Starting /dee2/code/volunteer_pipeline.sh SRR11389779 current disk space = 1545624506368 free memory = 1603212436 SRR11389779 SRAfilesize c47537175b9a7a089ea7bbc3390b5e2f SRR11389779.sra SRR11389779.sra file validated SRR11389779 is paired end SRR11389779 is conventional basespace SRR11389779 read1 length is 70-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389779_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.201 32.0 32.0 32.0 32.0 32.0 2 31.17675 32.0 32.0 32.0 32.0 32.0 3 31.10825 32.0 32.0 32.0 32.0 32.0 4 31.17875 32.0 32.0 32.0 32.0 32.0 5 31.18825 32.0 32.0 32.0 32.0 32.0 6 34.136 36.0 36.0 36.0 32.0 36.0 7 34.23825 36.0 36.0 36.0 32.0 36.0 8 34.023 36.0 36.0 36.0 32.0 36.0 9 34.304 36.0 36.0 36.0 32.0 36.0 10-11 34.194375 36.0 36.0 36.0 32.0 36.0 12-13 34.31625 36.0 36.0 36.0 32.0 36.0 14-15 34.170625 36.0 36.0 36.0 32.0 36.0 16-17 34.239625000000004 36.0 36.0 36.0 32.0 36.0 18-19 34.25375 36.0 36.0 36.0 32.0 36.0 20-21 34.127875 36.0 36.0 36.0 32.0 36.0 22-23 33.953375 36.0 36.0 36.0 32.0 36.0 24-25 33.830124999999995 36.0 36.0 36.0 32.0 36.0 26-27 33.6765 36.0 36.0 36.0 32.0 36.0 28-29 33.538875000000004 36.0 36.0 36.0 24.0 36.0 30-31 33.591 36.0 36.0 36.0 27.0 36.0 32-33 33.447 36.0 36.0 36.0 27.0 36.0 34-35 33.425875000000005 36.0 36.0 36.0 27.0 36.0 36-37 33.43725 36.0 36.0 36.0 24.0 36.0 38-39 33.282875000000004 36.0 36.0 36.0 21.0 36.0 40-41 33.275375 36.0 36.0 36.0 20.5 36.0 42-43 33.10375 36.0 36.0 36.0 14.0 36.0 44-45 33.1245 36.0 36.0 36.0 17.5 36.0 46-47 32.780874999999995 36.0 36.0 36.0 14.0 36.0 48-49 32.835499999999996 36.0 36.0 36.0 14.0 36.0 50-51 32.6765 36.0 36.0 36.0 14.0 36.0 52-53 32.642375 36.0 34.0 36.0 14.0 36.0 54-55 32.6185 36.0 36.0 36.0 14.0 36.0 56-57 32.326125 36.0 32.0 36.0 14.0 36.0 58-59 32.013 36.0 32.0 36.0 14.0 36.0 60-61 31.92375 36.0 32.0 36.0 14.0 36.0 62-63 31.88875 36.0 32.0 36.0 14.0 36.0 64-65 31.759375 36.0 32.0 36.0 14.0 36.0 66-67 31.587875 36.0 32.0 36.0 14.0 36.0 68-69 31.393 36.0 32.0 36.0 14.0 36.0 70-71 31.419994809904953 36.0 32.0 36.0 14.0 36.0 72-73 31.274735449493406 36.0 32.0 36.0 14.0 36.0 74-75 31.158383710585042 36.0 32.0 36.0 14.0 36.0 76 30.438723712835387 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 11.0 25 26.0 26 44.0 27 91.0 28 117.0 29 196.0 30 292.0 31 348.0 32 495.0 33 763.0 34 1049.0 35 566.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.175 11.475 11.675 35.675000000000004 2 25.0 14.325 33.25 27.425 3 25.0 22.15 20.3 32.550000000000004 4 28.325 29.375 17.7 24.6 5 25.1 30.025000000000002 22.075 22.8 6 22.43060765191298 32.63315828957239 22.680670167541887 22.255563890972745 7 18.025 23.65 35.925000000000004 22.400000000000002 8 20.0 22.8 29.625 27.575 9 21.2 20.424999999999997 31.175000000000004 27.200000000000003 10-11 22.9625 31.3125 21.2375 24.4875 12-13 24.25 22.8 24.637500000000003 28.3125 14-15 23.575 24.375 26.0625 25.9875 16-17 24.3625 24.1625 24.349999999999998 27.125 18-19 23.7125 24.9875 24.625 26.674999999999997 20-21 23.9125 25.2375 25.124999999999996 