Starting /dee2/code/volunteer_pipeline.sh SRR11389784 current disk space = 1545762885632 free memory = 1598739400 SRR11389784 SRAfilesize e92f8d44c6c3aed5b1110ce4159127fd SRR11389784.sra SRR11389784.sra file validated SRR11389784 is paired end SRR11389784 is conventional basespace SRR11389784 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389784_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.93525 32.0 32.0 32.0 32.0 32.0 2 31.03 32.0 32.0 32.0 32.0 32.0 3 31.10375 32.0 32.0 32.0 32.0 32.0 4 31.15975 32.0 32.0 32.0 32.0 32.0 5 31.1825 32.0 32.0 32.0 32.0 32.0 6 34.11275 36.0 36.0 36.0 32.0 36.0 7 34.1535 36.0 36.0 36.0 32.0 36.0 8 34.0415 36.0 36.0 36.0 32.0 36.0 9 34.26175 36.0 36.0 36.0 32.0 36.0 10-11 34.161874999999995 36.0 36.0 36.0 32.0 36.0 12-13 34.393125 36.0 36.0 36.0 32.0 36.0 14-15 34.309375 36.0 36.0 36.0 32.0 36.0 16-17 34.18725 36.0 36.0 36.0 32.0 36.0 18-19 34.186375 36.0 36.0 36.0 32.0 36.0 20-21 34.0865 36.0 36.0 36.0 32.0 36.0 22-23 34.06625 36.0 36.0 36.0 32.0 36.0 24-25 33.948 36.0 36.0 36.0 32.0 36.0 26-27 33.835125 36.0 36.0 36.0 32.0 36.0 28-29 33.7515 36.0 36.0 36.0 29.5 36.0 30-31 33.65 36.0 36.0 36.0 29.5 36.0 32-33 33.529250000000005 36.0 36.0 36.0 27.0 36.0 34-35 33.435874999999996 36.0 36.0 36.0 27.0 36.0 36-37 33.665538847117794 36.0 36.0 36.0 29.5 36.0 38-39 33.52155388471178 36.0 36.0 36.0 27.0 36.0 40-41 33.45576441102757 36.0 36.0 36.0 27.0 36.0 42-43 33.15977443609023 36.0 36.0 36.0 17.5 36.0 44-45 33.00588972431078 36.0 36.0 36.0 14.0 36.0 46-47 33.053884711779446 36.0 36.0 36.0 14.0 36.0 48-49 33.056641604010025 36.0 36.0 36.0 17.5 36.0 50-51 32.952118419638964 36.0 36.0 36.0 17.5 36.0 52-53 32.84783153672599 36.0 36.0 36.0 14.0 36.0 54-55 32.687186559679034 36.0 36.0 36.0 14.0 36.0 56-57 32.53598294884654 36.0 36.0 36.0 14.0 36.0 58-59 32.39724858674343 36.0 34.0 36.0 14.0 36.0 60-61 32.24391773263105 36.0 32.0 36.0 14.0 36.0 62-63 32.13986452584044 36.0 32.0 36.0 14.0 36.0 64-65 32.1098845960863 36.0 32.0 36.0 14.0 36.0 66-67 31.7056640130696 36.0 32.0 36.0 14.0 36.0 68-69 31.732702068493687 36.0 32.0 36.0 14.0 36.0 70-71 31.59212585046904 36.0 32.0 36.0 14.0 36.0 72-73 31.520129811581448 36.0 32.0 36.0 14.0 36.0 74-75 31.452805669502034 36.0 32.0 36.0 14.0 36.0 76 30.64078027235922 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 4.0 24 8.0 25 25.0 26 45.0 27 78.0 28 129.0 29 169.0 30 257.0 31 310.0 32 460.0 33 691.0 34 1115.0 35 697.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.15538847117794 10.6265664160401 11.929824561403509 35.288220551378444 2 24.536340852130326 16.416040100250626 31.47869674185464 27.56892230576441 3 24.51127819548872 20.576441102756892 22.406015037593985 32.5062656641604 4 29.49874686716792 24.862155388471177 18.095238095238095 27.54385964912281 5 30.15037593984962 28.270676691729324 20.350877192982455 21.228070175438596 6 25.23833416959358 30.306071249372806 23.98394380331159 20.47165077772203 7 17.694235588972433 25.86466165413534 34.93734335839599 21.503759398496243 8 20.676691729323306 24.260651629072683 28.24561403508772 26.81704260651629 9 22.957393483709275 19.223057644110277 31.00250626566416 26.81704260651629 10-11 24.87468671679198 31.2280701754386 21.002506265664163 22.894736842105264 12-13 