Starting /dee2/code/volunteer_pipeline.sh SRR11389785 current disk space = 1545719943168 free memory = 1603992228 SRR11389785 SRAfilesize 9f4d285294c9c2097e53297235102e73 SRR11389785.sra SRR11389785.sra file validated SRR11389785 is paired end SRR11389785 is conventional basespace SRR11389785 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389785_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.801 32.0 32.0 32.0 32.0 32.0 2 30.90625 32.0 32.0 32.0 32.0 32.0 3 30.7555 32.0 32.0 32.0 32.0 32.0 4 30.886 32.0 32.0 32.0 32.0 32.0 5 30.913 32.0 32.0 32.0 32.0 32.0 6 33.92725 36.0 36.0 36.0 32.0 36.0 7 33.95525 36.0 36.0 36.0 32.0 36.0 8 33.791 36.0 36.0 36.0 32.0 36.0 9 34.05475 36.0 36.0 36.0 32.0 36.0 10-11 33.854 36.0 36.0 36.0 32.0 36.0 12-13 33.888875 36.0 36.0 36.0 32.0 36.0 14-15 33.905 36.0 36.0 36.0 32.0 36.0 16-17 33.869125 36.0 36.0 36.0 32.0 36.0 18-19 33.93675 36.0 36.0 36.0 32.0 36.0 20-21 33.774874999999994 36.0 36.0 36.0 32.0 36.0 22-23 33.554249999999996 36.0 36.0 36.0 29.5 36.0 24-25 33.494749999999996 36.0 36.0 36.0 27.0 36.0 26-27 33.4105 36.0 36.0 36.0 24.0 36.0 28-29 33.4075 36.0 36.0 36.0 24.0 36.0 30-31 33.311375 36.0 36.0 36.0 21.0 36.0 32-33 33.258375 36.0 36.0 36.0 20.5 36.0 34-35 33.19175 36.0 36.0 36.0 21.0 36.0 36-37 33.53622822519566 36.0 36.0 36.0 27.0 36.0 38-39 33.272279727341584 36.0 36.0 36.0 21.0 36.0 40-41 33.33782035834232 36.0 36.0 36.0 20.5 36.0 42-43 32.81679292929293 36.0 36.0 36.0 14.0 36.0 44-45 32.81816003556658 36.0 36.0 36.0 14.0 36.0 46-47 32.90805759030058 36.0 36.0 36.0 14.0 36.0 48-49 32.72038393533721 36.0 36.0 36.0 14.0 36.0 50-51 32.75126326427488 36.0 36.0 36.0 14.0 36.0 52-53 32.62165234967155 36.0 34.0 36.0 14.0 36.0 54-55 32.56821627084386 36.0 34.0 36.0 14.0 36.0 56-57 32.140730832702175 36.0 32.0 36.0 14.0 36.0 58-59 32.19711773895372 36.0 32.0 36.0 14.0 36.0 60-61 31.83799601693188 36.0 32.0 36.0 14.0 36.0 62-63 31.7902452117031 36.0 32.0 36.0 14.0 36.0 64-65 31.892145779469388 36.0 32.0 36.0 14.0 36.0 66-67 31.638642694353003 36.0 32.0 36.0 14.0 36.0 68-69 31.5776589411062 36.0 32.0 36.0 14.0 36.0 70-71 31.354369981629077 36.0 32.0 36.0 14.0 36.0 72-73 31.2651651029422 36.0 32.0 36.0 14.0 36.0 74-75 31.200987850643394 36.0 32.0 36.0 14.0 36.0 76 30.393338323353294 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 39.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 3.0 24 16.0 25 29.0 26 44.0 27 81.0 28 124.0 29 181.0 30 267.0 31 338.0 32 512.0 33 787.0 34 1002.0 35 575.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.27745518808382 11.310275183034587 10.855844483716233 36.55642514516536 2 24.640242363039636 15.24867457712699 33.804594799293106 26.306488260540267 3 22.77202726584196 20.070689219893968 23.958596314062106 33.198687200201974 4 28.32618025751073 24.892703862660944 19.060843221408735 27.720272658419592 5 29.03307245645039 27.972734158040897 22.14087351678869 20.853319868720018 6 25.663046223793888 29.072998231876735 23.31396817378126 21.94998737054812 7 17.899520323150718 25.624842211562736 34.460994698308504 22.014642766978035 8 19.26281242110578 24.96844231254734 30.169149204746276 25.599596061600604 9 23.882857864175712 19.490027770764957 31.20424135319364 25.422873011865693 10-11 24.703357737944962 29.979803080030294 20.82807371875789 24.48876546326685 12-13 23.45367331481949 24.11007321383489 23.908104014137844 