Starting /dee2/code/volunteer_pipeline.sh SRR11389780 current disk space = 1545880260608 free memory = 1597692272 SRR11389780 SRAfilesize 15f793e0dedd07f27ae1021c5e1b59e6 SRR11389780.sra SRR11389780.sra file validated SRR11389780 is paired end SRR11389780 is conventional basespace SRR11389780 read1 length is 52-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389780_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.13325 32.0 32.0 32.0 32.0 32.0 2 31.113 32.0 32.0 32.0 32.0 32.0 3 31.2065 32.0 32.0 32.0 32.0 32.0 4 31.23625 32.0 32.0 32.0 32.0 32.0 5 31.279 32.0 32.0 32.0 32.0 32.0 6 34.23225 36.0 36.0 36.0 32.0 36.0 7 34.377 36.0 36.0 36.0 32.0 36.0 8 34.24875 36.0 36.0 36.0 32.0 36.0 9 34.308 36.0 36.0 36.0 32.0 36.0 10-11 34.29275 36.0 36.0 36.0 32.0 36.0 12-13 34.386875 36.0 36.0 36.0 32.0 36.0 14-15 34.3765 36.0 36.0 36.0 32.0 36.0 16-17 34.271125 36.0 36.0 36.0 32.0 36.0 18-19 34.305125000000004 36.0 36.0 36.0 32.0 36.0 20-21 34.19525 36.0 36.0 36.0 32.0 36.0 22-23 34.030125 36.0 36.0 36.0 32.0 36.0 24-25 33.92075 36.0 36.0 36.0 32.0 36.0 26-27 33.853875 36.0 36.0 36.0 32.0 36.0 28-29 33.8595 36.0 36.0 36.0 32.0 36.0 30-31 33.774375 36.0 36.0 36.0 32.0 36.0 32-33 33.53375 36.0 36.0 36.0 27.0 36.0 34-35 33.722875 36.0 36.0 36.0 32.0 36.0 36-37 33.687375 36.0 36.0 36.0 32.0 36.0 38-39 33.5745 36.0 36.0 36.0 29.5 36.0 40-41 33.307375 36.0 36.0 36.0 20.5 36.0 42-43 33.331125 36.0 36.0 36.0 21.0 36.0 44-45 33.16675 36.0 36.0 36.0 17.5 36.0 46-47 33.046375 36.0 36.0 36.0 17.5 36.0 48-49 33.135000000000005 36.0 36.0 36.0 21.0 36.0 50-51 32.79875 36.0 36.0 36.0 14.0 36.0 52-53 32.76349080790395 36.0 36.0 36.0 14.0 36.0 54-55 32.66725043782837 36.0 36.0 36.0 14.0 36.0 56-57 32.60920690517889 36.0 34.0 36.0 14.0 36.0 58-59 32.464598448836625 36.0 32.0 36.0 14.0 36.0 60-61 32.14010507880911 36.0 32.0 36.0 14.0 36.0 62-63 32.00388266675482 36.0 32.0 36.0 14.0 36.0 64-65 32.01325568371876 36.0 32.0 36.0 14.0 36.0 66-67 31.84654911027367 36.0 32.0 36.0 14.0 36.0 68-69 31.514898725844276 36.0 32.0 36.0 14.0 36.0 70-71 31.386296579584766 36.0 32.0 36.0 14.0 36.0 72-73 31.41085305750247 36.0 32.0 36.0 14.0 36.0 74-75 31.117488721523863 36.0 32.0 36.0 14.0 36.0 76 30.485012639942216 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 5.0 24 8.0 25 19.0 26 27.0 27 83.0 28 126.0 29 157.0 30 241.0 31 352.0 32 530.0 33 744.0 34 1068.0 35 639.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.4 11.375 12.2 35.025 2 24.975 13.975000000000001 34.175 26.875 3 24.7 21.175 21.5 32.625 4 27.625 28.925 19.0 24.45 5 26.275 29.825000000000003 22.025 21.875 6 21.76088044022011 30.29014507253627 25.237618809404704 22.71135567783892 7 17.875 24.025 36.575 21.525 8 20.625 22.225 29.65 27.500000000000004 9 20.724999999999998 20.05 31.775 27.450000000000003 10-11 23.8375 29.425 22.0875 24.65 12-13 24.5 21.987499999999997 26.2625 27.250000000000004 14-15 22.3625 25.424999999999997 25.974999999999998 26.237500000000004 16-17 24.099999999999998 25.35 24.45 26.1 18-19 23.799999999999997 25.087500000000002 24.65 26.4625 20-21 23.7375 25.15 24.975 26.137500000000003 22-23 23.3 25.55 24.85 26.3 24-25 22.9625 25.05 26.1 25.887500000000003 26-27 22.9875 25.45 25.387500000000003 26.174999999999997 28-29 24.0375 25.825 24.775 25.362499999999997 30-31 23.1125 25.387500000000003 24.9875 