24.14786967418546 23.27067669172932 25.025062656641605 27.556390977443606 14-15 22.669172932330827 26.065162907268167 24.74937343358396 26.516290726817044 16-17 25.81453634085213 23.50877192982456 23.50877192982456 27.167919799498748 18-19 23.546365914786968 23.395989974937343 25.68922305764411 27.368421052631582 20-21 25.513784461152884 23.709273182957393 24.724310776942357 26.052631578947366 22-23 23.07017543859649 26.92982456140351 24.185463659147867 25.81453634085213 24-25 24.273182957393484 22.94486215538847 25.551378446115287 27.230576441102755 26-27 23.383458646616543 24.32330827067669 24.348370927318296 27.94486215538847 28-29 25.789473684210527 25.651629072681704 24.072681704260653 24.486215538847116 30-31 22.982456140350877 24.097744360902258 25.38847117794486 27.531328320802007 32-33 23.99749373433584 24.51127819548872 24.74937343358396 26.741854636591476 34-35 24.74937343358396 24.172932330827066 24.786967418546364 26.29072681704261 36-37 26.71679197994987 24.724310776942357 23.345864661654137 25.213032581453632 38-39 24.849624060150376 26.127819548872182 22.969924812030076 26.052631578947366 40-41 24.12280701754386 23.395989974937343 25.125313283208023 27.355889724310778 42-43 24.761904761904763 24.899749373433583 25.112781954887218 25.225563909774433 44-45 23.546365914786968 23.684210526315788 25.13784461152882 27.631578947368425 46-47 26.54135338345865 23.546365914786968 23.020050125313283 26.8922305764411 48-49 24.586466165413533 25.401002506265662 24.14786967418546 25.86466165413534 50-51 25.128462213309938 23.662113046747713 24.46421857375611 26.745206166186236 52-53 24.768112308849336 23.451992980696918 22.98821759839559 28.79167711205816 54-55 24.974924774322968 24.147442326980944 25.55165496489468 25.325977933801404 56-57 24.235205616850553 23.182046138415245 24.72417251755266 27.858575727181545 58-59 23.67398119122257 24.288401253918497 25.04075235109718 26.996865203761754 60-61 26.185101580135438 23.45121645347379 24.855781289189867 25.5079006772009 62-63 24.636226793778224 23.444555945810336 25.33868539889614 26.580531861515304 64-65 25.815353738083292 23.557451078775713 24.310085298544905 26.317109884596086 66-67 24.538722229195432 26.333626208108445 23.471821262708673 25.655830299987446 68-69 24.758196206506717 25.737972616505466 22.836327094586107 26.66750408240171 70-71 24.491078160341793 25.546619753706963 23.18421713998492 26.778084945966324 72-73 25.034647851833185 25.475620511528284 23.35895174499181 26.130779891646718 74-75 24.572192513368986 22.633689839572195 25.3475935828877 27.446524064171125 76 28.266470371733533 0.0 32.71991166728009 39.01361796098638 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 10.0 1 5.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 3.5 19 7.5 20 7.0 21 8.5 22 11.0 23 12.0 24 8.5 25 4.0 26 8.0 27 19.0 28 22.5 29 17.0 30 17.5 31 24.5 32 39.0 33 49.5 34 48.5 35 60.0 36 80.5 37 94.5 38 107.5 39 130.5 40 149.0 41 168.5 42 187.5 43 187.0 44 203.0 45 248.5 46 263.5 47 206.5 48 158.5 49 153.0 50 143.0 51 135.5 52 124.5 53 115.0 54 117.0 55 112.5 56 113.5 57 117.0 58 118.0 59 119.5 60 126.5 61 131.0 62 123.0 63 116.0 64 104.0 65 91.0 66 85.0 67 75.5 68 75.5 69 81.0 70 74.0 71 69.0 72 62.0 73 48.0 74 37.0 75 32.5 76 30.5 77 27.5 78 22.5 79 17.0 80 13.0 81 10.0 82 8.0 83 6.5 84 3.0 85 0.5 86 2.0 87 3.0 88 2.