Starting /dee2/code/volunteer_pipeline.sh SRR11389778 current disk space = 1545644244992 free memory = 1600419184 SRR11389778 SRAfilesize d878dc69fbc52c4c189a4ef722e55518 SRR11389778.sra SRR11389778.sra file validated SRR11389778 is paired end SRR11389778 is conventional basespace SRR11389778 read1 length is 70-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389778_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.15175 32.0 32.0 32.0 32.0 32.0 2 31.09 32.0 32.0 32.0 32.0 32.0 3 31.0985 32.0 32.0 32.0 32.0 32.0 4 31.15 32.0 32.0 32.0 32.0 32.0 5 31.27 32.0 32.0 32.0 32.0 32.0 6 34.22775 36.0 36.0 36.0 32.0 36.0 7 34.22175 36.0 36.0 36.0 32.0 36.0 8 34.39325 36.0 36.0 36.0 32.0 36.0 9 34.26925 36.0 36.0 36.0 32.0 36.0 10-11 34.178875 36.0 36.0 36.0 32.0 36.0 12-13 34.329499999999996 36.0 36.0 36.0 32.0 36.0 14-15 34.283 36.0 36.0 36.0 32.0 36.0 16-17 34.201875 36.0 36.0 36.0 32.0 36.0 18-19 34.2355 36.0 36.0 36.0 32.0 36.0 20-21 34.202625 36.0 36.0 36.0 32.0 36.0 22-23 34.05325 36.0 36.0 36.0 32.0 36.0 24-25 33.829750000000004 36.0 36.0 36.0 32.0 36.0 26-27 33.779375 36.0 36.0 36.0 29.5 36.0 28-29 33.656625000000005 36.0 36.0 36.0 27.0 36.0 30-31 33.722375 36.0 36.0 36.0 29.5 36.0 32-33 33.541250000000005 36.0 36.0 36.0 27.0 36.0 34-35 33.449 36.0 36.0 36.0 27.0 36.0 36-37 33.564125000000004 36.0 36.0 36.0 27.0 36.0 38-39 33.45925 36.0 36.0 36.0 24.0 36.0 40-41 33.293375 36.0 36.0 36.0 21.0 36.0 42-43 33.24225 36.0 36.0 36.0 17.5 36.0 44-45 33.13 36.0 36.0 36.0 17.5 36.0 46-47 32.960375 36.0 36.0 36.0 14.0 36.0 48-49 32.893 36.0 36.0 36.0 14.0 36.0 50-51 32.699375 36.0 36.0 36.0 14.0 36.0 52-53 32.761875 36.0 36.0 36.0 14.0 36.0 54-55 32.687625 36.0 36.0 36.0 14.0 36.0 56-57 32.3635 36.0 34.0 36.0 14.0 36.0 58-59 32.460125000000005 36.0 34.0 36.0 14.0 36.0 60-61 32.07425 36.0 32.0 36.0 14.0 36.0 62-63 31.958875 36.0 32.0 36.0 14.0 36.0 64-65 31.94925 36.0 32.0 36.0 14.0 36.0 66-67 31.811625 36.0 32.0 36.0 14.0 36.0 68-69 31.53775 36.0 32.0 36.0 14.0 36.0 70-71 31.423113306653327 36.0 32.0 36.0 14.0 36.0 72-73 31.19119445572996 36.0 32.0 36.0 14.0 36.0 74-75 31.153595195461193 36.0 32.0 36.0 14.0 36.0 76 30.65 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 2.0 23 3.0 24 9.0 25 30.0 26 30.0 27 85.0 28 135.0 29 171.0 30 254.0 31 350.0 32 510.0 33 729.0 34 1077.0 35 614.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.025 11.525 10.274999999999999 36.175000000000004 2 25.650000000000002 13.825000000000001 33.975 26.55 3 23.974999999999998 20.875 21.175 33.975 4 28.425 28.050000000000004 19.125 24.4 5 26.900000000000002 29.625 22.400000000000002 21.075 6 22.380595148787197 31.007751937984494 23.78094523630908 22.83070767691923 7 17.549999999999997 24.025 36.199999999999996 22.225 8 20.275000000000002 21.75 30.625000000000004 27.35 9 21.4 21.224999999999998 31.525 25.85 10-11 23.425 30.8 22.0 23.775 12-13 23.3625 24.05 25.0125 27.575 14-15 23.2875 25.15 26.474999999999998 25.087500000000002 16-17 23.8625 25.412499999999998 24.762500000000003 25.9625 18-19 24.224999999999998 25.75 23.9375 26.087500000000002 20-21 23.7 25.974999999999998 24.775 25.55 22-23 23.4125 25.624999999999996 24.05 26.9125 24-25 23.3875 26.4125 24.45 25.75 26-27 22.8375 25.3125 24.712500000000002 27.1375 28-29 23.974999999999998 25.662499999999998 24.7375 25.624999999999996 