28.528149457207775 14-15 23.087604140368594 25.95304216107044 25.347134561979303 25.612219136581672 16-17 24.248927038626608 24.450896238323654 24.728603887907095 26.571572835142643 18-19 23.390557939914164 23.983842464024235 25.66271143650593 26.96288815955567 20-21 25.334511486998235 25.296642262055038 24.95581923756627 24.413027013380457 22-23 23.75662711436506 27.114365059328456 24.009088613986368 25.11991921232012 24-25 23.668265589497604 23.92072708911891 25.372380711941428 27.038626609442062 26-27 22.759404190860895 25.39762686190356 24.829588487755615 27.01338045947993 28-29 25.511234536733145 25.738449886392324 23.516788689724816 25.23352688714971 30-31 23.61777328957334 24.387780863418328 24.52663468821005 27.467811158798284 32-33 23.087604140368594 26.533703610199446 24.046957838929565 26.3317344105024 34-35 24.021711688967432 26.016157535975765 24.867457712698812 25.09467306235799 36-37 23.20121181519818 26.50845746023731 24.993688462509468 25.296642262055038 38-39 24.6528654380207 23.655642514516536 24.21105781368341 27.48043423377935 40-41 24.16361570508774 24.8200984724151 24.403484408534275 26.612801413962885 42-43 23.446969696969695 25.151515151515152 24.987373737373737 26.41414141414141 44-45 22.755398408890013 24.472786968051523 25.015784821315822 27.756029801742642 46-47 25.25890376357666 25.195756504167722 23.048749684263704 26.49659004799192 48-49 23.187673654963376 25.18312705228593 25.688305127557463 25.940894165193228 50-51 24.911571500757958 23.825164224355735 25.859019706922687 25.40424456796362 52-53 24.469429004547752 22.953511874684185 23.05457301667509 29.522486104092977 54-55 24.898938858009096 24.431531076301162 24.924204143506824 25.74532592218292 56-57 23.714466203411245 24.358812381554014 25.192672141503476 26.73404927353127 58-59 23.087621696801115 23.770388165381213 25.2876469844481 27.854343153369577 60-61 25.129631971670673 23.245225749336033 25.736689009738207 25.88845326925509 62-63 24.44022770398482 24.09867172675522 24.364326375711578 27.09677419354839 64-65 25.35122136438426 23.617263637514238 24.79432983166688 26.237185166434628 66-67 23.524943023550264 26.44973410990124 24.309951886553556 25.715370979994933 68-69 23.30884215860147 25.956422599442615 23.866227514568024 26.868507727387893 70-71 24.47037929722187 25.979956869212227 23.75998985157935 25.789673981986557 72-73 24.716379859783302 25.850860420650097 23.416188655194393 26.01657106437221 74-75 24.80378890392422 22.46278755074425 24.844384303112314 27.889039242219216 76 26.53443113772455 0.0 33.869760479041915 39.59580838323353 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 40.0 1 20.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 2.5 19 5.0 20 5.0 21 7.0 22 11.0 23 10.0 24 7.0 25 8.5 26 10.5 27 13.5 28 16.5 29 17.5 30 27.5 31 38.0 32 41.5 33 49.5 34 49.5 35 57.0 36 92.0 37 122.5 38 118.5 39 105.5 40 119.5 41 151.5 42 168.0 43 170.5 44 187.0 45 228.5 46 258.0 47 236.0 48 202.0 49 180.0 50 165.0 51 154.5 52 145.5 53 130.0 54 113.0 55 107.0 56 110.5 57 115.0 58 111.0 59 118.5 60 125.5 61 114.5 62 106.0 63 92.0 64 79.0 65 76.5 66 67.0 67 62.0 68 66.0 69 62.0 70 59.0 71 63.5 72 59.5 73 52.5 74 38.5 75 28.0 76 28.0 77 20.0 78 14.5 79 15.5 80 13.0 81 10.0 82 6.5 83 3.5 84 3.0 85 1.0 86 0.5 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.975 2 0.975 3 0.975 4 0.975 5 0.975 6 1.0250000000000001 7 0.975 8 0.975 9 0.975 10-11 0.975 12-13 0.975 14-15 0.975 16-17 0.975 18-19 0.975 20-21 0.975 22-23 0.975 24-25 0.975 26-27 0.975 28-29 0.975 30-31 0.975 32-33 0.975 34-35 0.975 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 39.0 36 0.0 37 0.0 38 0.0 39 0.0 40 1.0 41 0.0 42 0.0 43 0.0 44 1.0 45 0.0 46 0.0 47 0.0 48 0.0 49 1.