.5 86 2.5 87 0.0 88 0.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.4250000000000003 2 2.4 3 2.4 4 2.4 5 2.4 6 2.4 7 2.4 8 2.4 9 2.4 10-11 2.4 12-13 2.4 14-15 2.4 16-17 2.4 18-19 2.4 20-21 2.4 22-23 2.4 24-25 2.4 26-27 2.4 28-29 2.4 30-31 2.4 32-33 2.4 34-35 2.4 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 96.0 36 3.0 37 0.0 38 2.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 1.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 1.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 3.0 71 11.0 72 16.0 73 59.0 74 236.0 75 874.0 76 2697.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.375 #Duplication Level Percentage of deduplicated Percentage of total 1 96.27906976744185 87.97500000000001 2 2.6812585499316004 4.9 3 0.5471956224350205 1.5 4 0.24623803009575923 0.8999999999999999 5 0.08207934336525308 0.375 6 0.05471956224350205 0.3 7 0.0 0.0 8 0.027359781121751026 0.2 9 0.027359781121751026 0.22499999999999998 >10 0.027359781121751026 1.225 >50 0.027359781121751026 2.4 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 96 2.4 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 49 1.225 No Hit GCATTTCGTAACTTATTTTTTCTCTTTTTATTTTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCT 9 0.22499999999999998 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 8 0.2 No Hit CTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACG 6 0.15 No Hit CCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATTT 6 0.15 No Hit GTCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 5 0.125 No Hit GCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACC 5 0.125 No Hit GTCAGGGTTCAAATGTACATATGCTCCTCGAGCCCATGTCGGTACATTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389774 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389774_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.0805 32.0 32.0 32.0 27.0 32.0 2 29.8245 32.0 32.0 32.0 21.0 32.0 3 29.7385 32.0 32.0 32.0 21.0 32.0 4 29.77525 32.0 32.0 32.0 21.0 32.0 5 29.7015 32.0 32.0 32.0 21.0 32.0 6 32.63775 36.0 36.0 36.0 14.0 36.0 7 32.72725 36.0 36.0 36.0 14.0 36.0 8 32.80075 36.0 36.0 36.0 14.0 36.0 9 32.8385 36.0 36.0 36.0 21.0 36.0 10-11 32.757125 36.0 36.0 36.0 17.5 36.0 12-13 32.882000000000005 36.0 36.0 36.0 21.0 36.0 14-15 32.691 36.0 36.0 36.0 14.0 36.0 16-17 32.614374999999995 36.0 36.0 36.0 14.0 36.0 18-19 32.60625 36.0 36.0 36.0 14.0 36.0 20-21 32.404250000000005 36.0 36.0 36.0 14.0 36.0 22-23 32.522625000000005 36.0 36.0 36.0 14.0 36.0 24-25 32.464375 36.0 36.0 36.0 14.0 36.0 26-27 32.312375 36.0 36.0 36.0 14.0 36.0 28-29 32.474125 36.0 36.0 36.0 14.0 36.0 30-31 32.18925 36.0 36.0 36.0 14.0 36.0 32-33 32.036875 36.0 36.0 36.0 14.0 36.0 34-35 32.2115 36.0 36.0 36.0 14.0 36.0 36-37 32.683062503817396 36.0 36.0 36.0 14.0 36.0 38-39 32.68911078638628 36.0 36.0 36.0 14.0 36.0 40-41 32.494354631768026 36.0 36.0 36.0 14.0 36.0 42-43 32.491660251475494 36.0 36.0 36.0 14.0 36.0 44-45 32.362586605080836 36.0 36.0 36.0 14.0 36.0 46-47 32.2768796510136 36.0 36.0 36.0 14.0 36.0 48-49 32.165640236079035 36.0 32.0 36.0 14.0 36.0 50-51 32.02168334616372 36.0 32.0 36.0 14.0 36.0 52-53 31.809340518347447 36.0 32.0 36.0 14.0 36.0 54-55 31.75921088875592 36.0 32.0 36.0 14.0 36.0 56-57 31.66431322207959 36.0 32.0 36.0 14.0 36.0 58-59 31.32426187419769 36.0 32.0 36.0 14.0 36.0 60-61 31.194736842105264 36.0 32.0 36.0 14.0 36.0 62-63 31.10821566110398 36.0 32.0 36.0 14.0 36.0 64-65 31.051726167046766 36.0 32.0 36.0 14.0 36.0 66-67 30.734078068823834 36.0 29.5 36.0 14.0 36.0 68-69 30.822033898305087 36.0 32.0 36.0 14.0 36.0 70-71 30.406977183274513 36.0 27.0 36.0 14.0 36.0 72-73 30.548766216930957 36.0 27.0 36.0 14.0 36.0 74-75 30.408984403732852 36.0 27.0 36.0 14.0 36.0 76 29.32936660268714 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 99.0 3 0.0 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 2.0 11 0.0 12 1.0 13 0.0 14 3.0 15 6.0 16 8.0 17 13.0 18 11.0 19 11.0 20 14.0 21 22.0 22 24.0 23 16.0 24 37.0 25 70.0 26 90.0 27 91.0 28 155.0 29 183.0 30 230.0 31 311.0 32 470.0 33 634.0 34 934.0 35 563.