Starting /dee2/code/volunteer_pipeline.sh SRR11389776 current disk space = 1545736028160 free memory = 1603589448 SRR11389776 SRAfilesize 8afb9d3d0a1d41a7761d306cf10355a0 SRR11389776.sra SRR11389776.sra file validated SRR11389776 is paired end SRR11389776 is conventional basespace SRR11389776 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389776_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.14325 32.0 32.0 32.0 32.0 32.0 2 31.135 32.0 32.0 32.0 32.0 32.0 3 31.0785 32.0 32.0 32.0 32.0 32.0 4 31.19975 32.0 32.0 32.0 32.0 32.0 5 31.1645 32.0 32.0 32.0 32.0 32.0 6 34.252 36.0 36.0 36.0 32.0 36.0 7 34.23325 36.0 36.0 36.0 32.0 36.0 8 34.02575 36.0 36.0 36.0 32.0 36.0 9 34.1745 36.0 36.0 36.0 32.0 36.0 10-11 34.0985 36.0 36.0 36.0 32.0 36.0 12-13 34.178250000000006 36.0 36.0 36.0 32.0 36.0 14-15 34.108 36.0 36.0 36.0 32.0 36.0 16-17 34.101875 36.0 36.0 36.0 32.0 36.0 18-19 34.15675 36.0 36.0 36.0 32.0 36.0 20-21 33.960499999999996 36.0 36.0 36.0 32.0 36.0 22-23 34.056124999999994 36.0 36.0 36.0 32.0 36.0 24-25 33.937 36.0 36.0 36.0 32.0 36.0 26-27 33.6305 36.0 36.0 36.0 29.5 36.0 28-29 33.84162499999999 36.0 36.0 36.0 32.0 36.0 30-31 33.52975 36.0 36.0 36.0 29.5 36.0 32-33 33.405625 36.0 36.0 36.0 24.0 36.0 34-35 33.309625 36.0 36.0 36.0 24.0 36.0 36-37 33.589917231000754 36.0 36.0 36.0 27.0 36.0 38-39 33.43303235515425 36.0 36.0 36.0 24.0 36.0 40-41 33.17883120140456 36.0 36.0 36.0 17.5 36.0 42-43 33.26874843240532 36.0 36.0 36.0 17.5 36.0 44-45 33.22215253386854 36.0 36.0 36.0 17.5 36.0 46-47 33.14927245358756 36.0 36.0 36.0 17.5 36.0 48-49 32.89563472152534 36.0 36.0 36.0 14.0 36.0 50-51 32.94355243351731 36.0 36.0 36.0 14.0 36.0 52-53 32.63008028098344 36.0 36.0 36.0 14.0 36.0 54-55 32.632714500752634 36.0 34.0 36.0 14.0 36.0 56-57 32.39701455092825 36.0 32.0 36.0 14.0 36.0 58-59 32.344455594581035 36.0 34.0 36.0 14.0 36.0 60-61 32.29661229611041 36.0 32.0 36.0 14.0 36.0 62-63 31.92568519748086 36.0 32.0 36.0 14.0 36.0 64-65 31.75781462561426 36.0 32.0 36.0 14.0 36.0 66-67 31.34017517198865 36.0 32.0 36.0 14.0 36.0 68-69 31.471830985915496 36.0 32.0 36.0 14.0 36.0 70-71 31.562701839970643 36.0 32.0 36.0 14.0 36.0 72-73 31.176404321756607 36.0 32.0 36.0 14.0 36.0 74-75 31.113395652942117 36.0 32.0 36.0 14.0 36.0 76 30.37532612746925 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 5.0 24 12.0 25 25.0 26 43.0 27 73.0 28 139.0 29 179.0 30 218.0 31 351.0 32 528.0 33 732.0 34 1058.0 35 621.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.75746175068974 12.791572610985705 11.763230499122148 34.68773513920241 2 24.70529219964886 15.073990469024329 34.5623275645849 25.658389766741912 3 22.297466766992727 21.068472535741158 23.6518685728618 32.982192124404314 4 28.36719337848006 26.536242789064456 21.11863556558816 23.97792826686732 5 25.232004013042385 30.474040632054177 22.573363431151243 21.720591923752195 6 22.247303737145725 31.10107850514171 26.285427639829447 20.36619011788312 7 16.804614998745922 23.526460998244296 38.87634813142714 20.792575871582645 8 18.811136192626034 22.92450464008026 31.60270880361174 26.661650363681964 9 20.566842237271132 21.720591923752195 32.004013042387754 25.70855279658891 10-11 22.134436919989966 30.912967143215454 22.623526460998246 24.329069475796338 12-13 23.501379483320793 23.187860546777024 26.3481314271382 26.962628542763984 14-15 22.962126912465514 