Starting /dee2/code/volunteer_pipeline.sh SRR11389782 current disk space = 1545638674432 free memory = 1444335796 SRR11389782 SRAfilesize 2451ff6d56c38fc31ac6090d69e88a3e SRR11389782.sra SRR11389782.sra file validated SRR11389782 is paired end SRR11389782 is conventional basespace SRR11389782 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389782_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.51175 32.0 32.0 32.0 32.0 32.0 2 30.3755 32.0 32.0 32.0 32.0 32.0 3 30.5015 32.0 32.0 32.0 32.0 32.0 4 30.3725 32.0 32.0 32.0 32.0 32.0 5 30.44475 32.0 32.0 32.0 32.0 32.0 6 33.5115 36.0 36.0 36.0 32.0 36.0 7 33.38325 36.0 36.0 36.0 32.0 36.0 8 33.31275 36.0 36.0 36.0 27.0 36.0 9 33.596 36.0 36.0 36.0 32.0 36.0 10-11 33.359125 36.0 36.0 36.0 26.5 36.0 12-13 33.533500000000004 36.0 36.0 36.0 32.0 36.0 14-15 33.399375 36.0 36.0 36.0 32.0 36.0 16-17 33.432125 36.0 36.0 36.0 32.0 36.0 18-19 33.436375 36.0 36.0 36.0 32.0 36.0 20-21 33.388 36.0 36.0 36.0 26.5 36.0 22-23 33.24975 36.0 36.0 36.0 24.0 36.0 24-25 33.072 36.0 36.0 36.0 21.0 36.0 26-27 32.8765 36.0 36.0 36.0 17.5 36.0 28-29 32.852999999999994 36.0 36.0 36.0 21.0 36.0 30-31 32.774375000000006 36.0 36.0 36.0 14.0 36.0 32-33 32.599374999999995 36.0 36.0 36.0 14.0 36.0 34-35 32.715375 36.0 36.0 36.0 14.0 36.0 36-37 33.47461538461538 36.0 36.0 36.0 27.0 36.0 38-39 33.334102564102565 36.0 36.0 36.0 24.0 36.0 40-41 33.1670614095659 36.0 36.0 36.0 17.5 36.0 42-43 33.229674275455245 36.0 36.0 36.0 21.0 36.0 44-45 33.175557835342396 36.0 36.0 36.0 17.5 36.0 46-47 32.86919723005899 36.0 36.0 36.0 14.0 36.0 48-49 32.7295460374455 36.0 36.0 36.0 14.0 36.0 50-51 32.863170043600924 36.0 36.0 36.0 14.0 36.0 52-53 32.70825852782765 36.0 34.0 36.0 14.0 36.0 54-55 32.49345986150295 36.0 36.0 36.0 14.0 36.0 56-57 32.45139779430623 36.0 34.0 36.0 14.0 36.0 58-59 32.16234932033855 36.0 32.0 36.0 14.0 36.0 60-61 32.07976404206207 36.0 32.0 36.0 14.0 36.0 62-63 31.808876346844535 36.0 32.0 36.0 14.0 36.0 64-65 31.70035915854284 36.0 32.0 36.0 14.0 36.0 66-67 31.491534120061573 36.0 32.0 36.0 14.0 36.0 68-69 31.491790661877886 36.0 32.0 36.0 14.0 36.0 70-71 31.287852530938153 36.0 32.0 36.0 14.0 36.0 72-73 31.156976215936652 36.0 32.0 36.0 14.0 36.0 74-75 31.04246632442955 36.0 32.0 36.0 14.0 36.0 76 30.185365853658535 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 100.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 3.0 23 7.0 24 16.0 25 20.0 26 48.0 27 75.0 28 104.0 29 164.0 30 251.0 31 363.0 32 512.0 33 794.0 34 1037.0 35 506.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.30769230769231 10.948717948717949 9.615384615384617 41.12820512820513 2 27.256410256410255 11.948717948717949 35.69230769230769 25.102564102564102 3 24.17948717948718 18.69230769230769 21.666666666666668 35.46153846153846 4 31.538461538461537 24.76923076923077 18.358974358974358 25.333333333333336 5 29.615384615384617 29.05128205128205 21.974358974358974 19.35897435897436 6 23.852269812772505 31.41831238779174 23.59579379328033 21.133624006155426 7 19.71794871794872 23.358974358974358 36.333333333333336 20.589743589743588 8 19.46153846153846 22.205128205128204 32.97435897435898 25.358974358974358 9 20.666666666666668 19.05128205128205 33.15384615384615 27.12820512820513 10-11 23.807692307692307 