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.871794871794876 21.28205128205128 10.923076923076923 27.923076923076923 2 29.871794871794872 23.871794871794872 27.205128205128204 19.05128205128205 3 26.147141758523457 28.53114586003589 22.019994873109457 23.301717508331198 4 29.248910535760064 31.99179697513458 17.81594462958216 20.943347859523197 5 29.966675211484233 32.222507049474494 18.89259164316842 18.918226095872853 6 23.14791079210459 36.19584721866188 19.12330171750833 21.5329402717252 7 23.128205128205128 18.384615384615387 34.205128205128204 24.28205128205128 8 23.558062035375546 23.122276339400155 24.35273006921302 28.96693155601128 9 26.02564102564103 23.666666666666668 25.564102564102566 24.743589743589745 10-11 28.661195178250832 27.866119517825084 19.33829186971018 24.1343934342139 12-13 26.853990248909415 22.31203489863998 23.659225044906336 27.174749807544263 14-15 25.786971604779644 26.352306308621355 23.9367853012977 23.923936785301297 16-17 27.719974309569682 25.035324341682724 22.992935131663454 24.251766217084135 18-19 26.344155010907222 26.24149878095727 23.77774926215835 23.63659694597716 20-21 26.277934754687905 26.04675057796044 23.516568199332134 24.158746468019523 22-23 27.070758957236418 26.056247592140746 23.590599717477847 23.282393733144986 24-25 27.194558521560573 25.256673511293638 22.535934291581107 25.012833675564682 26-27 25.866940662727973 24.775237605959415 23.9917801181608 25.366041613151815 28-29 27.404648773597025 24.37395659432387 23.089764992936946 25.13162963914216 30-31 26.367839712304136 26.110968404829183 23.20832263036219 24.312869252504495 32-33 25.578108941418293 25.706577595066804 24.280575539568343 24.434737923946557 34-35 26.68550147682034 26.248876332348786 23.629125465519454 23.436496725311418 36-37 25.94733461785485 25.61335902376365 24.161849710982658 24.277456647398843 38-39 26.81233933161954 25.437017994858614 24.22879177377892 23.52185089974293 40-41 27.66422419334105 25.607404550713458 22.47075459570639 24.257616660239105 42-43 27.234151986627236 25.845441687025843 22.93943680082294 23.98096952552398 44-45 26.497044461578 26.407093292212796 23.091750192752507 24.004112053456694 46-47 27.290247976358728 26.095335988693307 22.39496338172941 24.219452653218553 48-49 26.243413443002183 25.035342500963885 24.50841794113867 24.212826114895257 50-51 26.676946800308404 26.17579028527371 22.8218966846569 24.325366229760988 52-53 26.248876332348786 26.76255297290356 22.177988955952227 24.810581738795427 54-55 26.885035324341683 25.934489402697498 23.660886319845858 23.519588953114965 56-57 26.58016443987667 25.732271325796507 23.496916752312437 24.190647482014388 58-59 27.419976860779023 25.09319964005656 24.321892274071217 23.1649312250932 60-61 25.2475884244373 26.816720257234728 23.4983922829582 24.437299035369776 62-63 25.36622976098689 26.92109997429967 23.74710871241326 23.96556155230018 64-65 26.786632390745503 25.51413881748072 23.187660668380463 24.511568123393314 66-67 26.61611618043953 26.34622799126076 22.811977894872122 24.22567793342758 68-69 26.394243125160628 26.50989462863017 23.091750192752507 24.004112053456694 70-71 26.962676962676962 25.37966537966538 