25.724999999999998 22-23 24.45 26.3625 24.587500000000002 24.6 24-25 24.087500000000002 25.362499999999997 24.099999999999998 26.450000000000003 26-27 23.599999999999998 25.75 24.2 26.450000000000003 28-29 23.6625 25.35 24.775 26.2125 30-31 23.1875 25.4 24.175 27.237499999999997 32-33 23.549999999999997 25.275 24.775 26.400000000000002 34-35 23.9375 24.3625 25.3125 26.387500000000003 36-37 24.525 25.1 23.425 26.950000000000003 38-39 23.400000000000002 25.0 24.9 26.700000000000003 40-41 24.1125 24.85 25.0625 25.974999999999998 42-43 23.4125 25.224999999999998 24.587500000000002 26.775 44-45 23.8375 24.099999999999998 25.025 27.037499999999998 46-47 24.3 24.775 23.95 26.974999999999998 48-49 24.1375 25.0 24.5625 26.3 50-51 23.4625 24.5 25.587500000000002 26.450000000000003 52-53 24.825 24.6875 24.2 26.2875 54-55 24.075 25.362499999999997 24.2875 26.275 56-57 24.0 24.4125 25.412499999999998 26.174999999999997 58-59 23.8375 24.6875 24.9375 26.5375 60-61 23.8625 25.162499999999998 22.9875 27.987499999999997 62-63 23.799999999999997 24.4375 24.6125 27.150000000000002 64-65 24.65 25.2125 23.6375 26.5 66-67 24.025 25.8625 23.6875 26.424999999999997 68-69 23.962500000000002 25.0125 24.712500000000002 26.3125 70-71 25.431357839459867 24.543635908977244 23.418354588647162 26.60665166291573 72-73 23.825671941723183 24.604370761115298 24.39085656870133 27.179100728460188 74-75 24.666930484105 20.9471046036143 26.117926394934702 28.268038517345996 76 27.918781725888326 0.0 33.64757070340827 38.433647570703414 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 2.0 24 3.0 25 4.0 26 5.5 27 7.0 28 7.5 29 8.5 30 14.0 31 21.0 32 31.0 33 44.5 34 55.5 35 62.0 36 76.5 37 89.5 38 105.5 39 140.5 40 171.0 41 204.0 42 232.5 43 219.5 44 197.0 45 210.0 46 216.5 47 209.0 48 202.0 49 197.0 50 192.5 51 195.5 52 183.0 53 146.5 54 126.5 55 122.5 56 117.5 57 107.0 58 108.5 59 101.5 60 88.0 61 75.0 62 66.5 63 76.0 64 77.5 65 66.0 66 68.0 67 74.5 68 68.5 69 61.5 70 51.5 71 43.5 72 47.5 73 43.0 74 40.0 75 46.5 76 41.5 77 30.0 78 17.5 79 12.0 80 14.5 81 12.5 82 6.5 83 3.0 84 1.5 85 2.5 86 2.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 2.0 71 9.0 72 16.0 73 62.0 74 241.0 75 912.0 76 2758.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.025 0.0 3 0.0 0.0 0.0 0.025 0.0 4 0.0 0.0 0.0 0.025 0.0 5 0.0 0.0 0.0 0.025 0.0 6 0.0 0.0 0.0 0.025 0.0 7 0.0 0.0 0.0 0.025 0.0 8 0.0 0.0 0.0 0.025 0.0 9 0.0 0.0 0.0 0.025 0.0 10 0.0 0.0 0.0 0.025 0.0 11 0.0 0.0 0.0 0.025 0.0 12 0.0 0.0 0.0 0.025 0.0 13 0.0 0.0 0.0 0.025 0.0 14 0.0 0.0 0.0 0.025 0.0 15 0.0 0.0 0.0 0.025 0.0 16 0.0 0.0 0.0 0.025 0.0 17 0.0 0.0 0.0 0.025 0.0 18 0.0 0.0 0.0 0.025 0.0 19 0.0 0.0 0.0 0.025 0.0 20 0.0 0.0 0.0 0.025 0.0 21 0.0 0.0 0.0 0.025 0.0 22 0.0 0.0 0.0 0.025 0.0 23 0.0 0.0 0.0 0.025 0.0 24 0.0 0.0 0.0 0.025 0.0 25 0.0 0.0 0.0 0.025 0.0 26 0.0 0.0 0.0 0.025 0.0 27 0.0 0.0 0.0 0.025 0.0 28 0.0 0.0 0.0 0.025 0.0 29 0.0 0.0 0.0 0.025 0.0 30 0.0 0.0 0.0 0.025 0.0 31 0.0 0.0 0.0 0.025 0.0 32 0.0 0.0 0.0 0.025 0.0 33 0.0 0.0 0.0 