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.25 3 0.25 4 0.25 5 0.25 6 0.35000000000000003 7 0.25 8 0.25 9 0.25 10-11 0.25 12-13 0.25 14-15 0.25 16-17 0.25 18-19 0.25 20-21 0.25 22-23 0.25 24-25 0.25 26-27 0.25 28-29 0.25 30-31 0.25 32-33 0.25 34-35 0.25 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 10.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 1.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 2.0 66 1.0 67 2.0 68 1.0 69 0.0 70 2.0 71 6.0 72 7.0 73 56.0 74 338.0 75 854.0 76 2717.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.35 #Duplication Level Percentage of deduplicated Percentage of total 1 97.35029146793853 91.85 2 1.987281399046105 3.75 3 0.2649708532061473 0.75 4 0.21197668256491786 0.8 5 0.052994170641229466 0.25 6 0.026497085320614733 0.15 7 0.0 0.0 8 0.052994170641229466 0.4 9 0.0 0.0 >10 0.026497085320614733 0.25 >50 0.026497085320614733 1.7999999999999998 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 72 1.7999999999999998 TruSeq Adapter, Index 19 (97% over 38bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 10 0.25 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 8 0.2 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTAT 8 0.2 TruSeq Adapter, Index 19 (97% over 38bp) GCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACC 6 0.15 No Hit GAAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAATC 5 0.125 No Hit GCATTTCGTAACTTATTTTTTCTCTTTTTATTTTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389784 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389784_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.80925 32.0 32.0 32.0 32.0 32.0 2 30.1895 32.0 32.0 32.0 21.0 32.0 3 29.97275 32.0 32.0 32.0 21.0 32.0 4 29.75825 32.0 32.0 32.0 21.0 32.0 5 30.0765 32.0 32.0 32.0 21.0 32.0 6 33.20925 36.0 36.0 36.0 21.0 36.0 7 33.0045 36.0 36.0 36.0 21.0 36.0 8 33.05975 36.0 36.0 36.0 14.0 36.0 9 33.03275 36.0 36.0 36.0 14.0 36.0 10-11 32.887 36.0 36.0 36.0 17.5 36.0 12-13 32.921625 36.0 36.0 36.0 17.5 36.0 14-15 32.730999999999995 36.0 36.0 36.0 14.0 36.0 16-17 32.736125 36.0 36.0 36.0 14.0 36.0 18-19 32.724875 36.0 36.0 36.0 14.0 36.0 20-21 32.555625 36.0 36.0 36.0 14.0 36.0 22-23 32.566125 36.0 36.0 36.0 14.0 36.0 24-25 32.42725 36.0 36.0 36.0 14.0 36.0 26-27 32.46125 36.0 36.0 36.0 14.0 36.0 28-29 32.463499999999996 36.0 36.0 36.0 14.0 36.0 30-31 32.436375 36.0 36.0 36.0 14.0 36.0 32-33 32.374875 36.0 36.0 36.0 14.0 36.0 34-35 32.267375 36.0 36.0 36.0 14.0 36.0 36-37 32.24246987951807 36.0 34.0 36.0 14.0 36.0 38-39 32.11182228915663 36.0 36.0 36.0 14.0 36.0 40-41 32.21887550200803 36.0 36.0 36.0 14.0 36.0 42-43 31.944779116465863 36.0 34.0 36.0 14.0 36.0 44-45 32.03953313253012 36.0 34.0 36.0 14.0 36.0 46-47 31.772841365461847 36.0 32.0 36.0 14.0 36.0 48-49 31.575301204819276 36.0 32.0 36.0 14.0 36.0 50-51 31.687583783539885 36.0 32.0 36.0 14.0 36.0 52-53 31.351744915892542 36.0 32.0 36.0 14.0 36.0 54-55 31.254394776494223 36.0 32.0 36.0 14.0 36.0 56-57 31.234932194876947 36.0 32.0 36.0 14.0 36.0 58-59 31.095923397312525 36.0 32.0 36.0 14.0 36.0 60-61 30.986937955287615 36.0 32.0 36.0 14.0 36.0 62-63 30.912185929648242 36.0 32.0 36.0 14.0 36.0 64-65 30.55577889447236 36.0 27.0 36.0 14.0 36.0 66-67 30.517301311348703 36.0 27.0 36.0 14.0 36.0 68-69 30.607856665812054 36.0 29.5 36.0 14.0 36.0 70-71 30.409988786451486 36.0 27.0 36.0 14.0 36.0 72-73 30.167720050569095 36.0 27.0 36.0 14.0 36.0 74-75 30.091392817875366 36.0 27.0 36.0 14.0 36.0 76 29.23232709209018 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 0.0 4 1.0 5 7.