30-31 23.3625 25.75 24.637500000000003 26.25 32-33 24.3625 25.25 24.2625 26.125 34-35 23.5 24.474999999999998 25.5125 26.5125 36-37 23.400000000000002 25.025 24.5125 27.0625 38-39 23.8875 24.9875 24.8 26.325 40-41 24.1625 24.9875 24.875 25.974999999999998 42-43 24.1625 25.0125 23.875 26.950000000000003 44-45 23.9 25.1875 24.474999999999998 26.437500000000004 46-47 24.3875 25.1875 23.4625 26.9625 48-49 23.474999999999998 26.05 24.0375 26.437500000000004 50-51 23.325000000000003 25.0125 24.837500000000002 26.825 52-53 24.0375 24.3125 23.962500000000002 27.6875 54-55 24.587500000000002 23.8875 24.0625 27.462500000000002 56-57 24.325 24.3125 24.5125 26.85 58-59 24.8 25.2875 24.212500000000002 25.7 60-61 23.549999999999997 25.05 24.2875 27.1125 62-63 24.0125 24.587500000000002 25.2375 26.1625 64-65 24.0375 25.575 24.525 25.8625 66-67 25.2625 24.175 24.1875 26.375 68-69 23.3875 24.8 25.0375 26.775 70-71 24.15603900975244 25.131282820705174 24.343585896474117 26.36909227306827 72-73 24.661314601103864 25.188158554942298 23.03060712493728 27.119919719016554 74-75 25.720738674106553 21.363092865683537 25.601169124485185 27.31499933572473 76 25.992647058823533 0.0 34.63235294117647 39.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 1.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 5.0 27 7.5 28 9.0 29 13.5 30 16.0 31 26.0 32 32.5 33 34.0 34 44.5 35 66.0 36 86.0 37 95.0 38 113.0 39 139.0 40 171.0 41 197.0 42 211.0 43 226.5 44 226.5 45 211.0 46 205.0 47 215.0 48 211.0 49 197.5 50 192.0 51 176.0 52 170.0 53 159.5 54 142.0 55 125.5 56 106.0 57 94.0 58 89.5 59 89.5 60 83.0 61 79.5 62 77.5 63 77.5 64 74.0 65 66.0 66 63.0 67 63.5 68 67.5 69 64.5 70 56.0 71 52.5 72 48.5 73 40.0 74 37.5 75 39.5 76 34.0 77 28.5 78 17.5 79 8.0 80 10.0 81 10.0 82 7.5 83 8.5 84 8.0 85 3.5 86 0.5 87 0.0 88 0.5 89 1.5 90 1.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 2.0 71 3.0 72 18.0 73 71.0 74 285.0 75 901.0 76 2720.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.025 0.0 0.0 51 0.0 0.0 0.025 0.0 0.0 52 0.0 0.0 0.025 0.0 0.0 53 0.0 0.0 0.025 0.0 0.0 54 0.0 0.0 0.025 0.0 0.0 55 0.0 0.0 0.025 0.0 0.0 56 0.0 0.0 0.025 0.0 0.0 57 0.0 0.0 0.025 0.0 0.0 58 0.0 0.0 0.025 0.0 0.0 59 0.0 0.0 0.025 0.0 0.0 60 0.0 0.0 0.025 0.0 0.0 61 0.0 0.0 0.025 0.0 0.0 62 0.0 0.0 0.025 0.0 0.0 63 0.0 0.0 0.025 0.0 0.0 64 0.0 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389778 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389778_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.73525 32.0 32.0 32.0 32.0 32.0 2 30.45475 32.0 32.0 32.0 32.0 32.0 3 30.3415 32.0 32.0 32.0 21.0 32.0 4 30.393 32.0 32.0 32.0 21.0 32.0 5 30.3255 32.0 32.0 32.0 21.0 32.0 6 33.5415 36.0 36.0 36.0 21.0 36.0 7 33.5435 36.0 36.0 36.0 21.0 36.0 8 33.522 36.0 36.0 36.0 21.0 36.0 9 33.55275 36.0 36.0 36.0 21.0 36.0 10-11 33.41375 36.0 36.0 36.0 21.0 36.0 12-13 33.44025 36.0 36.0 36.0 21.0 36.0 14-15 33.268125 36.0 36.0 36.0 21.0 36.0 16-17 33.37125 36.0 36.0 36.0 21.0 36.0 18-19 33.3595 36.0 36.0 36.0 21.0 36.0 20-21 33.187625 36.0 36.0 36.0 17.5 36.0 22-23 33.000375000000005 36.0 36.0 36.0 17.5 36.0 24-25 33.15537500000001 36.0 36.0 36.0 17.5 36.0 26-27 33.0325 36.0 36.0 36.0 17.5 36.0 28-29 32.962125 36.0 36.0 36.0 14.0 36.0 30-31 32.84075 36.0 36.0 36.0 14.0 36.0 32-33 32.7405 36.0 36.0 36.0 