0.025 0.0 34 0.0 0.0 0.0 0.025 0.0 35 0.0 0.0 0.0 0.025 0.0 36 0.0 0.0 0.0 0.025 0.0 37 0.0 0.0 0.0 0.025 0.0 38 0.0 0.0 0.0 0.025 0.0 39 0.0 0.0 0.0 0.025 0.0 40 0.0 0.0 0.0 0.025 0.0 41 0.0 0.0 0.0 0.025 0.0 42 0.0 0.0 0.0 0.025 0.0 43 0.0 0.0 0.0 0.025 0.0 44 0.0 0.0 0.0 0.025 0.0 45 0.0 0.0 0.0 0.025 0.0 46 0.0 0.0 0.0 0.025 0.0 47 0.0 0.0 0.0 0.025 0.0 48 0.0 0.0 0.0 0.025 0.0 49 0.0 0.0 0.0 0.025 0.0 50 0.0 0.0 0.0 0.025 0.0 51 0.0 0.0 0.0 0.025 0.0 52 0.0 0.0 0.0 0.025 0.0 53 0.0 0.0 0.0 0.025 0.0 54 0.0 0.0 0.0 0.025 0.0 55 0.0 0.0 0.0 0.025 0.0 56 0.0 0.0 0.0 0.025 0.0 57 0.0 0.0 0.0 0.025 0.0 58 0.0 0.0 0.0 0.025 0.0 59 0.0 0.0 0.0 0.025 0.0 60 0.0 0.0 0.0 0.025 0.0 61 0.0 0.0 0.0 0.025 0.0 62 0.0 0.0 0.0 0.025 0.0 63 0.0 0.0 0.0 0.025 0.0 64 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389779 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389779_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.87475 32.0 32.0 32.0 32.0 32.0 2 30.38325 32.0 32.0 32.0 32.0 32.0 3 30.34525 32.0 32.0 32.0 32.0 32.0 4 30.17225 32.0 32.0 32.0 21.0 32.0 5 30.238 32.0 32.0 32.0 21.0 32.0 6 33.401 36.0 36.0 36.0 21.0 36.0 7 33.551 36.0 36.0 36.0 21.0 36.0 8 33.61925 36.0 36.0 36.0 32.0 36.0 9 33.54 36.0 36.0 36.0 21.0 36.0 10-11 33.366 36.0 36.0 36.0 21.0 36.0 12-13 33.434125 36.0 36.0 36.0 21.0 36.0 14-15 33.277375000000006 36.0 36.0 36.0 21.0 36.0 16-17 33.23025 36.0 36.0 36.0 17.5 36.0 18-19 33.2845 36.0 36.0 36.0 21.0 36.0 20-21 33.079 36.0 36.0 36.0 17.5 36.0 22-23 33.003875 36.0 36.0 36.0 14.0 36.0 24-25 32.912499999999994 36.0 36.0 36.0 17.5 36.0 26-27 32.941125 36.0 36.0 36.0 14.0 36.0 28-29 32.9845 36.0 36.0 36.0 14.0 36.0 30-31 32.750875 36.0 36.0 36.0 14.0 36.0 32-33 32.721000000000004 36.0 36.0 36.0 14.0 36.0 34-35 32.714625 36.0 36.0 36.0 14.0 36.0 36-37 32.701653306613224 36.0 36.0 36.0 14.0 36.0 38-39 32.58191382765531 36.0 36.0 36.0 14.0 36.0 40-41 32.53745928338762 36.0 36.0 36.0 14.0 36.0 42-43 32.30982209972438 36.0 36.0 36.0 14.0 36.0 44-45 32.21804511278195 36.0 34.0 36.0 14.0 36.0 46-47 32.08220551378446 36.0 32.0 36.0 14.0 36.0 48-49 31.954135338345864 36.0 32.0 36.0 14.0 36.0 50-51 31.86466165413534 36.0 32.0 36.0 14.0 36.0 52-53 31.72531328320802 36.0 32.0 36.0 14.0 36.0 54-55 31.58045112781955 36.0 32.0 36.0 14.0 36.0 56-57 31.51127819548872 36.0 32.0 36.0 14.0 36.0 58-59 31.286215538847117 36.0 32.0 36.0 14.0 36.0 60-61 31.26654135338346 36.0 32.0 36.0 14.0 36.0 62-63 31.33659147869674 36.0 32.0 36.0 14.0 36.0 64-65 30.85200501253133 36.0 29.5 36.0 14.0 36.0 66-67 30.897117794486213 36.0 32.0 36.0 14.0 36.0 68-69 30.76475841144601 36.0 29.5 36.0 14.0 36.0 70-71 30.469083736544306 36.0 27.0 36.0 14.0 36.0 72-73 30.532376555592506 36.0 27.0 36.0 14.0 36.0 74-75 30.186469910449173 36.0 27.0 36.0 14.0 36.0 76 29.03037037037037 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 1.0 5 3.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 5.0 18 8.0 19 10.0 20 10.0 21 15.0 22 29.0 23 31.0 24 49.0 25 60.0 26 87.0 27 124.0 28 172.0 29 206.0 30 298.0 31 353.0 32 464.0 33 667.0 34 868.0 35 527.