29.76923076923077 23.153846153846153 23.26923076923077 12-13 24.14102564102564 22.602564102564102 26.282051282051285 26.974358974358974 14-15 24.474358974358974 24.935897435897438 25.756410256410255 24.833333333333332 16-17 24.94871794871795 24.794871794871796 24.05128205128205 26.205128205128204 18-19 25.602564102564102 24.423076923076923 24.358974358974358 25.615384615384617 20-21 24.833333333333332 24.0 24.756410256410255 26.410256410256412 22-23 24.858974358974358 25.153846153846153 23.910256410256412 26.076923076923077 24-25 24.05128205128205 24.679487179487182 24.23076923076923 27.03846153846154 26-27 25.333333333333336 24.94871794871795 24.269230769230766 25.44871794871795 28-29 24.333333333333336 25.0 24.5 26.166666666666664 30-31 24.307692307692307 24.833333333333332 24.807692307692307 26.051282051282048 32-33 24.602564102564102 24.55128205128205 24.858974358974358 25.987179487179485 34-35 25.91025641025641 24.243589743589745 24.487179487179485 25.358974358974358 36-37 25.78205128205128 24.641025641025642 23.205128205128204 26.371794871794872 38-39 25.166666666666664 24.346153846153847 24.205128205128204 26.282051282051285 40-41 24.015899474291576 24.772406718810103 24.631362995255802 26.580330811642515 42-43 25.621954347268534 23.185432162092845 24.737112080020516 26.45550141061811 44-45 24.980764298538087 23.531674788407283 24.04462682739164 27.44293408566299 46-47 25.532187740446265 24.442164657604515 24.057450628366247 25.96819697358297 48-49 25.532187740446265 23.967684021543985 23.724031803026417 26.776096434983327 50-51 24.96794049756348 25.36547832777635 23.057194152346757 26.609387022313413 52-53 25.237240318030263 23.57014619133111 23.749679404975634 27.44293408566299 54-55 25.250064119004872 24.519107463452166 23.954860220569376 26.275968196973583 56-57 24.570402667350603 23.826622210823288 24.762759681969737 26.840215439856372 58-59 25.121826109258784 24.083098230315468 24.352398050782252 26.4426776096435 60-61 25.2885355219287 23.493203385483458 23.506027186458066 27.71223390612978 62-63 24.94869163673679 23.66598255515649 24.43560800410467 26.949717804002056 64-65 26.52642380708055 23.935351462288352 23.35813237557722 26.180092355053873 66-67 24.74345818368394 25.269368907131863 23.473576192919445 26.513596716264754 68-69 25.667008722421752 23.063109286813752 24.371472550025654 26.898409440738842 70-71 25.035288079045298 23.302964198639806 24.509174900551777 27.152572821763123 72-73 25.32249742002064 23.52941176470588 23.516511867905056 27.631578947368425 74-75 25.71661459040891 20.187474527917402 25.743784811846215 28.35212606982747 76 30.43151969981238 0.0 31.36960600375234 38.19887429643527 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 101.0 1 50.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 4.5 20 7.0 21 7.0 22 7.0 23 6.0 24 4.5 25 4.0 26 4.0 27 12.5 28 20.0 29 22.5 30 26.5 31 32.5 32 42.5 33 47.0 34 45.5 35 63.0 36 92.0 37 111.5 38 114.5 39 118.5 40 133.0 41 154.0 42 174.0 43 187.0 44 205.0 45 191.5 46 171.5 47 166.0 48 163.5 49 156.0 50 141.5 51 131.0 52 116.0 53 115.5 54 119.0 55 116.0 56 117.0 57 117.5 58 115.5 59 120.5 60 123.0 61 118.5 62 116.0 63 103.0 64 100.5 65 109.5 66 105.0 67 97.0 68 88.0 69 65.5 70 55.0 71 55.5 72 49.5 73 49.5 74 43.0 75 33.5 76 29.0 77 23.5 78 19.5 79 16.0 80 12.0 81 8.5 82 4.5 83 4.0 84 5.5 85 4.5 86 2.0 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5 2 2.5 3 2.5 4 2.5 5 2.5 6 2.5250000000000004 7 2.5 8 2.5 9 2.5 10-11 2.5 12-13 2.5 14-15 2.5 16-17 2.5 18-19 2.5 20-21 2.5 22-23 2.5 24-25 2.5 26-27 2.5 28-29 2.5 30-31 2.5 32-33 2.5 34-35 2.5 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 100.0 36 0.0 37 0.0 38 0.0 39 0.0 40 1.