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 0.0 14 3.0 15 38.0 16 52.0 17 34.0 18 13.0 19 7.0 20 11.0 21 20.0 22 16.0 23 23.0 24 53.0 25 62.0 26 67.0 27 107.0 28 152.0 29 172.0 30 241.0 31 329.0 32 470.0 33 635.0 34 867.0 35 601.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.04092392668843 18.00150640220939 11.549083605322622 31.408486065779563 2 31.985940246045697 21.993472257092645 26.211398443384383 19.809189053477276 3 28.714859437751006 25.27610441767068 20.632530120481928 25.376506024096386 4 32.37951807228915 29.743975903614455 16.9929718875502 20.883534136546185 5 30.3714859437751 29.819277108433734 19.377510040160644 20.43172690763052 6 26.93273092369478 31.676706827309236 19.477911646586346 21.912650602409638 7 25.65261044176707 15.788152610441767 32.53012048192771 26.029116465863456 8 24.554356013055486 21.51644489078584 24.05222194325885 29.876977152899826 9 25.565042692114513 20.592667001506783 25.86639879457559 27.975891511803113 10-11 27.982401005656822 27.52985543683218 18.541797611565052 25.945945945945947 12-13 30.193661971830988 20.497987927565394 21.617203219315893 27.691146881287725 14-15 28.03926503901334 23.4205889755852 22.79134155549962 25.74880442990184 16-17 29.812413445801333 23.416845020773007 21.629107390154854 25.141634143270803 18-19 29.195518066221833 22.636283520080575 22.825129044441645 25.34306936925595 20-21 28.303312759793425 23.64277616828316 23.504219675022043 24.549691396901373 22-23 29.42954287873064 23.724971666037025 21.357511648407 25.487973806825337 24-25 28.217073784940823 23.860488541928984 22.23621254092168 25.686225132208513 26-27 26.575100806451612 25.063004032258064 22.920866935483872 25.44102822580645 28-29 26.81761006289308 24.930817610062896 22.754716981132077 25.49685534591195 30-31 27.818319073980874 23.225968797181682 23.037242073477604 25.918470055359837 32-33 27.50157331655129 23.67526746381372 23.134046570169918 25.689112649465073 34-35 28.178954001260237 24.4234404536862 22.596093257718966 24.801512287334592 36-37 28.38246409674981 23.393801965230537 22.033257747543463 26.190476190476193 38-39 28.006548293665784 24.367208160181335 22.80569197834026 24.82055156781262 40-41 28.973843058350102 23.07595573440644 22.484909456740443 25.465291750503017 42-43 29.396953292206973 23.01397456880272 23.026564270426793 24.562507868563515 44-45 27.209770838579704 24.150088139007806 22.7020901536137 25.93805086879879 46-47 28.947037363190336 24.518807397156873 22.342433010441564 24.191722229211223 48-49 28.08917999748079 22.723264894823025 23.718352437334676 25.469202670361508 50-51 27.481108312342567 23.765743073047858 22.657430730478588 26.09571788413098 52-53 28.63264020163831 24.56206679269061 20.894770006301197 25.910522999369878 54-55 28.467061342738383 23.365663181760926 22.710668849981104 25.456606625519584 56-57 28.82508500188893 