26.5125 32-33 23.5125 25.6 25.5 25.387500000000003 34-35 23.775 25.45 24.8125 25.9625 36-37 23.7625 24.5 24.6875 27.05 38-39 23.325000000000003 25.124999999999996 25.3 26.25 40-41 23.9875 25.7625 24.1875 26.0625 42-43 24.212500000000002 24.7875 24.9375 26.0625 44-45 23.05 25.55 25.0125 26.387500000000003 46-47 23.625 25.275 24.025 27.075 48-49 23.3 25.55 24.224999999999998 26.924999999999997 50-51 24.0625 24.8 25.3 25.837500000000002 52-53 24.468617154288573 24.58114528632158 23.543385846461614 27.406851712928233 54-55 23.73029772329247 25.293970477858394 24.668501376032022 26.307230422817113 56-57 24.380785589191895 25.281461095821868 24.180635476607456 26.157117838378785 58-59 24.330748061045785 24.68101075806855 24.69352014010508 26.294721040780583 60-61 24.31823867900926 24.00550412809607 24.26820115086315 27.408056042031525 62-63 24.408857750531716 25.42224446390592 24.346303015138247 25.822594770424125 64-65 24.527593542735577 24.59016393442623 23.764234764109624 27.118007758728567 66-67 24.371010138941042 24.195769182626112 24.65890599574415 26.7743146826887 68-69 23.478587528174305 23.954420235411973 24.805910343100425 27.7610818933133 70-71 23.731361984713693 25.172284174915422 24.495677233429394 26.600676606941487 72-73 23.858634134071185 23.87121116840649 25.128914601936863 27.141240095585463 74-75 24.12968376295509 21.57852777039596 25.471698113207548 28.8200903534414 76 26.941133983387505 0.0 34.05561574575659 39.00325027085591 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 0.5 22 0.5 23 1.0 24 1.0 25 1.5 26 2.5 27 5.5 28 7.5 29 5.5 30 13.0 31 28.0 32 34.0 33 33.0 34 52.5 35 82.5 36 88.5 37 94.5 38 113.5 39 135.5 40 165.0 41 183.0 42 187.5 43 226.0 44 253.5 45 238.0 46 231.5 47 226.5 48 204.5 49 194.0 50 197.0 51 178.0 52 157.0 53 136.5 54 122.0 55 123.5 56 115.0 57 111.5 58 113.0 59 100.5 60 82.0 61 77.0 62 79.0 63 73.0 64 72.5 65 76.0 66 64.5 67 53.0 68 59.0 69 60.0 70 55.0 71 53.5 72 52.5 73 41.0 74 38.5 75 46.5 76 33.0 77 20.5 78 16.5 79 14.0 80 13.0 81 8.5 82 5.0 83 4.0 84 4.0 85 2.5 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 52 2.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 1.0 65 0.0 66 1.0 67 0.0 68 2.0 69 1.0 70 1.0 71 3.0 72 23.0 73 80.0 74 242.0 75 873.0 76 2769.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389780 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389780_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.83075 32.0 32.0 32.0 32.0 32.0 2 30.44075 32.0 32.0 32.0 32.0 32.0 3 30.24925 32.0 32.0 32.0 21.0 32.0 4 30.30275 32.0 32.0 32.0 21.0 32.0 5 30.34725 32.0 32.0 32.0 21.0 32.0 6 33.64975 36.0 36.0 36.0 21.0 36.0 7 33.707 36.0 36.0 36.0 32.0 36.0 8 33.6275 36.0 36.0 36.0 32.0 36.0 9 33.47475 36.0 36.0 36.0 21.0 36.0 10-11 33.475 36.0 36.0 36.0 21.0 36.0 12-13 33.622375000000005 36.0 36.0 36.0 26.5 36.0 14-15 33.357124999999996 36.0 36.0 36.0 21.0 36.0 16-17 33.5625 36.0 36.0 36.0 26.5 36.0 18-19 33.394999999999996 36.0 36.0 36.0 21.0 36.0 20-21 33.226 36.0 36.0 36.0 21.0 36.0 22-23 33.104 36.0 36.0 36.0 21.0 36.0 24-25 33.222125 36.0 36.0 36.0 17.5 36.0 26-27 32.921 36.0 36.0 36.0 14.0 36.0 28-29 33.156875 36.0 36.0 36.0 17.5 36.0 30-31 32.866749999999996 36.0 36.0 36.0 14.0 36.0 32-33 32.7405 36.0 36.0 36.0 14.0 36.0 34-35 32.87475 36.0 36.0 36.0 14.0 36.0 36-37 32.639549436795996 