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 3.0 71 10.0 72 18.0 73 62.0 74 249.0 75 891.0 76 2665.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.05672268907563 93.35 2 1.628151260504202 3.1 3 0.1838235294117647 0.525 4 0.052521008403361345 0.2 5 0.026260504201680673 0.125 6 0.0 0.0 7 0.0 0.0 8 0.026260504201680673 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.026260504201680673 2.5 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 100 2.5 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 8 0.2 No Hit GTCAATTCAGATTATTCCAAAACCAGATTATTTGTTTGTTTGTTTCCCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 57 0.05 0.0 0.0 0.0 0.0 58 0.05 0.0 0.0 0.0 0.0 59 0.05 0.0 0.0 0.0 0.0 60 0.05 0.0 0.0 0.0 0.0 61 0.05 0.0 0.0 0.0 0.0 62 0.05 0.0 0.0 0.0 0.0 63 0.05 0.0 0.0 0.0 0.0 64 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389782 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389782_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.18075 32.0 32.0 32.0 32.0 32.0 2 29.784 32.0 32.0 32.0 21.0 32.0 3 29.649 32.0 32.0 32.0 21.0 32.0 4 29.69825 32.0 32.0 32.0 21.0 32.0 5 29.79275 32.0 32.0 32.0 21.0 32.0 6 32.84475 36.0 36.0 36.0 21.0 36.0 7 32.9295 36.0 36.0 36.0 21.0 36.0 8 33.03175 36.0 36.0 36.0 21.0 36.0 9 32.96575 36.0 36.0 36.0 21.0 36.0 10-11 32.831500000000005 36.0 36.0 36.0 17.5 36.0 12-13 32.860749999999996 36.0 36.0 36.0 21.0 36.0 14-15 32.754125 36.0 36.0 36.0 14.0 36.0 16-17 32.701375 36.0 36.0 36.0 14.0 36.0 18-19 32.784375 36.0 36.0 36.0 14.0 36.0 20-21 32.710375 36.0 36.0 36.0 14.0 36.0 22-23 32.771625 36.0 36.0 36.0 14.0 36.0 24-25 32.39775 36.0 36.0 36.0 14.0 36.0 26-27 32.405 36.0 36.0 36.0 14.0 36.0 28-29 32.397000000000006 36.0 36.0 36.0 14.0 36.0 30-31 32.2705 36.0 36.0 36.0 14.0 36.0 32-33 32.199375 36.0 36.0 36.0 14.0 36.0 34-35 32.16525 36.0 36.0 36.0 14.0 36.0 36-37 32.82952796305798 36.0 36.0 36.0 14.0 36.0 38-39 32.75661778481902 36.0 36.0 36.0 14.0 36.0 40-41 32.738029417130974 36.0 36.0 36.0 14.0 36.0 42-43 32.718541345659986 36.0 36.0 36.0 14.0 36.0 44-45 32.54969183359014 36.0 36.0 36.0 14.0 36.0 46-47 32.488315356959426 36.0 36.0 36.0 14.0 36.0 48-49 32.227786337955834 36.0 34.0 36.0 14.0 36.0 50-51 32.256291730868 36.0 32.0 36.0 14.0 36.0 52-53 32.07973805855162 36.0 34.0 36.0 14.0 36.0 54-55 31.667051874678993 36.0 32.0 36.0 14.0 36.0 56-57 31.79738058551618 36.0 32.0 36.0 14.0 36.0 58-59 31.66474062660503 36.0 32.0 36.0 14.0 36.0 60-61 31.508859784283512 36.0 32.0 36.0 14.0 36.0 62-63 31.416131518109427 36.0 32.0 36.0 14.0 36.0 64-65 31.206524531209865 36.0 32.0 36.0 14.0 36.0 66-67 31.343950680708964 36.0 32.0 36.0 14.0 36.0 68-69 30.95671718469047 36.0 29.5 36.0 14.0 36.0 70-71 30.859235085223844 36.0 32.0 36.0 14.0 36.0 72-73 30.80276497806709 36.0 29.5 36.0 14.0 36.0 74-75 30.497963539533714 36.0 27.0 36.0 14.0 36.0 76 29.46454678362573 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 102.0 3 0.0 4 0.0 5 2.0 6 1.0 7 0.0 8 1.0 9 0.0 10 1.0 11 2.0 12 0.0 13 0.0 14 1.0 15 4.0 16 6.0 17 0.0 18 5.0 19 4.0 20 9.0 21 13.0 22 23.0 23 24.0 24 42.0 25 56.0 26 83.0 27 93.0 28 137.0 29 208.0 30 236.0 31 307.0 32 470.0 33 659.0 34 967.0 35 544.