14.0 36.0 34-35 32.846625 36.0 36.0 36.0 14.0 36.0 36-37 32.617367367367365 36.0 36.0 36.0 14.0 36.0 38-39 32.59446946946947 36.0 36.0 36.0 14.0 36.0 40-41 32.669723804926605 36.0 36.0 36.0 14.0 36.0 42-43 32.489359038557836 36.0 36.0 36.0 14.0 36.0 44-45 32.26226840260391 36.0 34.0 36.0 14.0 36.0 46-47 32.17363545317977 36.0 34.0 36.0 14.0 36.0 48-49 31.90911367050576 36.0 32.0 36.0 14.0 36.0 50-51 32.0241612418628 36.0 32.0 36.0 14.0 36.0 52-53 31.62368552829244 36.0 32.0 36.0 14.0 36.0 54-55 31.661367050575862 36.0 32.0 36.0 14.0 36.0 56-57 31.59683301561408 36.0 32.0 36.0 14.0 36.0 58-59 31.39631855747558 36.0 32.0 36.0 14.0 36.0 60-61 31.28299524167293 36.0 32.0 36.0 14.0 36.0 62-63 31.052091159529176 36.0 32.0 36.0 14.0 36.0 64-65 31.000250438266967 36.0 32.0 36.0 14.0 36.0 66-67 31.017518602193114 36.0 32.0 36.0 14.0 36.0 68-69 30.745490981963925 36.0 29.5 36.0 14.0 36.0 70-71 30.535213911532338 36.0 27.0 36.0 14.0 36.0 72-73 30.374162112832288 36.0 27.0 36.0 14.0 36.0 74-75 30.410804258594148 36.0 27.0 36.0 14.0 36.0 76 29.392011834319526 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 1.0 5 1.0 6 2.0 7 1.0 8 1.0 9 0.0 10 0.0 11 2.0 12 1.0 13 0.0 14 1.0 15 3.0 16 6.0 17 1.0 18 5.0 19 9.0 20 11.0 21 14.0 22 22.0 23 35.0 24 50.0 25 60.0 26 79.0 27 135.0 28 151.0 29 195.0 30 262.0 31 352.0 32 508.0 33 667.0 34 941.0 35 480.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.320560981718 17.806160781367392 10.81893313298272 31.05434510393188 2 27.805611222444888 21.9438877755511 30.485971943887773 19.76452905811623 3 24.024024024024023 26.276276276276278 23.823823823823822 25.875875875875877 4 28.553553553553552 31.306306306306308 17.76776776776777 22.372372372372375 5 29.07907907907908 30.955955955955954 19.66966966966967 20.295295295295297 6 23.34834834834835 33.408408408408405 20.595595595595594 22.64764764764765 7 24.124124124124123 15.615615615615615 35.28528528528528 24.974974974974977 8 24.881101376720903 21.476846057571965 24.130162703379224 29.511889862327912 9 24.380475594493117 21.70212765957447 24.956195244055067 28.961201501877348 10-11 27.87726988102693 27.614276768941764 19.67438948027552 24.83406386975579 12-13 26.776093221400828 21.50106502944493 23.781481017416365 27.94136073173788 14-15 25.517500940910804 23.773679588508344 25.17877305231464 25.530046418266217 16-17 27.535140562248994 22.816265060240966 23.180220883534137 26.468373493975903 18-19 26.668339187155045 24.096838936276967 23.74560963371801 25.489212242849973 20-21 26.575445643986946 24.14009540547326 23.38689430077831 25.897564649761485 22-23 27.29098669344715 24.893296510168213 22.269645995480793 25.54607080090384 24-25 25.561551010164386 24.432174676872883 24.005521395407204 26.000752917555523 26-27 26.08913998744507 24.695543000627744 22.824858757062145 26.390458254865035 28-29 26.63322884012539 24.32601880877743 23.398119122257054 25.642633228840122 30-31 27.012791572610983 24.454477050413846 23.47629796839729 25.056433408577877 32-33 27.053806597265773 24.39483255988963 23.16568418412141 25.385676658723188 34-35 27.332077840552415 24.356559949780287 22.46076585059636 25.850596359070938 36-37 25.56475903614458 24.058734939759034 23.807730923694777 26.568775100401602 38-39 26.93273092369478 24.234437751004016 22.71586345381526 26.11696787148594 40-41 