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 1.0 57 2.0 58 1.0 59 0.0 60 1.0 61 0.0 62 1.0 63 1.0 64 1.0 65 1.0 66 0.0 67 0.0 68 4.0 69 2.0 70 3.0 71 8.0 72 19.0 73 61.0 74 314.0 75 866.0 76 2672.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.18850091887634 93.5 2 1.3914413231819376 2.65 3 0.2362824888422158 0.675 4 0.05250721974271463 0.2 5 0.026253609871357313 0.125 6 0.026253609871357313 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05250721974271463 1.225 >50 0.026253609871357313 1.4749999999999999 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 59 1.4749999999999999 TruSeq Adapter, Index 3 (97% over 36bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 39 0.975 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 10 0.25 TruSeq Adapter, Index 3 (97% over 36bp) GGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTT 6 0.15 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCAGCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 5 0.125 TruSeq Adapter, Index 3 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACGTC 15 0.0021164005 69.575005 13 ACTAATG 15 0.0021164005 69.575005 32 GTCACTA 15 0.0021164005 69.575005 29 CAGTCAC 15 0.0021164005 69.575005 27 CACACGT 15 0.0021164005 69.575005 12 ACGTCTG 15 0.0021164005 69.575005 15 CACGTCT 15 0.0021164005 69.575005 14 GATCGGA 15 0.0021164005 69.575005 1 ATGCGCA 15 0.0021164005 69.575005 36 ACTCCAG 15 0.0021164005 69.575005 23 TAATGCG 15 0.0021164005 69.575005 34 TCCAGTC 15 0.0021164005 69.575005 25 TCGGAAG 15 0.0021164005 69.575005 3 AACTCCA 15 0.0021164005 69.575005 22 GAACTCC 15 0.0021164005 69.575005 21 TGCTTGA 15 0.0021164005 69.575005 60 ATCGGAA 15 0.0021164005 69.575005 2 CTAATGC 15 0.0021164005 69.575005 33 TCTGAAC 15 0.0021164005 69.575005 18 GGAAGAG 15 0.0021164005 69.575005 5 >>END_MODULE SRR11389785 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389785_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.61525 32.0 32.0 32.0 32.0 32.0 2 30.12325 32.0 32.0 32.0 21.0 32.0 3 29.5095 32.0 32.0 32.0 14.0 32.0 4 29.7 32.0 32.0 32.0 21.0 32.0 5 29.80975 32.0 32.0 32.0 21.0 32.0 6 33.01375 36.0 36.0 36.0 21.0 36.0 7 32.9115 36.0 36.0 36.0 21.0 36.0 8 32.57125 36.0 36.0 36.0 14.0 36.0 9 32.743 36.0 36.0 36.0 14.0 36.0 10-11 32.693625 36.0 36.0 36.0 17.5 36.0 12-13 32.720375000000004 36.0 36.0 36.0 14.0 36.0 14-15 32.4885 36.0 36.0 36.0 14.0 36.0 16-17 32.675250000000005 36.0 36.0 36.0 17.5 36.0 18-19 32.5085 36.0 36.0 36.0 14.0 36.0 20-21 32.304500000000004 36.0 36.0 36.0 14.0 36.0 22-23 32.49275 36.0 36.0 36.0 14.0 36.0 24-25 32.337374999999994 36.0 36.0 36.0 14.0 36.0 26-27 32.26625 36.0 36.0 36.0 14.0 36.0 28-29 32.208375000000004 36.0 36.0 36.0 14.0 36.0 30-31 32.121625 36.0 34.0 36.0 14.0 36.0 32-33 31.98225 36.0 34.0 36.0 14.0 36.0 34-35 31.958 36.0 32.0 36.0 14.0 36.0 36-37 32.10060667340748 36.0 32.0 36.0 14.0 36.0 38-39 32.25367643957106 36.0 34.0 36.0 14.0 36.0 40-41 32.28179519595449 36.0 36.0 36.0 14.0 36.0 42-43 32.15929203539823 36.0 34.0 36.0 14.0 36.0 44-45 31.868647281921618 36.0 