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.02386451116243 21.78598922247883 9.674108288426995 37.516037977931745 2 30.518480492813143 22.279260780287473 29.158110882956876 18.044147843942504 3 22.70395074397127 27.834787070292457 22.062596203181116 27.398665982555155 4 26.603386351975374 32.837352488455615 17.573114417650075 22.986146741918933 5 28.732683427398666 31.990764494612623 19.035402770651615 20.241149307337096 6 23.345305284761416 33.27347357619292 20.651616213442793 22.72960492560287 7 23.499230374551054 16.777834787070294 34.68445356593124 25.03848127244741 8 23.909697280656747 20.420728578758336 24.987172909184196 30.682401231400718 9 23.710546574287914 21.45239928149859 26.148319219912754 28.688734924300746 10-11 26.68806161745828 28.138639281129652 19.845956354300384 25.32734274711168 12-13 27.401129943502823 20.891114535182332 23.382126348228045 28.325629173086803 14-15 26.01542416452442 24.087403598971722 23.65038560411311 26.246786632390744 16-17 26.674379740326522 23.177786347859623 22.792132664866948 27.355701246946907 18-19 26.539005269245596 22.86338516900141 23.647346099473076 26.95026346227991 20-21 26.591230551626595 25.202520252025202 22.27079850842227 25.935450687925936 22-23 27.41064541013114 23.450758549755722 23.412188223193624 25.726407816919515 24-25 26.61010412649441 23.43488880318807 23.06209024296182 26.8929168273557 26-27 26.401748971193417 24.56275720164609 23.199588477366255 25.835905349794235 28-29 27.216653816499615 24.325366229760988 21.88383448984837 26.57414546389103 30-31 26.73178254723043 24.264233389024547 22.979051535792312 26.024932527952704 32-33 26.204857987405216 25.382341601336588 22.953347898727667 25.45945251253052 34-35 26.574955001285677 24.479300591411672 22.62792491643096 26.317819490871692 36-37 25.8968754018259 24.508165102224506 23.453773948823454 26.14118554712614 38-39 26.874115983026876 23.38948180532339 23.505207663623505 26.23119454802623 40-41 27.95270530780105 23.878678833054877 22.58064516129032 25.587970697853745 42-43 25.964506172839506 25.295781893004115 21.75925925925926 26.98045267489712 44-45 27.404835390946502 23.675411522633745 22.775205761316872 26.14454732510288 46-47 26.648669494793676 25.003213780691606 22.11081115824656 26.23730556626816 48-49 26.838991769547327 23.469650205761315 23.482510288065843 26.20884773662551 50-51 27.462072512213936 24.247878632039086 22.83363332476215 25.456415530984827 52-53 27.737038466486556 24.14769072430207 22.29512414769072 25.82014666152065 54-55 27.24701041532725 24.495306673524496 22.823710942522823 25.433971968625436 56-57 26.664952429930572 24.35073283620468 22.64078169195166 26.343533041913087 58-59 27.11493957315505 24.59501157109797 21.663666752378504 26.626382103368474 60-61 27.17335390946502 23.932613168724277 22.415123456790123 26.47890946502058 62-63 26.514079979426512 24.726758390124726 22.656551369422655 26.102610261026104 64-65 27.112540192926044 24.0 22.778135048231512 