25.62076749435666 27.577125658389768 23.83997993478806 16-17 23.47629796839729 25.859041886129923 25.79633809882117 24.868322046651617 18-19 22.824178580386256 25.09405568096313 26.373212942061702 25.70855279658891 20-21 23.350890393779782 26.56132430398796 25.64584900928016 24.441936292952093 22-23 22.698771005768748 25.79633809882117 26.586405818911462 24.91848507649862 24-25 23.526460998244296 25.859041886129923 25.232004013042385 25.382493102583396 26-27 22.94958615500376 25.93428643090043 25.896664158515176 25.21946325558064 28-29 23.27564584900928 25.018811136192625 26.21018309505894 25.49535991973915 30-31 23.125156759468272 24.680210684725356 27.263606721846003 24.931025833960373 32-33 22.89942312515676 26.02207173313268 26.21018309505894 24.868322046651617 34-35 22.711311763230498 25.595685979433156 26.02207173313268 25.670930524203662 36-37 22.94958615500376 25.984449460747427 25.833960371206423 25.232004013042385 38-39 22.37271131176323 25.658389766741912 26.122397792826686 25.84650112866817 40-41 22.573363431151243 25.42011537496865 26.624028091296715 25.382493102583396 42-43 23.66440933032355 24.36669174818159 26.297968397291193 25.670930524203662 44-45 23.36929252383342 24.27245358755645 26.894129453085803 25.464124435524337 46-47 23.381836427496236 25.301053687907675 25.652282990466635 25.664826894129455 48-49 23.05569493226292 24.836929252383342 26.367285499247366 25.74009031610637 50-51 23.03060712493728 24.460612142498743 25.89061716006021 26.61816357250376 52-53 22.930255895634723 25.11289513296538 26.003512293025587 25.95333667837431 54-55 22.958223560406473 25.1411366202484 26.1698657633923 25.730774055952825 56-57 22.892624184646262 25.200702458605118 26.05368790767687 25.852985449071753 58-59 23.09332664325138 25.288509784244855 26.103863522328147 25.514300050175613 60-61 22.961104140526974 25.395232120451695 26.03513174404015 25.60853199498118 62-63 23.336680893798643 24.8807431584233 27.02736630680392 24.75520964097414 64-65 24.051745792514442 24.541572469228836 25.91057523235368 25.496106505903036 66-67 23.121387283236995 24.654435787886403 26.049258607690373 26.17491832118623 68-69 23.96881287726358 23.717303822937627 26.483903420523134 25.829979879275655 70-71 23.581939378694504 25.103760533266257 25.455917494654763 25.858382593384484 72-73 23.998483508151143 24.46606849488184 25.982560343738154 25.55288765322886 74-75 24.4944119212347 22.325705162320382 26.330494944119216 26.849387972325705 76 26.723816623183005 0.0 37.122623928438315 36.15355944837868 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 13.0 1 6.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 2.5 17 4.0 18 10.0 19 17.5 20 22.5 21 25.5 22 29.5 23 23.5 24 16.0 25 20.5 26 24.5 27 34.5 28 39.0 29 36.5 30 38.5 31 54.0 32 72.5 33 75.0 34 73.0 35 81.5 36 96.5 37 110.5 38 123.5 39 133.0 40 138.0 41 150.0 42 166.0 43 177.0 44 181.0 45 189.5 46 202.5 47 184.5 48 161.5 49 155.0 50 151.0 51 135.0 52 126.5 53 128.5 54 117.5 55 132.5 56 139.0 57 111.0 58 97.5 59 103.5 60 127.5 61 118.0 62 89.5 63 81.0 64 72.0 65 72.5 66 71.0 67 66.5 68 57.0 69 50.0 70 48.5 71 48.0 72 39.5 73 31.0 74 28.0 75 22.5 76 21.0 77 23.0 78 22.0 79 16.5 80 9.5 81 7.5 82 7.5 83 4.5 84 3.5 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.325 3 0.325 4 0.325 5 0.325 6 0.325 7 0.325 8 0.325 9 0.325 10-11 0.325 12-13 0.325 14-15 0.325 16-17 0.325 18-19 0.325 20-21 0.325 22-23 0.325 24-25 0.325 26-27 0.325 28-29 0.325 30-31 0.325 32-33 0.325 34-35 0.325 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.012543903662819869 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.012551776076314799 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 13.