36.0 36.0 36.0 14.0 36.0 38-39 32.666958698372966 36.0 36.0 36.0 14.0 36.0 40-41 32.52873227237602 36.0 36.0 36.0 14.0 36.0 42-43 32.500751126690034 36.0 36.0 36.0 14.0 36.0 44-45 32.309339008512765 36.0 34.0 36.0 14.0 36.0 46-47 32.28042063094642 36.0 34.0 36.0 14.0 36.0 48-49 32.05958938407611 36.0 32.0 36.0 14.0 36.0 50-51 32.11492238357536 36.0 32.0 36.0 14.0 36.0 52-53 31.762689896352168 36.0 32.0 36.0 14.0 36.0 54-55 31.660765247608722 36.0 32.0 36.0 14.0 36.0 56-57 31.67689802054623 36.0 32.0 36.0 14.0 36.0 58-59 31.559634176898022 36.0 32.0 36.0 14.0 36.0 60-61 31.318090704084188 36.0 32.0 36.0 14.0 36.0 62-63 31.219871527980565 36.0 32.0 36.0 14.0 36.0 64-65 30.932690238635708 36.0 32.0 36.0 14.0 36.0 66-67 31.050658591022632 36.0 32.0 36.0 14.0 36.0 68-69 30.75074025085921 36.0 27.0 36.0 14.0 36.0 70-71 30.542870641491398 36.0 27.0 36.0 14.0 36.0 72-73 30.446914754088162 36.0 27.0 36.0 14.0 36.0 74-75 30.408797016386963 36.0 27.0 36.0 14.0 36.0 76 29.24824528998892 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 2.0 5 1.0 6 0.0 7 0.0 8 2.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 2.0 15 3.0 16 2.0 17 3.0 18 6.0 19 7.0 20 9.0 21 14.0 22 16.0 23 31.0 24 43.0 25 55.0 26 82.0 27 146.0 28 150.0 29 186.0 30 267.0 31 351.0 32 511.0 33 683.0 34 938.0 35 483.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.020035061357376 17.054845980465817 10.16779363886802 32.75732531930879 2 27.004008016032067 22.62024048096192 30.410821643286575 19.964929859719437 3 23.60450563204005 27.23404255319149 24.005006257822277 25.15644555694618 4 29.987484355444305 30.76345431789737 17.296620775969963 21.952440550688358 5 28.71088861076345 32.64080100125156 18.39799749687109 20.250312891113893 6 22.853566958698373 34.11764705882353 21.60200250312891 21.426783479349186 7 22.302878598247812 17.146433041301627 35.41927409261577 25.131414267834796 8 25.212819228843266 21.181772658988482 23.73560340510766 29.86980470706059 9 25.018782870022537 22.01352366641623 26.446280991735538 26.521412471825695 10-11 28.385318802455217 28.1097331830139 18.100964549668046 25.403983464862833 12-13 27.286394387371587 22.062139814582814 23.001753946379353 27.649711851666247 14-15 25.523642292737993 24.43245955098457 25.084660729963627 24.95923742631381 16-17 27.64462291379094 23.41573597691053 23.491027732463294 25.44861337683524 18-19 26.292022077270445 24.623682890115404 23.3567486201706 25.72754641244355 20-21 26.826512678885262 24.566909364800402 24.002008536279188 24.604569420035148 22-23 26.964599548079338 25.119256841576703 22.533266382124026 25.382877228219936 24-25 26.217369477911646 25.627510040160644 22.87901606425703 25.27610441767068 26-27 26.494974874371856 25.841708542713565 23.42964824120603 24.23366834170854 28-29 26.692577733199595 24.874623871614844 22.993981945837515 25.438816449348046 30-31 26.64576802507837 24.58934169278997 23.460815047021942 25.304075235109718 32-33 26.690079016681302 25.235168694343407 23.88059701492537 24.19415527404992 34-35 26.940467219291637 24.315498618437577 23.461441848781714 25.282592313489072 36-37 27.090133065528498 25.33266382124027 22.77178006527743 24.805423047953802 38-39 25.803212851405622 25.31375502008032 23.832831325301203 25.050200803212853 40-41 27.710239378368218 24.476751472615614 22.97280360947487 