32.0 36.0 14.0 36.0 46-47 31.795575221238938 36.0 32.0 36.0 14.0 36.0 48-49 31.615170670037926 36.0 32.0 36.0 14.0 36.0 50-51 31.60065756196257 36.0 32.0 36.0 14.0 36.0 52-53 31.454097116843702 36.0 32.0 36.0 14.0 36.0 54-55 31.332068791097623 36.0 32.0 36.0 14.0 36.0 56-57 31.361439280027938 36.0 32.0 36.0 14.0 36.0 58-59 31.249580077467968 36.0 32.0 36.0 14.0 36.0 60-61 30.910724875068517 36.0 32.0 36.0 14.0 36.0 62-63 30.89033319453221 36.0 32.0 36.0 14.0 36.0 64-65 30.505133751693215 36.0 27.0 36.0 14.0 36.0 66-67 30.659908768373036 36.0 27.0 36.0 14.0 36.0 68-69 30.388709867219163 36.0 27.0 36.0 14.0 36.0 70-71 30.366769402724053 36.0 27.0 36.0 14.0 36.0 72-73 30.040048776892355 36.0 27.0 36.0 14.0 36.0 74-75 30.171229900043457 36.0 27.0 36.0 14.0 36.0 76 29.402880498248347 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 44.0 3 0.0 4 0.0 5 1.0 6 2.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 6.0 15 29.0 16 53.0 17 27.0 18 13.0 19 11.0 20 6.0 21 8.0 22 13.0 23 38.0 24 57.0 25 52.0 26 68.0 27 108.0 28 143.0 29 209.0 30 263.0 31 340.0 32 473.0 33 665.0 34 861.0 35 509.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.79878665318504 18.07381193124368 9.80788675429727 31.319514661274013 2 32.58341759352882 22.548028311425682 26.08695652173913 18.781597573306367 3 26.820020222446917 26.971688574317493 21.814964610717897 24.393326592517695 4 31.04145601617796 30.283114256825076 17.87158746208291 20.803842264914056 5 30.46006066734075 32.0525783619818 18.933265925176947 18.554095045500503 6 25.75834175935288 33.49342770475228 20.020222446916076 20.72800808897877 7 24.469160768452983 16.708796764408493 34.858442871587464 23.96359959555106 8 24.443882709807887 22.067745197168858 24.595551061678464 28.892821031344795 9 26.04298356510746 21.61820480404551 25.335018963337546 27.00379266750948 10-11 28.5497534454419 27.08306992034391 18.953091414843847 25.414085219370335 12-13 29.071825998988366 20.687910976226608 21.459281740010116 28.78098128477491 14-15 28.42504743833017 23.415559772296017 23.111954459203034 25.047438330170777 16-17 29.144520374588712 23.3232093140977 21.716021260440392 25.816249050873196 18-19 28.195393571247784 23.373829410275878 23.361174386231333 25.069602632245 20-21 26.645569620253163 24.645569620253163 23.417721518987342 25.29113924050633 22-23 28.620253164556964 23.848101265822784 22.582278481012658 24.949367088607595 24-25 28.220703619336877 24.25968109339408 22.75373323209314 24.765882055175904 26-27 25.984551095352664 26.946941876662024 22.514879068000507 24.553627959984805 28-29 26.534227508541058 25.319498924459065 22.447171960015183 25.699101606984687 30-31 27.78691636087562 24.395799063646717 22.73820068328483 25.079083892192838 32-33 26.597494622295333 23.990889535619388 24.851322282677465 24.56029355940782 34-35 28.513547733603446 24.98100785008863 22.30944542922259 24.19599898708534 36-37 28.27656071926048 23.743193617829554 23.2493351905787 24.730910472331267 38-39 27.98379951904822 24.414631059359575 22.04784204531072 25.553727376281483 40-41 28.106808402935968 23.943305492280437 21.791951404707667 26.15793470007593 42-43 28.57142857142857 24.231304567885616 22.257370618752372 24.939896241933443 44-45 27.237058600177193 24.51588406530819 23.908366029616506 24.338691304898113 46-47 27.33485193621868 24.525436598329538 22.766388256137688 25.373323209314098 48-49 