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 1.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 1.0 60 0.0 61 1.0 62 1.0 63 1.0 64 2.0 65 0.0 66 2.0 67 2.0 68 0.0 69 0.0 70 1.0 71 10.0 72 17.0 73 54.0 74 272.0 75 939.0 76 2683.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.21638655462185 92.55 2 1.9432773109243697 3.6999999999999997 3 0.4726890756302521 1.35 4 0.13130252100840337 0.5 5 0.10504201680672269 0.5 6 0.0 0.0 7 0.026260504201680673 0.17500000000000002 8 0.026260504201680673 0.2 9 0.026260504201680673 0.22499999999999998 >10 0.052521008403361345 0.8 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 19 0.475 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 13 0.325 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 9 0.22499999999999998 No Hit GAAGAATTACTGCATTTCGTAACTTATTTTTTCTCTTTTTATTTTGTTTC 8 0.2 No Hit AGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTTCTCTTTT 7 0.17500000000000002 No Hit CGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATTTC 5 0.125 No Hit CCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATTT 5 0.125 No Hit GAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTGAGCTGAC 5 0.125 No Hit GAAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389776 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389776_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.411 32.0 32.0 32.0 32.0 32.0 2 30.08675 32.0 32.0 32.0 21.0 32.0 3 29.80975 32.0 32.0 32.0 21.0 32.0 4 29.878 32.0 32.0 32.0 21.0 32.0 5 29.96925 32.0 32.0 32.0 21.0 32.0 6 32.67825 36.0 36.0 36.0 14.0 36.0 7 32.91575 36.0 36.0 36.0 14.0 36.0 8 32.957 36.0 36.0 36.0 21.0 36.0 9 32.9225 36.0 36.0 36.0 21.0 36.0 10-11 32.87125 36.0 36.0 36.0 14.0 36.0 12-13 32.891 36.0 36.0 36.0 17.5 36.0 14-15 32.544375 36.0 36.0 36.0 14.0 36.0 16-17 32.576875 36.0 36.0 36.0 14.0 36.0 18-19 32.52975 36.0 36.0 36.0 14.0 36.0 20-21 32.46625 36.0 34.0 36.0 14.0 36.0 22-23 32.475875 36.0 36.0 36.0 14.0 36.0 24-25 32.465 36.0 36.0 36.0 14.0 36.0 26-27 32.305875 36.0 34.0 36.0 14.0 36.0 28-29 32.18675 36.0 32.0 36.0 14.0 36.0 30-31 32.15112499999999 36.0 32.0 36.0 14.0 36.0 32-33 32.02225 36.0 32.0 36.0 14.0 36.0 34-35 31.9935 36.0 34.0 36.0 14.0 36.0 36-37 32.1435581278309 36.0 32.0 36.0 14.0 36.0 38-39 32.10117931163689 36.0 32.0 36.0 14.0 36.0 40-41 31.92587465391392 36.0 32.0 36.0 14.0 36.0 42-43 31.813365215202616 36.0 32.0 36.0 14.0 36.0 44-45 31.70808157099698 36.0 32.0 36.0 14.0 36.0 46-47 31.715130916414903 36.0 32.0 36.0 14.0 36.0 48-49 31.556394763343405 36.0 32.0 36.0 14.0 36.0 50-51 31.35322255790534 36.0 32.0 36.0 14.0 36.0 52-53 31.19511581067472 36.0 32.0 36.0 14.0 36.0 54-55 30.90647029204431 36.0 32.0 36.0 14.0 36.0 56-57 30.973690835850956 36.0 32.0 36.0 14.0 36.0 58-59 30.426863041289025 36.0 27.0 36.0 14.0 36.0 60-61 30.624150088139007 36.0 29.5 36.0 14.0 36.0 62-63 30.362252354995547 36.0 27.0 36.0 14.0 36.0 64-65 30.34837804808615 36.0 27.0 36.0 14.0 36.0 66-67 29.980930500680756 36.0 27.0 36.0 14.0 36.0 68-69 29.94309866262932 36.0 27.0 36.0 14.0 36.0 70-71 29.76818789349183 36.0 27.0 36.0 14.0 36.0 72-73 29.66634492952044 36.0 27.0 36.0 14.0 36.0 74-75 29.51618758465235 36.0 24.0 36.0 14.0 36.0 76 28.63752825923135 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 1.0 4 0.0 5 3.