26.109324758842444 66-67 26.7772207224579 24.16763080087415 22.547885332304922 26.50726314436303 68-69 26.56893004115226 24.395576131687243 22.968106995884774 26.06738683127572 70-71 26.351003602676276 24.26659804426145 22.568193515182706 26.81420483787957 72-73 26.106080206985773 23.829236739974128 23.208279430789133 26.85640362225097 74-75 27.837727086463598 20.93976232755088 24.463871055866683 26.758639530118838 76 29.637760702524695 0.0 32.41858763263812 37.943651664837176 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 103.0 1 51.5 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 1.5 10 2.0 11 1.0 12 1.0 13 1.0 14 0.5 15 1.5 16 2.5 17 2.0 18 5.0 19 5.0 20 3.0 21 4.0 22 6.5 23 9.5 24 10.5 25 13.5 26 15.0 27 14.0 28 18.5 29 21.5 30 21.0 31 25.5 32 29.0 33 30.0 34 38.5 35 59.0 36 71.0 37 80.5 38 105.0 39 114.5 40 120.5 41 134.0 42 131.5 43 145.0 44 164.0 45 163.0 46 159.5 47 153.0 48 149.5 49 143.5 50 133.5 51 128.0 52 124.0 53 108.0 54 98.0 55 103.5 56 105.5 57 123.5 58 141.5 59 139.5 60 140.5 61 137.0 62 129.5 63 130.5 64 122.0 65 100.5 66 100.5 67 113.0 68 107.0 69 89.5 70 83.0 71 83.5 72 76.0 73 65.0 74 50.5 75 43.5 76 38.0 77 29.5 78 22.5 79 15.5 80 12.0 81 9.5 82 5.0 83 2.0 84 5.0 85 4.0 86 1.0 87 1.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 2.5 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5749999999999997 2 2.6 3 2.55 4 2.55 5 2.55 6 2.55 7 2.55 8 2.55 9 2.5749999999999997 10-11 2.625 12-13 2.65 14-15 2.75 16-17 2.7625 18-19 2.7375 20-21 2.7875 22-23 2.775 24-25 2.7625 26-27 2.8000000000000003 28-29 2.725 30-31 2.7375 32-33 2.7375 34-35 2.775 36-37 0.24371472550025652 38-39 0.2309172546504169 40-41 0.11553273427471118 42-43 0.15408320493066258 44-45 0.15408320493066258 46-47 0.11556240369799693 48-49 0.15408320493066258 50-51 0.12840267077555212 52-53 0.1926040061633282 54-55 0.14124293785310735 56-57 0.12840267077555212 58-59 0.12840267077555212 60-61 0.15408320493066258 62-63 0.11559208836372976 64-65 0.14127921911122526 66-67 0.08990495761623427 68-69 0.12843565373747753 70-71 0.10282776349614395 72-73 0.09047434406100556 74-75 0.12278308321964529 76 0.10964912280701754 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 102.0 36 0.0 37 0.0 38 1.0 39 1.0 40 2.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 6.0 71 8.0 72 21.0 73 84.0 74 218.0 75 820.0 76 2736.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.15 #Duplication Level Percentage of deduplicated Percentage of total 1 97.89805570152392 93.15 2 1.8392012611665791 3.5000000000000004 3 0.13137151865475566 0.375 4 0.0788229111928534 0.3 5 0.02627430373095113 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.02627430373095113 2.55 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 102 2.55 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 987052 spots for SRR11389782.sra Written 987052 spots for SRR11389782.sra Read 987052 spots for SRR11389782.sra Written 987052 spots for SRR11389782.sra Read 987052 spots for SRR11389782.sra Written 987052 spots for SRR11389782.sra Read 987052 spots for SRR11389782.sra Written 987052 spots for SRR11389782.sra Read 987052 spots for SRR11389782.sra Written 987052 spots for SRR11389782.sra Read 987052 spots for SRR11389782.sra Written 987052 spots for SRR11389782.sra Read 