23.680823680823682 23.976833976833976 72-73 25.874757908327954 26.132989025177533 24.299548095545514 23.692704970949 74-75 26.461370758958985 23.109415451696417 25.139664804469277 25.289548984875328 76 29.054573405073018 0.0 34.70407378939277 36.241352805534206 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 106.0 1 54.0 2 1.0 3 0.5 4 1.0 5 1.5 6 1.5 7 1.5 8 2.0 9 1.0 10 1.0 11 2.0 12 2.0 13 2.0 14 3.0 15 2.5 16 1.0 17 1.5 18 10.0 19 16.5 20 13.5 21 12.0 22 17.0 23 17.0 24 17.5 25 24.5 26 25.0 27 21.5 28 25.5 29 30.5 30 37.5 31 44.5 32 44.0 33 42.5 34 47.5 35 65.5 36 76.0 37 80.0 38 91.5 39 97.0 40 109.5 41 128.0 42 146.0 43 152.5 44 141.5 45 150.5 46 170.5 47 169.0 48 160.0 49 157.5 50 156.0 51 149.0 52 136.0 53 130.5 54 137.0 55 147.0 56 136.5 57 126.0 58 132.0 59 138.0 60 135.5 61 131.0 62 121.0 63 102.0 64 87.5 65 78.0 66 67.0 67 60.5 68 65.5 69 66.5 70 60.5 71 60.5 72 59.5 73 55.0 74 44.5 75 33.5 76 31.5 77 25.0 78 16.0 79 14.0 80 13.0 81 6.5 82 4.0 83 5.0 84 4.0 85 2.0 86 1.5 87 2.0 88 1.5 89 1.0 90 1.0 91 1.0 92 1.0 93 0.5 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5 2 2.5 3 2.475 4 2.475 5 2.475 6 2.475 7 2.5 8 2.475 9 2.5 10-11 2.5250000000000004 12-13 2.5749999999999997 14-15 2.7125 16-17 2.6875 18-19 2.5875 20-21 2.675 22-23 2.6625 24-25 2.6 26-27 2.675 28-29 2.6625 30-31 2.675 32-33 2.7 34-35 2.6625 36-37 0.19230769230769232 38-39 0.2052334530528476 40-41 0.1924557351809084 42-43 0.21811649987169618 44-45 0.15396458814472672 46-47 0.1411342057993328 48-49 0.16679497049012063 50-51 0.15396458814472672 52-53 0.08981267641775725 54-55 0.07701193685021178 56-57 0.07702182284980745 58-59 0.14120667522464697 60-61 0.19255455712451863 62-63 0.10269576379974327 64-65 0.11554756708178199 66-67 0.08988186954288649 68-69 0.07704160246533129 70-71 0.1798561151079137 72-73 0.10318586353669547 74-75 0.14965986394557823 76 0.11516314779270634 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 99.0 36 2.0 37 0.0 38 2.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 1.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 1.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 4.0 71 6.0 72 15.0 73 55.0 74 278.0 75 931.0 76 2605.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.2 #Duplication Level Percentage of deduplicated Percentage of total 1 96.52928416485899 89.0 2 2.304772234273319 4.25 3 0.6507592190889371 1.7999999999999998 4 0.2440347071583514 0.8999999999999999 5 0.10845986984815618 0.5 6 0.027114967462039046 0.15 7 0.05422993492407809 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.05422993492407809 0.575 >50 0.027114967462039046 2.475 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 99 2.475 No Hit TGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTTCGCGCCGGTAGAT 12 0.3 No Hit GGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACA 11 0.27499999999999997 No Hit CTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTG 7 0.17500000000000002 No Hit AAATTATCCGAGCAGCTTGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCG 7 0.17500000000000002 No Hit GGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTT 6 0.15 No Hit GCTTGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTTCGCGCCGGT 5 0.125 No Hit AGGCGATCAAATTCGAGTTCGCGCCGGTAGATACTATCGATTAATAGATA 5 0.125 No Hit GGTAGATACTATCGATTAATAGATAAAACTAAATATGAAGAAGGTCTAAATAAAAAGAAACAAAATAAAAAGAGA 5 0.125 No Hit GATTAATAGATAAAACTAAATATGAAGAAGGTCTAAATAAAAAGAAACAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 57 0.05 0.0 0.0 0.0 0.0 58 0.05 0.0 0.0 0.0 0.0 59 0.05 0.0 0.0 0.0 0.0 60 0.05 0.0 0.0 0.0 0.0 61 0.05 0.0 0.0 0.0 0.0 62 0.05 0.0 0.0 0.0 0.0 63 