27.256614761362197 23.927079377136344 24.395493100392454 24.420812761109 50-51 27.180655779212557 24.18027598430181 23.408026332447147 25.231041904038488 52-53 28.225908572875774 24.65493225275421 22.08433582373053 25.034823350639485 54-55 29.202531645569618 24.025316455696203 21.772151898734176 25.0 56-57 28.054184073933406 24.395493100392454 22.964932269907585 24.585390555766555 58-59 28.8773441459706 23.213380638621388 22.85859097820578 25.05068423720223 60-61 29.118094272681194 24.34110491637101 21.895590471363406 24.645210339584388 62-63 28.491761723700886 23.979721166032952 22.73764258555133 24.79087452471483 64-65 28.08062880324544 23.973123732251523 22.45182555780933 25.49442190669371 66-67 27.386839102320277 25.548370736655258 22.239127678458225 24.825662482566248 68-69 27.128536987691916 25.07296028422789 22.992006090597638 24.806496637482553 70-71 26.35993899339095 24.936451448906965 23.5510930350788 25.152516522623287 72-73 26.47321999233031 25.57842260002556 23.405343218714048 24.54301418893008 74-75 25.756547699823585 24.033111684081966 24.073822771067988 26.136517845026464 76 28.98324892871056 0.0 33.81379041682898 37.20296065446046 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 44.0 1 22.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 2.0 18 4.0 19 4.0 20 2.5 21 3.0 22 5.0 23 5.5 24 6.0 25 6.5 26 10.5 27 14.5 28 17.0 29 18.0 30 16.5 31 19.0 32 20.5 33 23.0 34 39.5 35 67.0 36 80.5 37 79.5 38 91.0 39 104.0 40 116.5 41 130.5 42 137.0 43 160.0 44 184.0 45 188.5 46 195.0 47 183.5 48 168.5 49 162.5 50 143.5 51 136.0 52 129.5 53 122.0 54 126.5 55 131.5 56 135.0 57 128.5 58 124.0 59 134.5 60 147.5 61 139.0 62 118.0 63 106.0 64 97.5 65 101.0 66 102.0 67 92.5 68 77.5 69 69.0 70 76.0 71 80.0 72 72.0 73 60.5 74 54.5 75 49.5 76 40.0 77 33.0 78 29.0 79 25.5 80 21.0 81 13.0 82 8.0 83 4.5 84 2.0 85 3.0 86 2.5 87 1.0 88 0.5 89 0.5 90 1.5 91 1.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 1.0999999999999999 3 1.0999999999999999 4 1.0999999999999999 5 1.0999999999999999 6 1.0999999999999999 7 1.0999999999999999 8 1.0999999999999999 9 1.125 10-11 1.1375 12-13 1.15 14-15 1.1875 16-17 1.225 18-19 1.225 20-21 1.25 22-23 1.25 24-25 1.225 26-27 1.2874999999999999 28-29 1.2125000000000001 30-31 1.2125000000000001 32-33 1.2125000000000001 34-35 1.275 36-37 0.1895854398382204 38-39 0.12640626975097966 40-41 0.1011378002528445 42-43 0.08849557522123894 44-45 0.11378002528445005 46-47 0.1011378002528445 48-49 0.1390644753476612 50-51 0.11380880121396054 52-53 0.139099645928174 54-55 0.10116337885685382 56-57 0.10117617301125584 58-59 0.11390963169219087 60-61 0.0886188125079124 62-63 0.08864125617323033 64-65 0.08866371120962635 66-67 0.06335529650278764 68-69 0.07607455306200077 70-71 0.06350819255683983 72-73 0.10215808964372365 74-75 0.08135593220338982 76 0.07785130400934215 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 44.0 36 0.0 37 0.0 38 1.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 1.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 1.0 57 2.0 58 1.0 59 0.0 60 1.0 61 0.0 62 1.0 63 0.0 64 1.0 65 1.0 66 0.0 67 1.0 68 3.0 69 2.0 70 7.0 71 7.0 72 21.0 73 70.0 74 295.0 75 971.0 76 2569.