24.840205539541298 42-43 26.552892458275817 25.536453758313467 23.491027732463294 24.41962605094742 44-45 26.098418277680143 24.830529751443635 23.637961335676625 25.433090635199594 46-47 26.46026573075959 24.204061168212583 23.20130358485836 26.134369516169464 48-49 26.707684580612757 24.49773982923154 24.15871421396283 24.63586137619287 50-51 26.82559598494354 24.654956085319952 22.923462986198242 25.59598494353827 52-53 27.175687554941604 24.852442546778853 23.006404621373854 24.96546527690569 54-55 26.735283042550524 24.501066900966485 23.584787247395507 25.178862809087487 56-57 26.52190284925317 24.576377557424376 24.40065269235597 24.501066900966485 58-59 27.345810827785456 25.449064187916093 22.66046979022736 24.544655194071098 60-61 26.31578947368421 24.971737218942344 23.564878784072352 25.14759452330109 62-63 27.020582329317268 25.100401606425706 23.19277108433735 24.686244979919678 64-65 27.10139464756879 24.676466892825733 23.33207689408217 24.890061565523308 66-67 27.17800652774291 25.54607080090384 22.89731358272659 24.378609088626664 68-69 27.208747015206736 24.494156088978258 23.01118512002011 25.2859117757949 70-71 26.923076923076923 25.1131221719457 22.863247863247864 25.100553041729512 72-73 26.717942251922832 24.612280922960533 23.729668389862564 24.940108435254064 74-75 26.578699340245056 21.40837484852565 25.55540595125892 26.45751985997038 76 29.69674556213018 0.0 35.20710059171598 35.09615384615385 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.5 4 1.0 5 1.5 6 1.0 7 1.0 8 2.0 9 1.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 1.5 19 1.0 20 0.5 21 1.5 22 2.0 23 1.5 24 1.5 25 2.5 26 4.0 27 4.5 28 6.5 29 10.5 30 12.5 31 17.5 32 24.0 33 28.5 34 41.5 35 52.5 36 67.0 37 86.0 38 113.0 39 140.0 40 141.5 41 158.5 42 186.0 43 196.0 44 203.0 45 211.0 46 221.5 47 213.0 48 204.0 49 201.0 50 193.0 51 176.5 52 161.0 53 156.0 54 147.0 55 128.0 56 113.0 57 108.0 58 98.0 59 92.0 60 87.5 61 79.0 62 74.5 63 79.5 64 81.0 65 79.0 66 83.5 67 88.0 68 87.5 69 83.0 70 81.0 71 81.5 72 67.5 73 48.5 74 41.5 75 43.0 76 43.5 77 35.5 78 20.0 79 11.0 80 9.5 81 8.5 82 6.0 83 5.0 84 7.0 85 5.0 86 1.5 87 1.0 88 0.5 89 1.0 90 1.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.2 3 0.125 4 0.125 5 0.125 6 0.125 7 0.125 8 0.15 9 0.17500000000000002 10-11 0.21250000000000002 12-13 0.22499999999999998 14-15 0.3375 16-17 0.3875 18-19 0.35000000000000003 20-21 0.42500000000000004 22-23 0.42500000000000004 24-25 0.4 26-27 0.5 28-29 0.3 30-31 0.3125 32-33 0.3375 34-35 0.475 36-37 0.3003754693366708 38-39 0.2753441802252816 40-41 0.1251721116535236 42-43 0.23785678517776665 44-45 0.2754131196795193 46-47 0.12518778167250877 48-49 0.30045067601402103 50-51 0.2253380070105158 52-53 0.3004882934769 54-55 0.2004259050482275 56-57 0.18792282635930843 58-59 0.26309195690303183 60-61 0.26309195690303183 62-63 0.16288685628367372 64-65 0.23815492604662825 66-67 0.11285266457680251 68-69 0.18815855494229805 70-71 0.1380695368394628 72-73 0.08818342151675485 74-75 0.12103281334050564 76 0.11082379017362395 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 5.0 36 0.0 37 0.0 38 0.0 39 0.0 40 1.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 1.0 53 1.0 54 1.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 2.0 65 0.0 66 1.0 67 0.0 68 2.0 69 1.0 70 1.0 71 4.0 72 20.0 73 102.0 74 278.0 75 872.0 76 2707.