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.987722375344525 17.739914808318716 10.974693059383613 32.29766975695315 2 28.514156852919072 23.076923076923077 28.539213229766975 19.86970684039088 3 23.622244488977955 28.582164328657317 22.069138276553108 25.726452905811627 4 29.13326653306613 33.04108216432866 16.958917835671343 20.86673346693387 5 27.229458917835668 33.842685370741485 19.739478957915832 19.188376753507015 6 22.645290581162325 33.71743486973948 21.34268537074148 22.294589178356713 7 23.22144288577154 15.656312625250502 35.82164328657315 25.30060120240481 8 23.327486845402152 20.596341768980206 25.10648960160361 30.969681784014032 9 22.95164119268354 20.821849160611375 26.058631921824105 30.16787772488098 10-11 27.043630892678035 27.670511534603808 19.39568706118355 25.890170511534606 12-13 27.539503386004515 21.24404314020567 23.6017055430148 27.614747930775017 14-15 25.43925702811245 23.895582329317268 24.359939759036145 26.305220883534137 16-17 27.055869428750785 23.71625863151287 23.00062774639046 26.22724419334589 18-19 27.233935742971887 23.130020080321284 23.54417670682731 26.09186746987952 20-21 25.904068307383227 24.547965846308387 23.493219487694624 26.054746358613762 22-23 27.23505775991964 24.63586137619287 22.187343043696636 25.94173782019086 24-25 26.691776522285 24.83364720652856 22.925298179535467 25.549278091650972 26-27 26.227860821504834 24.456726541891722 23.640246200226102 25.67516643637734 28-29 26.680883090817865 24.7491219267436 22.679377822378324 25.89061716006021 30-31 26.562107904642406 24.567126725219573 22.835633626097867 26.03513174404015 32-33 26.888331242158092 24.278544542032623 23.864491844416563 24.968632371392722 34-35 27.019218691119207 24.98429845496797 22.685592262278607 25.310890591634216 36-37 26.808136614766447 24.40984429934706 23.10396785534907 25.67805123053742 38-39 26.644902059266702 24.91210447011552 22.852837769964843 25.59015570065294 40-41 26.555444054189664 23.845960863020572 23.75815353738083 25.840441545408932 42-43 26.72024108488197 24.886991461577097 23.053741838272224 25.339025615268707 44-45 25.67805123053742 25.602712204922152 23.643897538925163 25.075339025615268 46-47 27.471149021575513 24.786753637732062 22.36578023080783 25.376317109884596 48-49 26.8491774456863 24.56360668089916 22.893381891247017 25.693833982167526 50-51 26.832329317269078 23.820281124497992 24.046184738955823 25.301204819277107 52-53 28.151682571572074 24.937217478653942 21.96132596685083 24.949773982923155 54-55 25.963107039779143 24.3945287990965 23.691805747270674 25.95055841385368 56-57 27.330907265654407 24.41962605094742 23.89258376207805 24.356882921320118 58-59 27.224802309526797 24.852516631103303 22.505334504832433 25.417346554537467 60-61 26.569563033651434 25.05022601707684 23.417880462079356 24.962330487192368 62-63 26.67503136762861 24.54203262233375 23.02383939774153 25.759096612296112 64-65 27.253326638212407 24.47903590258599 22.64624654782827 