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.45758354755783 95.75 2 1.3367609254498714 2.6 3 0.15424164524421594 0.44999999999999996 4 0.025706940874035987 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025706940874035987 1.0999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 44 1.0999999999999999 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 601546 spots for SRR11389785.sra Written 601546 spots for SRR11389785.sra Read 601546 spots for SRR11389785.sra Written 601546 spots for SRR11389785.sra Read 601546 spots for SRR11389785.sra Written 601546 spots for SRR11389785.sra Read 601546 spots for SRR11389785.sra Written 601546 spots for SRR11389785.sra Read 601546 spots for SRR11389785.sra Written 601546 spots for SRR11389785.sra Read 601546 spots for SRR11389785.sra Written 601546 spots for SRR11389785.sra Read 601546 spots for SRR11389785.sra Written 601546 spots for SRR11389785.sra Read 601546 spots for SRR11389785.sra Written 601546 spots for SRR11389785.sra Read 601546 spots for SRR11389785.sra Written 601546 spots for SRR11389785.sra Read 601546 spots for SRR11389785.sra Written 601546 spots for SRR11389785.sra Read 601546 spots for SRR11389785.sra Written 601546 spots for SRR11389785.sra Read 601546 spots for SRR11389785.sra Written 601546 spots for SRR11389785.sra Read 601546 spots for SRR11389785.sra Written 601546 spots for SRR11389785.sra Read 601546 spots for SRR11389785.sra Written 601546 spots for SRR11389785.sra Read 601546 spots for SRR11389785.sra Written 601546 spots for SRR11389785.sra Read 601546 spots for SRR11389785.sra Written 601546 spots for SRR11389785.sra Read 601546 spots for SRR11389785.sra Written 601546 spots for SRR11389785.sra Read 601546 spots for SRR11389785.sra Written 601546 spots for SRR11389785.sra Read 601546 spots for SRR11389785.sra Written 601546 spots for SRR11389785.sra Read 601546 spots for SRR11389785.sra Written 601546 spots for SRR11389785.sra SRR ids: ['SRR11389785.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_le2189ep SRR11389785.sra spots: 12030920 blocks: [[1, 601546], [601547, 1203092], [1203093, 1804638], [1804639, 2406184], [2406185, 3007730], [3007731, 3609276], [3609277, 4210822], [4210823, 4812368], [4812369, 5413914], [5413915, 6015460], [6015461, 6617006], [6617007, 7218552], [7218553, 7820098], [7820099, 8421644], [8421645, 9023190], [9023191, 9624736], [9624737, 10226282], [10226283, 10827828], [10827829, 11429374], [11429375, 12030920]] SRR11389785 file size 2268195 SRR11389785 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389785 SRR11389785_1.fastq SRR11389785_2.fastq Input file: SRR11389785_1.fastq Paired file: SRR11389785_2.fastq trimmed: SRR11389785-trimmed-pair1.fastq, SRR11389785-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:21:51 2024 >> started Sat Dec 7 06:22:03 2024 >> done (12.394s) 12030920 read pairs processed; of these: 594 ( 0.00%) short read pairs filtered out after trimming by size control 550967 ( 4.58%) empty read pairs filtered out after trimming by size control 11479359 (95.42%) read pairs available; of these: 15303 ( 0.13%) trimmed read pairs available after processing 11464056 (99.