23.183478151366327 23.15829240649792 24.83314444024682 58-59 28.893649193548388 24.306955645161292 22.744455645161292 24.054939516129032 60-61 28.225806451612907 23.891129032258064 22.19002016129032 25.69304435483871 62-63 28.88273082252173 23.94508124448923 21.992694293991686 25.179493638997354 64-65 28.00252047889099 23.742911153119092 22.50787649653434 25.746691871455578 66-67 28.117913832199548 24.237843285462333 22.17183169564122 25.472411186696903 68-69 25.718970736629664 24.684661957618566 24.00353178607467 25.59283551967709 70-71 26.77692210579472 24.087867693473047 23.873248327231412 25.26196187350082 72-73 26.259038437143218 24.736775339337814 23.03691488012178 25.967271343397186 74-75 25.675130995566303 23.041784226790273 23.99570065833669 27.28738411930673 76 29.66653890379456 0.0 32.15791490992718 38.17554618627827 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 16.0 1 9.0 2 2.0 3 1.5 4 1.0 5 0.5 6 2.0 7 2.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 1.0 14 1.5 15 0.5 16 0.0 17 0.5 18 4.0 19 7.0 20 6.0 21 3.5 22 4.5 23 5.5 24 5.0 25 5.5 26 8.5 27 11.0 28 12.5 29 15.5 30 17.0 31 26.5 32 37.0 33 39.5 34 46.0 35 66.5 36 84.0 37 90.0 38 98.0 39 104.5 40 116.0 41 125.0 42 129.5 43 145.0 44 163.0 45 161.5 46 157.0 47 161.5 48 141.0 49 125.5 50 132.5 51 121.5 52 111.5 53 119.0 54 122.0 55 125.0 56 122.5 57 116.0 58 119.0 59 140.0 60 163.0 61 150.5 62 137.0 63 131.0 64 116.5 65 111.0 66 112.5 67 105.0 68 95.5 69 88.5 70 85.5 71 89.0 72 82.0 73 70.5 74 55.0 75 42.0 76 35.5 77 34.5 78 30.0 79 23.5 80 20.5 81 15.5 82 9.5 83 6.0 84 6.5 85 4.0 86 3.0 87 4.0 88 4.0 89 2.0 90 0.5 91 0.5 92 0.0 93 0.0 94 1.0 95 1.0 96 0.0 97 1.0 98 1.5 99 2.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.42500000000000004 3 0.4 4 0.4 5 0.4 6 0.4 7 0.4 8 0.42500000000000004 9 0.44999999999999996 10-11 0.5625 12-13 0.6 14-15 0.675 16-17 0.7125 18-19 0.7125 20-21 0.7625 22-23 0.7374999999999999 24-25 0.7250000000000001 26-27 0.8 28-29 0.625 30-31 0.65 32-33 0.6875 34-35 0.8125 36-37 0.37650602409638556 38-39 0.338855421686747 40-41 0.2008032128514056 42-43 0.3137550200803213 44-45 0.32630522088353414 46-47 0.2384538152610442 48-49 0.3639558232931727 50-51 0.33889795406049955 52-53 0.3891539040923927 54-55 0.31391260673028626 56-57 0.2887995981918634 58-59 0.33906819038050984 60-61 0.3265511178095956 62-63 0.2638190954773869 64-65 0.314070351758794 66-67 0.21370207416719045 68-69 0.26418417410995093 70-71 0.2518574486840448 72-73 0.2025572857323712 74-75 0.26798874447273213 76 0.30569354222392053 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 16.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 1.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 2.0 66 1.0 67 2.0 68 1.0 69 0.0 70 7.0 71 8.0 72 19.0 73 69.0 74 279.0 75 975.0 76 2617.