987052 spots for SRR11389782.sra Written 987052 spots for SRR11389782.sra Read 987052 spots for SRR11389782.sra Written 987052 spots for SRR11389782.sra Read 987052 spots for SRR11389782.sra Written 987052 spots for SRR11389782.sra Read 987052 spots for SRR11389782.sra Written 987052 spots for SRR11389782.sra Read 987052 spots for SRR11389782.sra Written 987052 spots for SRR11389782.sra Read 987052 spots for SRR11389782.sra Written 987052 spots for SRR11389782.sra Read 987059 spots for SRR11389782.sra Written 987059 spots for SRR11389782.sra Read 987052 spots for SRR11389782.sra Written 987052 spots for SRR11389782.sra Read 987052 spots for SRR11389782.sra Written 987052 spots for SRR11389782.sra Read 987052 spots for SRR11389782.sra Written 987052 spots for SRR11389782.sra Read 987052 spots for SRR11389782.sra Written 987052 spots for SRR11389782.sra Read 987052 spots for SRR11389782.sra Written 987052 spots for SRR11389782.sra Read 987052 spots for SRR11389782.sra Written 987052 spots for SRR11389782.sra Read 987052 spots for SRR11389782.sra Written 987052 spots for SRR11389782.sra SRR ids: ['SRR11389782.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_btqicth4 SRR11389782.sra spots: 19741047 blocks: [[1, 987052], [987053, 1974104], [1974105, 2961156], [2961157, 3948208], [3948209, 4935260], [4935261, 5922312], [5922313, 6909364], [6909365, 7896416], [7896417, 8883468], [8883469, 9870520], [9870521, 10857572], [10857573, 11844624], [11844625, 12831676], [12831677, 13818728], [13818729, 14805780], [14805781, 15792832], [15792833, 16779884], [16779885, 17766936], [17766937, 18753988], [18753989, 19741047]] SRR11389782 file size 3711871 SRR11389782 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389782 SRR11389782_1.fastq SRR11389782_2.fastq Input file: SRR11389782_1.fastq Paired file: SRR11389782_2.fastq trimmed: SRR11389782-trimmed-pair1.fastq, SRR11389782-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:18:11 2024 >> started Sat Dec 7 06:19:10 2024 >> done (58.961s) 19741047 read pairs processed; of these: 1119 ( 0.01%) short read pairs filtered out after trimming by size control 641155 ( 3.25%) empty read pairs filtered out after trimming by size control 19098773 (96.75%) read pairs available; of these: 25027 ( 0.13%) trimmed read pairs available after processing 19073746 (99.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 594 0.00% 19 7 0.00% 20 1091 0.01% 21 5 0.00% 22 1431 0.01% 23 12 0.00% 24 1861 0.01% 25 18 0.00% 26 2074 0.01% 27 15 0.00% 28 2220 0.01% 29 26 0.00% 30 1977 0.01% 31 23 0.00% 32 1690 0.01% 33 16 0.00% 34 1414 0.01% 35 108 0.00% 36 4360 0.02% 37 115 0.00% 38 2486 0.01% 39 131 0.00% 40 1230 0.01% 41 138 0.00% 42 627 0.00% 43 155 0.00% 44 526 0.00% 45 175 0.00% 46 276 0.00% 47 175 0.00% 48 322 0.00% 49 206 0.00% 50 292 0.00% 51 250 0.00% 52 307 0.00% 53 301 0.00% 54 295 0.00% 55 698 0.00% 56 3643 0.02% 57 1857 0.01% 58 921 0.00% 59 1012 0.01% 60 1051 0.01% 61 825 0.00% 62 838 0.00% 63 1013 0.01% 64 1129 0.01% 65 1323 0.01% 66 1426 0.01% 67 1766 0.01% 68 1690 0.01% 69 1975 0.01% 70 2898 0.02% 71 4612 0.02% 72 20362 0.11% 73 165750 0.87% 74 1282995 6.72% 75 8413637 44.05% 76 9160403 47.96% 19098773 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=33 prefix-density=0.56 