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84966173891256 99.625 2 0.12528188423953898 0.25 3 0.0 0.0 4 0.0 0.0 5 0.025056376847907794 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 743062 spots for SRR11389780.sra Written 743062 spots for SRR11389780.sra Read 743062 spots for SRR11389780.sra Written 743062 spots for SRR11389780.sra Read 743062 spots for SRR11389780.sra Written 743062 spots for SRR11389780.sra Read 743062 spots for SRR11389780.sra Written 743062 spots for SRR11389780.sra Read 743062 spots for SRR11389780.sra Written 743062 spots for SRR11389780.sra Read 743062 spots for SRR11389780.sra Written 743062 spots for SRR11389780.sra Read 743062 spots for SRR11389780.sra Written 743062 spots for SRR11389780.sra Read 743062 spots for SRR11389780.sra Written 743062 spots for SRR11389780.sra Read 743062 spots for SRR11389780.sra Written 743062 spots for SRR11389780.sra Read 743062 spots for SRR11389780.sra Written 743062 spots for SRR11389780.sra Read 743062 spots for SRR11389780.sra Written 743062 spots for SRR11389780.sra Read 743062 spots for SRR11389780.sra Written 743062 spots for SRR11389780.sra Read 743062 spots for SRR11389780.sra Written 743062 spots for SRR11389780.sra Read 743072 spots for SRR11389780.sra Written 743072 spots for SRR11389780.sra Read 743062 spots for SRR11389780.sra Written 743062 spots for SRR11389780.sra Read 743062 spots for SRR11389780.sra Written 743062 spots for SRR11389780.sra Read 743062 spots for SRR11389780.sra Written 743062 spots for SRR11389780.sra Read 743062 spots for SRR11389780.sra Written 743062 spots for SRR11389780.sra Read 743062 spots for SRR11389780.sra Written 743062 spots for SRR11389780.sra Read 743062 spots for SRR11389780.sra Written 743062 spots for SRR11389780.sra SRR ids: ['SRR11389780.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_56mtvcc4 SRR11389780.sra spots: 14861250 blocks: [[1, 743062], [743063, 1486124], [1486125, 2229186], [2229187, 2972248], [2972249, 3715310], [3715311, 4458372], [4458373, 5201434], [5201435, 5944496], [5944497, 6687558], [6687559, 7430620], [7430621, 8173682], [8173683, 8916744], [8916745, 9659806], [9659807, 10402868], [10402869, 11145930], [11145931, 11888992], [11888993, 12632054], [12632055, 13375116], [13375117, 14118178], [14118179, 14861250]] SRR11389780 file size 2823714 SRR11389780 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389780 SRR11389780_1.fastq SRR11389780_2.fastq Input file: SRR11389780_1.fastq Paired file: SRR11389780_2.fastq trimmed: SRR11389780-trimmed-pair1.fastq, SRR11389780-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:18:11 2024 >> started Sat Dec 7 06:18:24 2024 >> done (13.335s) 14861250 read pairs processed; of these: 488 ( 0.00%) short read pairs filtered out after trimming by size control 6101 ( 0.04%) empty read pairs filtered out after trimming by size control 14854661 (99.96%) read pairs available; of these: 6277 ( 0.04%) trimmed read pairs available after processing 14848384 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 4 0.00% 21 4 0.00% 22 1 0.00% 23 3 0.00% 24 7 0.00% 25 2 0.00% 26 6 0.00% 27 5 0.00% 28 8 0.00% 29 8 0.00% 30 7 0.00% 31 9 0.00% 32 4 0.00% 33 12 0.00% 34 8 0.00% 35 161 0.00% 36 163 0.00% 37 188 0.00% 38 191 0.00% 39 