25.621390911373336 66-67 27.65930757651781 23.95885599598595 23.30657300551932 25.075263421976917 68-69 26.92355968369524 25.567967867453245 22.794025354587674 24.71444709426384 70-71 26.772938370779464 25.957072925819002 22.542989833061377 24.726998870340154 72-73 26.801261829652994 24.56782334384858 23.17981072555205 25.45110410094637 74-75 27.694992616458585 20.633642099610686 25.010068465565848 26.66129681836488 76 29.080118694362017 0.0 34.64391691394659 36.275964391691396 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 10.0 1 5.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.5 8 1.0 9 1.0 10 2.0 11 2.5 12 1.5 13 0.5 14 1.0 15 1.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.0 21 1.5 22 2.5 23 3.0 24 2.5 25 2.5 26 3.0 27 3.0 28 4.5 29 7.0 30 11.0 31 17.0 32 28.0 33 34.5 34 31.0 35 46.5 36 69.0 37 73.5 38 93.5 39 117.0 40 127.0 41 168.5 42 192.5 43 185.5 44 198.0 45 216.5 46 225.5 47 234.0 48 216.5 49 195.5 50 197.0 51 197.0 52 181.5 53 151.5 54 135.0 55 122.0 56 115.0 57 109.5 58 104.0 59 95.0 60 90.0 61 91.0 62 84.5 63 86.0 64 90.5 65 88.5 66 91.5 67 95.5 68 94.5 69 86.5 70 64.5 71 49.5 72 55.5 73 53.5 74 47.5 75 47.0 76 36.0 77 29.0 78 22.5 79 12.0 80 13.0 81 15.0 82 9.5 83 6.0 84 6.0 85 5.0 86 3.0 87 2.0 88 1.5 89 1.0 90 0.5 91 0.5 92 1.0 93 1.0 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 1.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.22499999999999998 3 0.2 4 0.2 5 0.2 6 0.2 7 0.2 8 0.22499999999999998 9 0.22499999999999998 10-11 0.3 12-13 0.325 14-15 0.4 16-17 0.43750000000000006 18-19 0.4 20-21 0.44999999999999996 22-23 0.44999999999999996 24-25 0.43750000000000006 26-27 0.4875 28-29 0.35000000000000003 30-31 0.375 32-33 0.375 34-35 0.4875 36-37 0.250501002004008 38-39 0.250501002004008 40-41 0.12528188423953898 42-43 0.22550739163117012 44-45 0.20050125313283207 46-47 0.10025062656641603 48-49 0.2130325814536341 50-51 0.15037593984962408 52-53 0.20050125313283207 54-55 0.13784461152882205 56-57 0.13784461152882205 58-59 0.16290726817042606 60-61 0.20050125313283207 62-63 0.12531328320802004 64-65 0.17543859649122806 66-67 0.10025062656641603 68-69 0.15039478631407444 70-71 0.12536041118214866 72-73 0.10084457330139922 74-75 0.1072817486925037 76 0.14814814814814814 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 8.0 36 0.0 37 0.0 38 0.0 39 1.0 40 0.0 41 0.0 42 0.0 43 1.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 0.0 70 1.0 71 7.0 72 29.0 73 79.0 74 289.0 75 884.0 76 2700.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72375690607734 99.275 2 0.22601707684580613 0.44999999999999996 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025113008538422906 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 883961 spots for SRR11389779.sra Written 883961 spots for SRR11389779.sra Read 883961 spots for SRR11389779.sra Written 883961 spots for SRR11389779.sra Read 883961 spots for SRR11389779.sra Written 883961 spots for SRR11389779.sra Read 883961 spots for SRR11389779.sra Written 883961 spots for SRR11389779.sra