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=15.49 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=1.2 sequence=CAAAAACAGCTAATTGGAAAGCAATAGTCATATTTCTAATCCTCCAAGCTATCATCAAATAAAGTTGACTACATATTTGATCCCTCACTTAACCTAAATTGTAAAAAATACAAGAAGTAGGAGGGGTTTAATCATGAATCCATTGATTCTTCTCTTTAATTAATAATTAAAACTTATTACTTACCGCTTTTATTTGGATATGGGGATTAGGGTAGGGGATTTAGTCTTTATTTCAAAAGCGGGTATAGCGGATCTTCTATCCGTGTATACAGTATACAGAAATATATCGAAAAAGGATTTGCATCTGAGATGTTTCTAGAGGTTAGTAGATCCTTTTATTTTTATATGGCTGTGTTCTATTTCTAGGAGTAAAATAGGGATTAAGCTGTGGAGAGATGGCTGAGTGGTTGATAGCTCCGGTCTTGAAAACCGGTATAGTTCTAGGAACTATCGAGGGTTCGAATCCCTCTCTCTCCTTTTGC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=30 prefix-density=0.33 prefix-fanout=1.9 sequence=GACGCCTATGTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCC criterion=fanout-score sequence-density=0.15 sequence-density-rank=15 fanout-score=103.84 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=16.1 sequence=GCCGCCGCCGCCTCC SRR11389782 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:20:22 Started mapping on | Dec 07 06:20:23 Finished on | Dec 07 06:26:07 Mapping speed, Million of reads per hour | 199.87 Number of input reads | 19098773 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 15961571 Uniquely mapped reads % | 83.57% Average mapped length | 149.90 Number of splices: Total | 6177575 Number of splices: Annotated (sjdb) | 5882297 Number of splices: GT/AG | 6097197 Number of splices: GC/AG | 69333 Number of splices: AT/AC | 1902 Number of splices: Non-canonical | 9143 Mismatch rate per base, % | 1.30% Deletion rate per base | 0.01% Deletion average length | 1.71 Insertion rate per base | 0.01% Insertion average length | 1.83 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1996994 % of reads mapped to multiple loci | 10.46% Number of reads mapped to too many loci | 49861 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.50% % of reads unmapped: other | 1.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1140212 1140212 1140212 N_multimapping 1996994 1996994 1996994 N_noFeature 624955 15490308 782221 N_ambiguous 457657 2011 157024 UnstrandedReadsAssigned:14878959 PositiveStrandReadsAssigned:469252 NegativeStrandReadsAssigned:15022326 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389782 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389782-trimmed-pair1.fastq SRR11389782-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,098,773 reads, 16,844,121 reads pseudoaligned [quant] estimated average fragment length: 194.545 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52973 SRR11389782.ke.tsv 35125 SRR11389782.se.tsv 88098 total ==> SRR11389782.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 742.642 0 0 PNS24247 1044 850.455 30.617 2.87621 PNS24249 1928 1734.46 150.876 6.94971 PNS24246 1044 850.455 30.617 2.87621 PNS24248 1044 850.455 30.617 2.87621 PNS24244 1471 1277.46 59.2729 3.70698 PNS24243 293 112.268 0 0 KQK14069 1603 1409.46 5602.77 317.586 KQK14071 474 282.427 447.617 126.622 ==> SRR11389782.se.tsv <== BRADI_1g14170v3 6698 BRADI_1g53295v3 15 BRADI_1g59795v3 449 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 100 BRADI_1g74790v3 80 BRADI_1g09890v3 0 BRADI_1g77505v3 188 BRADI_1g48960v3 2 SRR11389782 completed mapping pipeline successfully