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.231222763394 95.8 2 1.4611638041527815 2.85 3 0.20507562163547807 0.6 4 0.05126890540886952 0.2 5 0.0 0.0 6 0.02563445270443476 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02563445270443476 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 16 0.4 No Hit GGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1016909 spots for SRR11389784.sra Written 1016909 spots for SRR11389784.sra Read 1016909 spots for SRR11389784.sra Written 1016909 spots for SRR11389784.sra Read 1016909 spots for SRR11389784.sra Written 1016909 spots for SRR11389784.sra Read 1016909 spots for SRR11389784.sra Written 1016909 spots for SRR11389784.sra Read 1016909 spots for SRR11389784.sra Written 1016909 spots for SRR11389784.sra Read 1016909 spots for SRR11389784.sra Written 1016909 spots for SRR11389784.sra Read 1016909 spots for SRR11389784.sra Written 1016909 spots for SRR11389784.sra Read 1016909 spots for SRR11389784.sra Written 1016909 spots for SRR11389784.sra Read 1016909 spots for SRR11389784.sra Written 1016909 spots for SRR11389784.sra Read 1016909 spots for SRR11389784.sra Written 1016909 spots for SRR11389784.sra Read 1016909 spots for SRR11389784.sra Written 1016909 spots for SRR11389784.sra Read 1016909 spots for SRR11389784.sra Written 1016909 spots for SRR11389784.sra Read 1016909 spots for SRR11389784.sra Written 1016909 spots for SRR11389784.sra Read 1016909 spots for SRR11389784.sra Written 1016909 spots for SRR11389784.sra Read 1016916 spots for SRR11389784.sra Written 1016916 spots for SRR11389784.sra Read 1016909 spots for SRR11389784.sra Written 1016909 spots for SRR11389784.sra Read 1016909 spots for SRR11389784.sra Written 1016909 spots for SRR11389784.sra Read 1016909 spots for SRR11389784.sra Written 1016909 spots for SRR11389784.sra Read 1016909 spots for SRR11389784.sra Written 1016909 spots for SRR11389784.sra Read 1016909 spots for SRR11389784.sra Written 1016909 spots for SRR11389784.sra SRR ids: ['SRR11389784.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8bwfqum7 SRR11389784.sra spots: 20338187 blocks: [[1, 1016909], [1016910, 2033818], [2033819, 3050727], [3050728, 4067636], [4067637, 5084545], [5084546, 6101454], [6101455, 7118363], [7118364, 8135272], [8135273, 9152181], [9152182, 10169090], [10169091, 11185999], [11186000, 12202908], [12202909, 13219817], [13219818, 14236726], [14236727, 15253635], [15253636, 16270544], [16270545, 17287453], [17287454, 18304362], [18304363, 19321271], [19321272, 20338187]] SRR11389784 file size 3864131 SRR11389784 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389784 SRR11389784_1.fastq SRR11389784_2.fastq Input file: SRR11389784_1.fastq Paired file: SRR11389784_2.fastq trimmed: SRR11389784-trimmed-pair1.fastq, SRR11389784-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:21:06 2024 >> started Sat Dec 7 06:21:23 2024 >> done (17.061s) 20338187 read pairs processed; of these: 824 ( 0.00%) short read pairs filtered out after trimming by size control 836345 ( 4.11%) empty read pairs filtered out after trimming by size control 19501018 (95.88%) read pairs available; of these: 15417 ( 0.08%) trimmed read pairs available after processing 19485601 (99.