Read 883961 spots for SRR11389779.sra Written 883961 spots for SRR11389779.sra Read 883961 spots for SRR11389779.sra Written 883961 spots for SRR11389779.sra Read 883961 spots for SRR11389779.sra Written 883961 spots for SRR11389779.sra Read 883961 spots for SRR11389779.sra Written 883961 spots for SRR11389779.sra Read 883961 spots for SRR11389779.sra Written 883961 spots for SRR11389779.sra Read 883961 spots for SRR11389779.sra Written 883961 spots for SRR11389779.sra Read 883961 spots for SRR11389779.sra Written 883961 spots for SRR11389779.sra Read 883961 spots for SRR11389779.sra Written 883961 spots for SRR11389779.sra Read 883961 spots for SRR11389779.sra Written 883961 spots for SRR11389779.sra Read 883961 spots for SRR11389779.sra Written 883961 spots for SRR11389779.sra Read 883961 spots for SRR11389779.sra Written 883961 spots for SRR11389779.sra Read 883961 spots for SRR11389779.sra Written 883961 spots for SRR11389779.sra Read 883961 spots for SRR11389779.sra Written 883961 spots for SRR11389779.sra Read 883961 spots for SRR11389779.sra Written 883961 spots for SRR11389779.sra Read 883961 spots for SRR11389779.sra Written 883961 spots for SRR11389779.sra Read 883966 spots for SRR11389779.sra Written 883966 spots for SRR11389779.sra SRR ids: ['SRR11389779.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oybkywgb SRR11389779.sra spots: 17679225 blocks: [[1, 883961], [883962, 1767922], [1767923, 2651883], [2651884, 3535844], [3535845, 4419805], [4419806, 5303766], [5303767, 6187727], [6187728, 7071688], [7071689, 7955649], [7955650, 8839610], [8839611, 9723571], [9723572, 10607532], [10607533, 11491493], [11491494, 12375454], [12375455, 13259415], [13259416, 14143376], [14143377, 15027337], [15027338, 15911298], [15911299, 16795259], [16795260, 17679225]] SRR11389779 file size 3364206 SRR11389779 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389779 SRR11389779_1.fastq SRR11389779_2.fastq Input file: SRR11389779_1.fastq Paired file: SRR11389779_2.fastq trimmed: SRR11389779-trimmed-pair1.fastq, SRR11389779-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:15:35 2024 >> started Sat Dec 7 06:15:50 2024 >> done (14.383s) 17679225 read pairs processed; of these: 592 ( 0.00%) short read pairs filtered out after trimming by size control 4871 ( 0.03%) empty read pairs filtered out after trimming by size control 17673762 (99.97%) read pairs available; of these: 8843 ( 0.05%) trimmed read pairs available after processing 17664919 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 10 0.00% 21 16 0.00% 22 16 0.00% 23 24 0.00% 24 27 0.00% 25 18 0.00% 26 32 0.00% 27 29 0.00% 28 34 0.00% 29 42 0.00% 30 32 0.00% 31 28 0.00% 32 33 0.00% 33 27 0.00% 34 36 0.00% 35 165 0.00% 36 178 0.00% 37 183 0.00% 38 185 0.00% 39 155 0.00% 40 170 0.00% 41 170 0.00% 42 198 0.00% 43 192 0.00% 44 202 0.00% 45 178 0.00% 46 171 0.00% 47 187 0.00% 48 226 0.00% 49 212 0.00% 50 220 0.00% 51 216 0.00% 52 251 0.00% 53 259 0.00% 54 219 0.00% 55 290 0.00% 56 384 0.00% 57 493 0.00% 