217 0.00% 40 237 0.00% 41 267 0.00% 42 280 0.00% 43 312 0.00% 44 326 0.00% 45 380 0.00% 46 372 0.00% 47 405 0.00% 48 408 0.00% 49 463 0.00% 50 447 0.00% 51 549 0.00% 52 556 0.00% 53 605 0.00% 54 659 0.00% 55 876 0.01% 56 975 0.01% 57 1013 0.01% 58 1111 0.01% 59 1252 0.01% 60 1232 0.01% 61 1256 0.01% 62 1392 0.01% 63 1577 0.01% 64 1743 0.01% 65 1952 0.01% 66 2183 0.01% 67 2422 0.02% 68 2308 0.02% 69 2641 0.02% 70 3561 0.02% 71 4640 0.03% 72 13122 0.09% 73 126353 0.85% 74 1096699 7.38% 75 6666108 44.88% 76 6912969 46.54% 14854661 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=194.13 fanout-score-rank=14 prefix-density=0.60 prefix-fanout=23.9 sequence=GCGGCGGCGGCG criterion=fanout-score sequence-density=0.04 sequence-density-rank=24 fanout-score=495.57 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=33.2 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=122.60 fanout-score-rank=21 prefix-density=1.26 prefix-fanout=19.2 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=33 fanout-score=500.81 fanout-score-rank=1 prefix-density=1.26 prefix-fanout=19.2 sequence=CGCCGCCGCCACC SRR11389780 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:18:54 Started mapping on | Dec 07 06:18:54 Finished on | Dec 07 06:20:24 Mapping speed, Million of reads per hour | 594.19 Number of input reads | 14854661 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 13853201 Uniquely mapped reads % | 93.26% Average mapped length | 149.88 Number of splices: Total | 6256560 Number of splices: Annotated (sjdb) | 5961601 Number of splices: GT/AG | 6172809 Number of splices: GC/AG | 73460 Number of splices: AT/AC | 5183 Number of splices: Non-canonical | 5108 Mismatch rate per base, % | 1.24% Deletion rate per base | 0.01% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 247699 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 26305 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.14% % of reads unmapped: other | 0.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 753762 753762 753762 N_multimapping 247699 247699 247699 N_noFeature 519106 13539859 637226 N_ambiguous 233388 1985 40008 UnstrandedReadsAssigned:13100707 PositiveStrandReadsAssigned:311357 NegativeStrandReadsAssigned:13175967 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389780 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389780-trimmed-pair1.fastq SRR11389780-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,854,661 reads, 13,441,989 reads pseudoaligned [quant] estimated average fragment length: 198.716 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,098 rounds 52973 SRR11389780.ke.tsv 35125 SRR11389780.se.tsv 88098 total ==> SRR11389780.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 738.515 22.7658 3.53876 PNS24247 1044 846.284 56.9812 7.72937 PNS24249 1928 1730.28 500.252 33.1895 PNS24246 1044 846.284 56.9812 7.72937 PNS24248 1044 846.284 56.9812 7.72937 PNS24244 1471 1273.28 44.0382 3.97038 PNS24243 293 109.335 0 0 KQK14069 1603 1405.28 237.656 19.4139 KQK14071 474 278.207 33.4528 13.8036 ==> SRR11389780.se.tsv <== BRADI_1g14170v3 347 BRADI_1g53295v3 29 BRADI_1g59795v3 234 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 854 BRADI_1g74790v3 14 BRADI_1g09890v3 0 BRADI_1g77505v3 272 BRADI_1g48960v3 1 SRR11389780 completed mapping pipeline successfully