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 2.0 13 2.0 14 0.0 15 4.0 16 3.0 17 9.0 18 7.0 19 10.0 20 8.0 21 17.0 22 24.0 23 39.0 24 53.0 25 69.0 26 121.0 27 159.0 28 188.0 29 274.0 30 353.0 31 440.0 32 544.0 33 643.0 34 672.0 35 327.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.35581278309008 19.325616507297433 10.241570206341217 31.07700050327126 2 30.14594866633115 24.257674886763965 27.679919476597885 17.916456970306996 3 25.188726723704075 29.54202315047811 20.93608454957222 24.333165576245598 4 30.85052843482637 31.328636134876696 17.413185707096122 20.407649723200805 5 29.089079013588325 32.15903371917464 18.87267237040765 19.879214896829392 6 23.27629592350277 34.65022647206845 21.036738802214394 21.036738802214394 7 22.954945884721873 18.122325698464635 33.90385099421092 25.01887742260257 8 24.786109713135378 22.72269753397081 24.35832913940614 28.132863613487668 9 26.221662468513856 21.712846347607055 24.408060453400505 27.657430730478588 10-11 28.609221466364325 28.130511463844798 19.601914840010078 23.658352229780803 12-13 27.52709856314595 21.704058482480466 23.342576254096294 27.426266700277285 14-15 26.02324406265791 25.606366851945427 24.456796361798887 23.913592723597777 16-17 28.10564893213699 23.707822570453686 22.86111462150891 25.325413875900416 18-19 26.10340479192938 25.346784363177804 23.87137452711223 24.67843631778058 20-21 27.42301867743564 25.643614336193842 22.905098435133773 24.02826855123675 22-23 26.73904809998738 24.870597146824895 23.50713293776038 24.883221815427344 24-25 26.712069617858493 24.416698196493883 22.903266490099632 25.96796569554799 26-27 26.94104279762656 25.362959222320413 23.10314354248201 24.592854437571013 28-29 27.35646687697161 25.05993690851735 23.09148264984227 24.49211356466877 30-31 25.98763094787328 26.113845765492872 22.89536791619336 25.00315537044049 32-33 26.657406238161386 24.864250536683922 23.311024119206973 25.167319105947723 34-35 27.33240752430249 26.133064007069812 22.560282792576693 23.974245676051005 36-37 26.274608783442705 25.429076224129226 22.741039878849065 25.555275113579 38-39 26.20280338426569 25.45775981815886 23.298396262154313 25.04104053542114 40-41 26.224747474747474 25.643939393939398 23.08080808080808 25.050505050505052 42-43 26.39555443293761 25.625157868148523 22.78353119474615 25.195756504167722 44-45 26.529582439762834 26.17635927841554 22.770278793995207 24.523779487826417 46-47 27.271580010095914 25.69409389197375 22.57698132256436 24.45734477536598 48-49 26.186868686868685 24.507575757575758 23.69949494949495 25.606060606060606 50-51 25.961902359026112 25.242840923426265 24.019174971615996 24.776081745931627 52-53 26.065036551550293 25.71212503150996 23.50642803125788 24.716410385681876 54-55 28.10844892812106 25.031525851197983 22.78688524590164 24.07313997477932 56-57 26.449823499747854 26.638930912758447 23.33585476550681 23.57539082198689 58-59 26.968702675416456 26.224129227662797 22.513881877839477 24.293286219081274 60-61 26.853606163950992 25.514715169887587 22.495894909688012 25.135783756473412 62-63 26.691065118626955 25.567895002523976 23.662291771832408 24.078748107016658 