0.05 0.0 0.0 0.0 0.0 64 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 771046 spots for SRR11389774.sra Written 771046 spots for SRR11389774.sra Read 771046 spots for SRR11389774.sra Written 771046 spots for SRR11389774.sra Read 771046 spots for SRR11389774.sra Written 771046 spots for SRR11389774.sra Read 771046 spots for SRR11389774.sra Written 771046 spots for SRR11389774.sra Read 771046 spots for SRR11389774.sra Written 771046 spots for SRR11389774.sra Read 771050 spots for SRR11389774.sra Written 771050 spots for SRR11389774.sra Read 771046 spots for SRR11389774.sra Written 771046 spots for SRR11389774.sra Read 771046 spots for SRR11389774.sra Written 771046 spots for SRR11389774.sra Read 771046 spots for SRR11389774.sra Written 771046 spots for SRR11389774.sra Read 771046 spots for SRR11389774.sra Written 771046 spots for SRR11389774.sra Read 771046 spots for SRR11389774.sra Written 771046 spots for SRR11389774.sra Read 771046 spots for SRR11389774.sra Written 771046 spots for SRR11389774.sra Read 771046 spots for SRR11389774.sra Written 771046 spots for SRR11389774.sra Read 771046 spots for SRR11389774.sra Written 771046 spots for SRR11389774.sra Read 771046 spots for SRR11389774.sra Written 771046 spots for SRR11389774.sra Read 771046 spots for SRR11389774.sra Written 771046 spots for SRR11389774.sra Read 771046 spots for SRR11389774.sra Written 771046 spots for SRR11389774.sra Read 771046 spots for SRR11389774.sra Written 771046 spots for SRR11389774.sra Read 771046 spots for SRR11389774.sra Written 771046 spots for SRR11389774.sra Read 771046 spots for SRR11389774.sra Written 771046 spots for SRR11389774.sra SRR ids: ['SRR11389774.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8qaedi2z SRR11389774.sra spots: 15420924 blocks: [[1, 771046], [771047, 1542092], [1542093, 2313138], [2313139, 3084184], [3084185, 3855230], [3855231, 4626276], [4626277, 5397322], [5397323, 6168368], [6168369, 6939414], [6939415, 7710460], [7710461, 8481506], [8481507, 9252552], [9252553, 10023598], [10023599, 10794644], [10794645, 11565690], [11565691, 12336736], [12336737, 13107782], [13107783, 13878828], [13878829, 14649874], [14649875, 15420924]] SRR11389774 file size 2900359 SRR11389774 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389774 SRR11389774_1.fastq SRR11389774_2.fastq Input file: SRR11389774_1.fastq Paired file: SRR11389774_2.fastq trimmed: SRR11389774-trimmed-pair1.fastq, SRR11389774-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 05:44:09 2024 >> started Sat Dec 7 05:46:00 2024 >> done (111.081s) 15420924 read pairs processed; of these: 607 ( 0.00%) short read pairs filtered out after trimming by size control 417223 ( 2.71%) empty read pairs filtered out after trimming by size control 15003094 (97.29%) read pairs available; of these: 43653 ( 0.29%) trimmed read pairs available after processing 14959441 (99.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 829 0.01% 19 60 0.00% 20 1476 0.01% 21 66 0.00% 22 1834 0.01% 23 76 0.00% 24 2227 0.01% 25 76 0.00% 26 2420 0.02% 27 102 0.00% 28 2426 0.02% 29 90 0.00% 30 2198 0.01% 31 97 0.00% 32 1898 0.01% 33 58 0.00% 34 1577 0.01% 35 146 0.00% 36 4386 0.03% 37 127 0.00% 38 2561 0.02% 39 138 0.00% 40 1342 0.01% 41 143 0.00% 42 666 0.00% 43 143 0.00% 44 436 0.00% 45 136 0.00% 46 268 0.00% 47 135 0.00% 48 274 0.00% 49 154 0.00% 50 247 0.00% 51 221 0.00% 52 266 0.00% 53 235 0.00% 54 262 0.00% 55 513 0.00% 56 1823 0.01% 57 1587 0.01% 58 957 0.01% 59 691 0.00% 60 761 0.01% 61 615 0.00% 62 616 0.00% 63 793 0.01% 64 947 0.01% 65 762 0.01% 66 960 0.01% 67 976 0.01% 68 1042 0.01% 69 1130 0.01% 70 