58 466 0.00% 59 531 0.00% 60 568 0.00% 61 456 0.00% 62 554 0.00% 63 622 0.00% 64 607 0.00% 65 754 0.00% 66 754 0.00% 67 982 0.01% 68 804 0.00% 69 1016 0.01% 70 1805 0.01% 71 2775 0.02% 72 12516 0.07% 73 145225 0.82% 74 1293143 7.32% 75 7893796 44.66% 76 8310869 47.02% 17673762 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=188.50 fanout-score-rank=16 prefix-density=0.57 prefix-fanout=22.8 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=10 fanout-score=400.09 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=34.6 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=116.03 fanout-score-rank=21 prefix-density=1.44 prefix-fanout=18.8 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=1275.67 fanout-score-rank=1 prefix-density=1.16 prefix-fanout=20.1 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR11389779 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:16:35 Started mapping on | Dec 07 06:16:36 Finished on | Dec 07 06:18:08 Mapping speed, Million of reads per hour | 691.58 Number of input reads | 17673762 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 15960882 Uniquely mapped reads % | 90.31% Average mapped length | 149.88 Number of splices: Total | 7182261 Number of splices: Annotated (sjdb) | 6845591 Number of splices: GT/AG | 7085995 Number of splices: GC/AG | 83720 Number of splices: AT/AC | 6379 Number of splices: Non-canonical | 6167 Mismatch rate per base, % | 1.28% Deletion rate per base | 0.01% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 303138 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 64550 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.88% % of reads unmapped: other | 1.73% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1409751 1409751 1409751 N_multimapping 303138 303138 303138 N_noFeature 591551 15584882 742659 N_ambiguous 272241 2476 49383 UnstrandedReadsAssigned:15097090 PositiveStrandReadsAssigned:373524 NegativeStrandReadsAssigned:15168840 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389779 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389779-trimmed-pair1.fastq SRR11389779-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,673,762 reads, 15,562,323 reads pseudoaligned [quant] estimated average fragment length: 216.204 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,230 rounds 52973 SRR11389779.ke.tsv 35125 SRR11389779.se.tsv 88098 total ==> SRR11389779.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 721.084 0 0 PNS24247 1044 828.796 65.0837 7.47042 PNS24249 1928 1712.8 584.365 32.4563 PNS24246 1044 828.796 65.0837 7.47042 PNS24248 1044 828.796 65.0837 7.47042 PNS24244 1471 1255.8 49.384 3.741 PNS24243 293 96.5767 0 0 KQK14069 1603 1387.8 41.4601 2.842 KQK14071 474 261.996 0.741951 0.269403 ==> SRR11389779.se.tsv <== BRADI_1g14170v3 60 BRADI_1g53295v3 25 BRADI_1g59795v3 265 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 832 BRADI_1g74790v3 19 BRADI_1g09890v3 0 BRADI_1g77505v3 345 BRADI_1g48960v3 0 SRR11389779 completed mapping pipeline successfully