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 318 0.00% 19 16 0.00% 20 304 0.00% 21 17 0.00% 22 369 0.00% 23 22 0.00% 24 390 0.00% 25 34 0.00% 26 463 0.00% 27 47 0.00% 28 396 0.00% 29 40 0.00% 30 333 0.00% 31 38 0.00% 32 233 0.00% 33 32 0.00% 34 182 0.00% 35 232 0.00% 36 490 0.00% 37 265 0.00% 38 425 0.00% 39 324 0.00% 40 434 0.00% 41 467 0.00% 42 515 0.00% 43 606 0.00% 44 659 0.00% 45 743 0.00% 46 817 0.00% 47 931 0.00% 48 1002 0.01% 49 1045 0.01% 50 1199 0.01% 51 1397 0.01% 52 1585 0.01% 53 1896 0.01% 54 1995 0.01% 55 2298 0.01% 56 2728 0.01% 57 2990 0.02% 58 3360 0.02% 59 3657 0.02% 60 3736 0.02% 61 4025 0.02% 62 4441 0.02% 63 5268 0.03% 64 5872 0.03% 65 6526 0.03% 66 7360 0.04% 67 8287 0.04% 68 8162 0.04% 69 9056 0.05% 70 10776 0.06% 71 13895 0.07% 72 30721 0.16% 73 174342 0.89% 74 1292326 6.63% 75 8446993 43.32% 76 9433938 48.38% 19501018 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=34 prefix-density=0.67 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.11 sequence-density-rank=34 fanout-score=10.12 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=4.5 sequence=GCGCCGAGCATGGCCCA criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=19 prefix-density=0.66 prefix-fanout=2.5 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=14.85 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.0 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC SRR11389784 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:21:58 Started mapping on | Dec 07 06:21:58 Finished on | Dec 07 06:23:47 Mapping speed, Million of reads per hour | 644.07 Number of input reads | 19501018 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 16344583 Uniquely mapped reads % | 83.81% Average mapped length | 149.87 Number of splices: Total | 5744235 Number of splices: Annotated (sjdb) | 5477136 Number of splices: GT/AG | 5668243 Number of splices: GC/AG | 65386 Number of splices: AT/AC | 1734 Number of splices: Non-canonical | 8872 Mismatch rate per base, % | 1.22% Deletion rate per base | 0.01% Deletion average length | 1.75 Insertion rate per base | 0.01% Insertion average length | 1.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1949771 % of reads mapped to multiple loci | 10.00% Number of reads mapped to too many loci | 40376 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.15% % of reads unmapped: other | 0.83% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1206669 1206669 1206669 N_multimapping 1949771 1949771 1949771 N_noFeature 519073 15871893 669145 N_ambiguous 445580 1966 133233 UnstrandedReadsAssigned:15379930 PositiveStrandReadsAssigned:470724 NegativeStrandReadsAssigned:15542205 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389784 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389784-trimmed-pair1.fastq SRR11389784-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,501,018 reads, 17,463,876 reads pseudoaligned [quant] estimated average fragment length: 177.442 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52973 SRR11389784.ke.tsv 35125 SRR11389784.se.tsv 88098 total ==> SRR11389784.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 759.687 0 0 PNS24247 1044 867.558 8.38599 0.721942 PNS24249 1928 1751.56 129.149 5.50697 PNS24246 1044 867.558 8.38599 0.721942 PNS24248 1044 867.558 8.38599 0.721942 PNS24244 1471 1294.56 26.6931 1.54001 PNS24243 293 127.723 0 0 KQK14069 1603 1426.56 1707.48 89.3949 KQK14071 474 299.279 38.9626 9.7234 ==> SRR11389784.se.tsv <== BRADI_1g14170v3 1806 BRADI_1g53295v3 20 BRADI_1g59795v3 461 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 168 BRADI_1g74790v3 161 BRADI_1g09890v3 0 BRADI_1g77505v3 230 BRADI_1g48960v3 0 SRR11389784 completed mapping pipeline successfully