26.19107321965898 24.72417251755266 23.545636910732195 25.539117352056167 42-43 27.45639352490902 24.18120215836366 23.089471702848538 25.27293261387878 44-45 26.663319106201357 24.66733617875973 22.633693196083353 26.03565151895556 46-47 26.98432601880878 24.087774294670847 23.510971786833856 25.41692789968652 48-49 26.311825257343713 23.889028370574945 24.202862164197843 25.596284207883507 50-51 27.4312962730581 24.658049943531182 23.290249717655918 24.6204040657548 52-53 26.973766788000503 24.287686707669135 23.296096397640266 25.442450106690096 54-55 27.29553437029604 23.883592574009032 23.193677872553938 25.627195183140994 56-57 26.245138627524778 24.9529544599172 23.710952201731274 25.090954710826747 58-59 27.368553143430795 24.48236918057473 22.738110176935624 25.410967499058852 60-61 27.111836324839967 24.915275511484875 22.844232458892932 25.128655704782226 62-63 26.47685940047661 24.53279819390443 24.118901291860027 24.871441113758934 64-65 26.916802610114193 25.235286736102395 22.938888191743004 24.909022462040404 66-67 26.946708463949843 24.514106583072103 23.385579937304072 25.15360501567398 68-69 26.87915673233781 24.29413979169281 24.01807002133266 24.808633454636716 70-71 27.487140885710705 24.702044912808933 23.547860996110902 24.262953205369463 72-73 25.969773299748113 24.647355163727962 23.95465994962217 25.42821158690176 74-75 26.72275641025641 22.30235042735043 23.985042735042736 26.989850427350426 76 29.703703703703706 0.0 33.22222222222222 37.074074074074076 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.0 4 0.0 5 0.0 6 1.5 7 2.5 8 1.5 9 0.5 10 0.5 11 1.0 12 1.0 13 0.5 14 1.5 15 2.5 16 1.0 17 0.0 18 1.0 19 1.5 20 2.0 21 2.5 22 2.0 23 1.5 24 1.5 25 2.5 26 4.0 27 5.5 28 8.5 29 10.5 30 11.0 31 16.0 32 25.5 33 31.0 34 33.0 35 44.0 36 64.0 37 79.5 38 103.0 39 128.0 40 148.0 41 171.0 42 190.0 43 195.5 44 207.0 45 220.0 46 213.0 47 211.5 48 203.5 49 178.0 50 160.0 51 169.5 52 158.5 53 146.5 54 149.5 55 129.0 56 120.0 57 118.5 58 118.5 59 107.5 60 96.5 61 101.0 62 98.0 63 86.0 64 81.0 65 85.0 66 88.0 67 92.0 68 90.5 69 80.5 70 70.0 71 60.5 72 50.0 73 53.5 74 54.0 75 46.0 76 40.0 77 40.5 78 31.5 79 17.0 80 16.5 81 14.5 82 8.5 83 3.0 84 1.5 85 3.0 86 4.0 87 3.0 88 3.0 89 2.5 90 1.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.2 3 0.1 4 0.1 5 0.1 6 0.1 7 0.1 8 0.125 9 0.125 10-11 0.1875 12-13 0.2375 14-15 0.36250000000000004 16-17 0.4 18-19 0.35000000000000003 20-21 0.42500000000000004 22-23 0.42500000000000004 24-25 0.3875 26-27 0.43750000000000006 28-29 0.3125 30-31 0.325 32-33 0.3375 34-35 0.43750000000000006 36-37 0.3003003003003003 38-39 0.3003003003003003 40-41 0.17521902377972465 42-43 0.23785678517776665 44-45 0.2754131196795193 46-47 0.1627441161742614 48-49 0.2754131196795193 50-51 0.23785678517776665 52-53 0.26289434151226837 54-55 0.20030045067601399 56-57 0.2003255289846 58-59 0.2128725269221137 60-61 0.23791635361883295 62-63 0.16278487352867518 64-65 0.2128725269221137 66-67 0.12523481527864747 68-69 0.187875751503006 70-71 0.13781007266349285 72-73 0.11322178890426468 74-75 0.13336889837289945 76 0.14792899408284024 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 4.0 36 0.0 37 0.0 38 0.0 39 0.0 40 2.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 1.