1661 0.01% 71 3212 0.02% 72 17946 0.12% 73 140940 0.94% 74 1085001 7.23% 75 6866302 45.77% 76 6844063 45.62% 15003094 reads passed initial QC criterion=sequence-density sequence-density=1.08 sequence-density-rank=1 fanout-score=1.83 fanout-score-rank=27 prefix-density=0.06 prefix-fanout=1.8 sequence=GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTTCTCTTTTTATTTTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=21.24 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.5 sequence=GAAAAATAATGCCTAAATTCTAAACGAAAGTAGAAGCTCAAGGCCTTATTAATTTCATTATCTCTTCCATTCCATGGACCCGAGAATGCCAATATTAGCACGAATCGTACGGAAATGTAACTCGGTATTCAAACAACTATTCAGAGTTCCTAGAGCTCCTTGTACGGCCTGCTGGAAAACCCGTTGTCGGACCTGATTCATTGCCCTTTGTTTTTCAAAATAAAGGGTTTCGTTTTTAGACTTTTCTAATTGTTCCAAACTAATAGAAGTAGCATTAATCAAATTTTCTTTTTCTCGTTCTATCTCAGAGTATCCATTCATTCGATACTCATCCGCTTCTAGTTCGACTTTCTGTAATCGAATCCGAGCTTTTTCGAGCTGCTCAAAGGTCCCTCTACGCAATTCTTCCGAATTTCGAATAGTACTCAAGATCCTCTGTTTTCGATTATCTAATAAATCTTTTAATGAAAGTAGATTATCTTGCTATTAAGTTTACAACTTTTATGATCTC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=17 prefix-density=0.68 prefix-fanout=2.3 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=14.60 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.7 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC SRR11389774 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 05:50:26 Started mapping on | Dec 07 05:50:27 Finished on | Dec 07 06:13:21 Mapping speed, Million of reads per hour | 39.31 Number of input reads | 15003094 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 11294714 Uniquely mapped reads % | 75.28% Average mapped length | 150.02 Number of splices: Total | 3533617 Number of splices: Annotated (sjdb) | 3342102 Number of splices: GT/AG | 3484711 Number of splices: GC/AG | 40981 Number of splices: AT/AC | 994 Number of splices: Non-canonical | 6931 Mismatch rate per base, % | 0.99% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.01% Insertion average length | 1.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2433498 % of reads mapped to multiple loci | 16.22% Number of reads mapped to too many loci | 101899 % of reads mapped to too many loci | 0.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.33% % of reads unmapped: other | 3.49% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1274910 1274910 1274910 N_multimapping 2433498 2433498 2433498 N_noFeature 596905 10924802 698093 N_ambiguous 437248 2681 190948 UnstrandedReadsAssigned:10260561 PositiveStrandReadsAssigned:367231 NegativeStrandReadsAssigned:10405673 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389774 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389774-trimmed-pair1.fastq SRR11389774-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,003,094 reads, 12,520,215 reads pseudoaligned [quant] estimated average fragment length: 202.719 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,117 rounds 52973 SRR11389774.ke.tsv 35125 SRR11389774.se.tsv 88098 total ==> SRR11389774.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 734.377 21.5058 2.75821 PNS24247 1044 842.281 2.84225 0.317831 PNS24249 1928 1726.28 40.3901 2.2037 PNS24246 1044 842.281 2.84225 0.317831 PNS24248 1044 842.281 2.84225 0.317831 PNS24244 1471 1269.28 96.5773 7.1665 PNS24243 293 104.636 0 0 KQK14069 1603 1401.28 3503.9 235.514 KQK14071 474 273.818 155.036 53.3285 ==> SRR11389774.se.tsv <== BRADI_1g14170v3 3815 BRADI_1g53295v3 7 BRADI_1g59795v3 227 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 111 BRADI_1g74790v3 132 BRADI_1g09890v3 0 BRADI_1g77505v3 184 BRADI_1g48960v3 0 SRR11389774 completed mapping pipeline successfully