64-65 26.89149930529241 25.211570039156246 22.83693318176077 25.05999747379058 66-67 27.320954907161806 24.883162814197295 23.43059239610964 24.365289882531265 68-69 26.175429726996967 25.0 23.90040444893832 24.924165824064712 70-71 28.070841239721695 25.616698292220114 22.593295382669197 23.719165085388994 72-73 26.66497203863752 24.631418403660398 23.716319267920692 24.987290289781395 74-75 27.133775192749898 21.790883267956175 25.36182875693223 25.71351278236169 76 30.539826349565875 0.0 32.804832012080034 36.655341638354095 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 27.0 1 14.5 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.5 8 1.0 9 1.0 10 1.5 11 1.0 12 0.0 13 0.0 14 1.0 15 1.5 16 1.5 17 3.0 18 8.5 19 10.5 20 7.0 21 9.5 22 14.0 23 13.0 24 14.0 25 17.0 26 18.5 27 23.0 28 31.0 29 33.5 30 40.0 31 47.5 32 47.5 33 46.0 34 46.5 35 60.5 36 75.0 37 80.5 38 87.0 39 107.5 40 120.5 41 127.0 42 135.0 43 152.0 44 177.5 45 172.5 46 169.0 47 171.0 48 161.0 49 162.5 50 165.5 51 150.0 52 142.5 53 138.5 54 125.0 55 133.5 56 141.5 57 133.0 58 128.0 59 125.0 60 129.5 61 124.5 62 115.5 63 110.0 64 98.0 65 86.5 66 77.0 67 78.0 68 78.5 69 71.0 70 63.0 71 62.5 72 66.5 73 59.0 74 45.5 75 40.5 76 34.5 77 27.0 78 21.5 79 17.5 80 14.5 81 14.0 82 10.0 83 4.0 84 3.5 85 2.5 86 1.5 87 2.0 88 1.0 89 0.5 90 0.5 91 0.0 92 0.0 93 1.5 94 1.5 95 0.0 96 0.0 97 0.0 98 0.5 99 1.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.65 3 0.65 4 0.65 5 0.65 6 0.65 7 0.675 8 0.65 9 0.75 10-11 0.775 12-13 0.8250000000000001 14-15 1.05 16-17 1.0875 18-19 0.8750000000000001 20-21 0.95 22-23 0.9875 24-25 0.8875 26-27 0.9875 28-29 0.9375 30-31 0.9625 32-33 1.0125 34-35 0.9875 36-37 0.3019627579265224 38-39 0.3523342141688688 40-41 0.32720865844450037 42-43 0.3523785552479235 44-45 0.21399798590130917 46-47 0.25176233635448136 48-49 0.3021148036253776 50-51 0.21399798590130917 52-53 0.12588116817724068 54-55 0.17623363544813697 56-57 0.1510574018126888 58-59 0.25176233635448136 60-61 0.3147821707378494 62-63 0.18894067262879455 64-65 0.2142677085959163 66-67 0.176522506619594 68-69 0.17663386323492303 70-71 0.2523659305993691 72-73 0.17761989342806395 74-75 0.28324790936066896 76 0.18839487565938207 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 26.0 36 0.0 37 0.0 38 1.0 39 0.0 40 0.0 41 0.0 42 0.0 43 1.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 1.0 60 0.0 61 1.0 62 1.0 63 1.0 64 2.0 65 0.0 66 1.0 67 2.0 68 0.0 69 0.0 70 1.0 71 8.0 72 26.0 73 76.0 74 290.0 75 908.0 76 2654.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.8 #Duplication Level Percentage of deduplicated Percentage of total 1 97.52087682672233 93.425 2 1.80062630480167 3.45 3 0.44363256784968685 1.275 4 0.07828810020876827 0.3 5 0.052192066805845504 0.25 6 0.0 0.0 7 0.0 0.0 8 0.052192066805845504 0.4 9 0.0 0.0 >10 0.052192066805845504 0.8999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 26 0.65 No Hit AAATTATCCGAGCAGCTTGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCG 10 0.25 No Hit CTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTG 8 0.2 No Hit GGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACA 8 0.2 No Hit CTTTTTCACTCAGGACTGGGTATCCATGCCAGGTGTTATACCAGTAGCTT 5 0.125 No Hit GAAGGGGAACGCGAAATCACTTTAGGTTTTGTTGATTTATTGCGCGACGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1232104 spots for SRR11389776.sra Written 