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 0.0 68 0.0 69 0.0 70 2.0 71 7.0 72 17.0 73 68.0 74 298.0 75 896.0 76 2704.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82456140350877 99.575 2 0.12531328320802004 0.25 3 0.02506265664160401 0.075 4 0.02506265664160401 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 662458 spots for SRR11389778.sra Written 662458 spots for SRR11389778.sra Read 662458 spots for SRR11389778.sra Written 662458 spots for SRR11389778.sra Read 662458 spots for SRR11389778.sra Written 662458 spots for SRR11389778.sra Read 662458 spots for SRR11389778.sra Written 662458 spots for SRR11389778.sra Read 662458 spots for SRR11389778.sra Written 662458 spots for SRR11389778.sra Read 662472 spots for SRR11389778.sra Written 662472 spots for SRR11389778.sra Read 662458 spots for SRR11389778.sra Written 662458 spots for SRR11389778.sra Read 662458 spots for SRR11389778.sra Written 662458 spots for SRR11389778.sra Read 662458 spots for SRR11389778.sra Written 662458 spots for SRR11389778.sra Read 662458 spots for SRR11389778.sra Written 662458 spots for SRR11389778.sra Read 662458 spots for SRR11389778.sra Written 662458 spots for SRR11389778.sra Read 662458 spots for SRR11389778.sra Written 662458 spots for SRR11389778.sra Read 662458 spots for SRR11389778.sra Written 662458 spots for SRR11389778.sra Read 662458 spots for SRR11389778.sra Written 662458 spots for SRR11389778.sra Read 662458 spots for SRR11389778.sra Written 662458 spots for SRR11389778.sra Read 662458 spots for SRR11389778.sra Written 662458 spots for SRR11389778.sra Read 662458 spots for SRR11389778.sra Written 662458 spots for SRR11389778.sra Read 662458 spots for SRR11389778.sra Written 662458 spots for SRR11389778.sra Read 662458 spots for SRR11389778.sra Written 662458 spots for SRR11389778.sra Read 662458 spots for SRR11389778.sra Written 662458 spots for SRR11389778.sra SRR ids: ['SRR11389778.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_la2hgm7c SRR11389778.sra spots: 13249174 blocks: [[1, 662458], [662459, 1324916], [1324917, 1987374], [1987375, 2649832], [2649833, 3312290], [3312291, 3974748], [3974749, 4637206], [4637207, 5299664], [5299665, 5962122], [5962123, 6624580], [6624581, 7287038], [7287039, 7949496], [7949497, 8611954], [8611955, 9274412], [9274413, 9936870], [9936871, 10599328], [10599329, 11261786], [11261787, 11924244], [11924245, 12586702], [12586703, 13249174]] SRR11389778 file size 2515633 SRR11389778 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389778 SRR11389778_1.fastq SRR11389778_2.fastq Input file: SRR11389778_1.fastq Paired file: SRR11389778_2.fastq trimmed: SRR11389778-trimmed-pair1.fastq, SRR11389778-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:15:23 2024 >> started Sat Dec 7 06:15:35 2024 >> done (11.849s) 13249174 read pairs processed; of these: 439 ( 0.00%) short read pairs filtered out after trimming by size control 3753 ( 0.03%) empty read pairs filtered out after trimming by size control 13244982 (99.97%) read pairs available; of these: 9301 ( 0.07%) trimmed read pairs available after processing 13235681 (99.