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 712 0.01% 19 18 0.00% 20 883 0.01% 21 15 0.00% 22 1054 0.01% 23 18 0.00% 24 1043 0.01% 25 20 0.00% 26 1085 0.01% 27 23 0.00% 28 859 0.01% 29 24 0.00% 30 646 0.01% 31 21 0.00% 32 511 0.00% 33 23 0.00% 34 366 0.00% 35 135 0.00% 36 832 0.01% 37 158 0.00% 38 460 0.00% 39 180 0.00% 40 315 0.00% 41 252 0.00% 42 339 0.00% 43 326 0.00% 44 420 0.00% 45 400 0.00% 46 465 0.00% 47 483 0.00% 48 564 0.00% 49 603 0.01% 50 685 0.01% 51 780 0.01% 52 892 0.01% 53 989 0.01% 54 1009 0.01% 55 1288 0.01% 56 1694 0.01% 57 1756 0.02% 58 1773 0.02% 59 1881 0.02% 60 2279 0.02% 61 2235 0.02% 62 2509 0.02% 63 2915 0.03% 64 3262 0.03% 65 3640 0.03% 66 3994 0.03% 67 4647 0.04% 68 4401 0.04% 69 5041 0.04% 70 6025 0.05% 71 7826 0.07% 72 16904 0.15% 73 104463 0.91% 74 787373 6.86% 75 5039756 43.90% 76 5456089 47.53% 11479359 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=22 prefix-density=0.50 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.04 sequence-density-rank=24 fanout-score=8.07 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=2.8 sequence=CCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCTTGCCGCCGCTGCAGACGACGGCGAAGTTGGAGCCCCGCCGCGACAGCGACGGCAGGCTCGTCGGCGCC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=23 prefix-density=0.56 prefix-fanout=2.1 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=22 fanout-score=102.93 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=16.1 sequence=GCCGCCGCCGCC SRR11389785 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:22:35 Started mapping on | Dec 07 06:22:35 Finished on | Dec 07 06:24:10 Mapping speed, Million of reads per hour | 435.01 Number of input reads | 11479359 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 9746357 Uniquely mapped reads % | 84.90% Average mapped length | 149.74 Number of splices: Total | 3811325 Number of splices: Annotated (sjdb) | 3637014 Number of splices: GT/AG | 3759068 Number of splices: GC/AG | 45645 Number of splices: AT/AC | 1354 Number of splices: Non-canonical | 5258 Mismatch rate per base, % | 1.32% Deletion rate per base | 0.01% Deletion average length | 1.75 Insertion rate per base | 0.01% Insertion average length | 1.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 967134 % of reads mapped to multiple loci | 8.42% Number of reads mapped to too many loci | 25966 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.49% % of reads unmapped: other | 0.95% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 765874 765874 765874 N_multimapping 967134 967134 967134 N_noFeature 344821 9442388 451210 N_ambiguous 266292 1426 73163 UnstrandedReadsAssigned:9135244 PositiveStrandReadsAssigned:302543 NegativeStrandReadsAssigned:9221984 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389785 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389785-trimmed-pair1.fastq SRR11389785-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,479,359 reads, 10,083,521 reads pseudoaligned [quant] estimated average fragment length: 181.54 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52973 SRR11389785.ke.tsv 35125 SRR11389785.se.tsv 88098 total ==> SRR11389785.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 755.539 0 0 PNS24247 1044 863.46 7.16138 1.11595 PNS24249 1928 1747.46 58.605 4.51249 PNS24246 1044 863.46 7.16138 1.11595 PNS24248 1044 863.46 7.16138 1.11595 PNS24244 1471 1290.46 38.9109 4.0571 PNS24243 293 124.095 0 0 KQK14069 1603 1422.46 311.591 29.4736 KQK14071 474 295 19.1105 8.71646 ==> SRR11389785.se.tsv <== BRADI_1g14170v3 369 BRADI_1g53295v3 13 BRADI_1g59795v3 179 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 72 BRADI_1g74790v3 159 BRADI_1g09890v3 0 BRADI_1g77505v3 146 BRADI_1g48960v3 0 SRR11389785 completed mapping pipeline successfully