1232104 spots for SRR11389776.sra Read 1232104 spots for SRR11389776.sra Written 1232104 spots for SRR11389776.sra Read 1232104 spots for SRR11389776.sra Written 1232104 spots for SRR11389776.sra Read 1232104 spots for SRR11389776.sra Written 1232104 spots for SRR11389776.sra Read 1232104 spots for SRR11389776.sra Written 1232104 spots for SRR11389776.sra Read 1232104 spots for SRR11389776.sra Written 1232104 spots for SRR11389776.sra Read 1232104 spots for SRR11389776.sra Written 1232104 spots for SRR11389776.sra Read 1232104 spots for SRR11389776.sra Written 1232104 spots for SRR11389776.sra Read 1232104 spots for SRR11389776.sra Written 1232104 spots for SRR11389776.sra Read 1232104 spots for SRR11389776.sra Written 1232104 spots for SRR11389776.sra Read 1232104 spots for SRR11389776.sra Written 1232104 spots for SRR11389776.sra Read 1232105 spots for SRR11389776.sra Written 1232105 spots for SRR11389776.sra Read 1232104 spots for SRR11389776.sra Written 1232104 spots for SRR11389776.sra Read 1232104 spots for SRR11389776.sra Written 1232104 spots for SRR11389776.sra Read 1232104 spots for SRR11389776.sra Written 1232104 spots for SRR11389776.sra Read 1232104 spots for SRR11389776.sra Written 1232104 spots for SRR11389776.sra Read 1232104 spots for SRR11389776.sra Written 1232104 spots for SRR11389776.sra Read 1232104 spots for SRR11389776.sra Written 1232104 spots for SRR11389776.sra Read 1232104 spots for SRR11389776.sra Written 1232104 spots for SRR11389776.sra Read 1232104 spots for SRR11389776.sra Written 1232104 spots for SRR11389776.sra SRR ids: ['SRR11389776.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_60epaka0 SRR11389776.sra spots: 24642081 blocks: [[1, 1232104], [1232105, 2464208], [2464209, 3696312], [3696313, 4928416], [4928417, 6160520], [6160521, 7392624], [7392625, 8624728], [8624729, 9856832], [9856833, 11088936], [11088937, 12321040], [12321041, 13553144], [13553145, 14785248], [14785249, 16017352], [16017353, 17249456], [17249457, 18481560], [18481561, 19713664], [19713665, 20945768], [20945769, 22177872], [22177873, 23409976], [23409977, 24642081]] SRR11389776 file size 4687881 SRR11389776 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389776 SRR11389776_1.fastq SRR11389776_2.fastq Input file: SRR11389776_1.fastq Paired file: SRR11389776_2.fastq trimmed: SRR11389776-trimmed-pair1.fastq, SRR11389776-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:06:13 2024 >> started Sat Dec 7 06:06:43 2024 >> done (29.238s) 24642081 read pairs processed; of these: 528 ( 0.00%) short read pairs filtered out after trimming by size control 135061 ( 0.55%) empty read pairs filtered out after trimming by size control 24506492 (99.45%) read pairs available; of these: 19891 ( 0.08%) trimmed read pairs available after processing 24486601 (99.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 140 0.00% 19 21 0.00% 20 194 0.00% 21 16 0.00% 22 286 0.00% 23 25 0.00% 24 328 0.00% 25 12 0.00% 26 427 0.00% 27 13 0.00% 28 423 0.00% 29 18 0.00% 30 420 0.00% 31 13 0.00% 32 353 0.00% 33 6 0.00% 34 254 0.00% 35 188 0.00% 36 988 0.00% 37 231 0.00% 38 572 0.00% 39 214 0.00% 40 424 0.00% 41 245 0.00% 42 360 0.00% 43 336 0.00% 44 437 0.00% 45 421 0.00% 46 483 0.00% 47 489 0.00% 48 552 0.00% 49 561 0.00% 50 596 0.00% 51 648 0.00% 52 777 0.00% 53 806 0.00% 54 872 0.00% 55 1237 0.01% 56 1577 0.01% 57 1482 