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 7 0.00% 21 14 0.00% 22 13 0.00% 23 19 0.00% 24 16 0.00% 25 13 0.00% 26 23 0.00% 27 11 0.00% 28 17 0.00% 29 27 0.00% 30 23 0.00% 31 28 0.00% 32 27 0.00% 33 20 0.00% 34 19 0.00% 35 102 0.00% 36 128 0.00% 37 106 0.00% 38 122 0.00% 39 123 0.00% 40 154 0.00% 41 154 0.00% 42 147 0.00% 43 161 0.00% 44 143 0.00% 45 170 0.00% 46 136 0.00% 47 164 0.00% 48 171 0.00% 49 197 0.00% 50 183 0.00% 51 193 0.00% 52 208 0.00% 53 218 0.00% 54 234 0.00% 55 324 0.00% 56 314 0.00% 57 414 0.00% 58 426 0.00% 59 436 0.00% 60 516 0.00% 61 414 0.00% 62 478 0.00% 63 582 0.00% 64 556 0.00% 65 651 0.00% 66 758 0.01% 67 883 0.01% 68 818 0.01% 69 934 0.01% 70 1509 0.01% 71 2287 0.02% 72 9587 0.07% 73 109776 0.83% 74 978381 7.39% 75 5943681 44.87% 76 6187760 46.72% 13244982 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=5.77 fanout-score-rank=28 prefix-density=0.10 prefix-fanout=3.9 sequence=GGCAGCCTCCTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=25 fanout-score=532.53 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=35.0 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=114.47 fanout-score-rank=24 prefix-density=1.34 prefix-fanout=18.6 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=1046.00 fanout-score-rank=1 prefix-density=1.08 prefix-fanout=20.0 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR11389778 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:16:30 Started mapping on | Dec 07 06:16:31 Finished on | Dec 07 06:18:21 Mapping speed, Million of reads per hour | 433.47 Number of input reads | 13244982 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 12166722 Uniquely mapped reads % | 91.86% Average mapped length | 149.87 Number of splices: Total | 5428325 Number of splices: Annotated (sjdb) | 5173662 Number of splices: GT/AG | 5354939 Number of splices: GC/AG | 64181 Number of splices: AT/AC | 4693 Number of splices: Non-canonical | 4512 Mismatch rate per base, % | 1.30% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 225633 % of reads mapped to multiple loci | 1.70% Number of reads mapped to too many loci | 27438 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.23% % of reads unmapped: other | 1.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 852630 852630 852630 N_multimapping 225633 225633 225633 N_noFeature 499332 11876221 611533 N_ambiguous 216216 1889 39755 UnstrandedReadsAssigned:11451174 PositiveStrandReadsAssigned:288612 NegativeStrandReadsAssigned:11515434 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389778 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389778-trimmed-pair1.fastq SRR11389778-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,244,982 reads, 11,796,167 reads pseudoaligned [quant] estimated average fragment length: 214.118 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52973 SRR11389778.ke.tsv 35125 SRR11389778.se.tsv 88098 total ==> SRR11389778.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 723.134 0 0 PNS24247 1044 830.882 39.4484 6.0647 PNS24249 1928 1714.88 436.748 32.5324 PNS24246 1044 830.882 39.4484 6.0647 PNS24248 1044 830.882 39.4484 6.0647 PNS24244 1471 1257.88 37.9064 3.84938 PNS24243 293 96.3338 3 3.97797 KQK14069 1603 1389.88 301.24 27.6856 KQK14071 474 263.194 18.3115 8.88725 ==> SRR11389778.se.tsv <== BRADI_1g14170v3 336 BRADI_1g53295v3 16 BRADI_1g59795v3 199 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 584 BRADI_1g74790v3 21 BRADI_1g09890v3 0 BRADI_1g77505v3 277 BRADI_1g48960v3 0 SRR11389778 completed mapping pipeline successfully