0.01% 58 1558 0.01% 59 1555 0.01% 60 1729 0.01% 61 1788 0.01% 62 2041 0.01% 63 2211 0.01% 64 2656 0.01% 65 2541 0.01% 66 2789 0.01% 67 3060 0.01% 68 3143 0.01% 69 3400 0.01% 70 4342 0.02% 71 7003 0.03% 72 30168 0.12% 73 220184 0.90% 74 1717958 7.01% 75 11054880 45.11% 76 11426041 46.62% 24506492 reads passed initial QC criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=26 prefix-density=0.87 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=141.45 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=8.9 sequence=TCTTTTTTTTAAGTAATGAGCCTATCCTCTCTCTTCTATTTTATCTTTCTATTTCAATATACTGAAACCTATATAAGATTAGATAAATATTAAGAGGACTCTTCCGCCTAGATAAAAATCTATCATGGTCAGCAAAGTTGTTTCTTTATTTGTATTTGCACTTTACTTAAGAATTTCAATTTCATTAAGAAAAACTAACGAAATAAATAGAAAATGAATCGAAGTCTTTTTTTTCTT criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=18 prefix-density=0.61 prefix-fanout=2.4 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=33.56 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.4 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC SRR11389776 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:07:10 Started mapping on | Dec 07 06:07:11 Finished on | Dec 07 06:09:16 Mapping speed, Million of reads per hour | 705.79 Number of input reads | 24506492 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 19171041 Uniquely mapped reads % | 78.23% Average mapped length | 149.90 Number of splices: Total | 6409598 Number of splices: Annotated (sjdb) | 6053561 Number of splices: GT/AG | 6324410 Number of splices: GC/AG | 71575 Number of splices: AT/AC | 1549 Number of splices: Non-canonical | 12064 Mismatch rate per base, % | 1.19% Deletion rate per base | 0.01% Deletion average length | 1.65 Insertion rate per base | 0.01% Insertion average length | 1.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3878610 % of reads mapped to multiple loci | 15.83% Number of reads mapped to too many loci | 75735 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.81% % of reads unmapped: other | 1.83% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1456886 1456886 1456886 N_multimapping 3878610 3878610 3878610 N_noFeature 998509 18531001 1185522 N_ambiguous 736511 4514 317532 UnstrandedReadsAssigned:17436021 PositiveStrandReadsAssigned:635526 NegativeStrandReadsAssigned:17667987 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389776 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389776-trimmed-pair1.fastq SRR11389776-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,506,492 reads, 21,074,772 reads pseudoaligned [quant] estimated average fragment length: 212.788 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,393 rounds 52973 SRR11389776.ke.tsv 35125 SRR11389776.se.tsv 88098 total ==> SRR11389776.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 724.25 0 0 PNS24247 1044 832.212 28.6444 1.98023 PNS24249 1928 1716.21 72.9402 2.44515 PNS24246 1044 832.212 28.6444 1.98023 PNS24248 1044 832.212 28.6444 1.98023 PNS24244 1471 1259.21 166.127 7.59013 PNS24243 293 99.3425 0 0 KQK14069 1603 1391.21 1933.27 79.948 KQK14071 474 264.316 53.003 11.5368 ==> SRR11389776.se.tsv <== BRADI_1g14170v3 2068 BRADI_1g53295v3 28 BRADI_1g59795v3 324 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 79 BRADI_1g74790v3 214 BRADI_1g09890v3 0 BRADI_1g77505v3 290 BRADI_1g48960v3 0 SRR11389776 completed mapping pipeline successfully