Starting /dee2/code/volunteer_pipeline.sh SRR11389786 current disk space = 1545622822912 free memory = 1600214224 SRR11389786 SRAfilesize 585bf4f169db40e7e200d7c2faaa7237 SRR11389786.sra SRR11389786.sra file validated SRR11389786 is paired end SRR11389786 is conventional basespace SRR11389786 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389786_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.12 32.0 32.0 32.0 32.0 32.0 2 31.07975 32.0 32.0 32.0 32.0 32.0 3 31.1575 32.0 32.0 32.0 32.0 32.0 4 31.32875 32.0 32.0 32.0 32.0 32.0 5 31.18375 32.0 32.0 32.0 32.0 32.0 6 34.14425 36.0 36.0 36.0 32.0 36.0 7 34.20375 36.0 36.0 36.0 32.0 36.0 8 34.1655 36.0 36.0 36.0 32.0 36.0 9 34.17275 36.0 36.0 36.0 32.0 36.0 10-11 34.187625 36.0 36.0 36.0 32.0 36.0 12-13 34.361999999999995 36.0 36.0 36.0 32.0 36.0 14-15 34.20075 36.0 36.0 36.0 32.0 36.0 16-17 34.176625 36.0 36.0 36.0 32.0 36.0 18-19 34.0745 36.0 36.0 36.0 32.0 36.0 20-21 34.234125 36.0 36.0 36.0 32.0 36.0 22-23 33.998625000000004 36.0 36.0 36.0 32.0 36.0 24-25 33.841 36.0 36.0 36.0 32.0 36.0 26-27 33.804375 36.0 36.0 36.0 32.0 36.0 28-29 33.72575 36.0 36.0 36.0 29.5 36.0 30-31 33.6375 36.0 36.0 36.0 29.5 36.0 32-33 33.540875 36.0 36.0 36.0 27.0 36.0 34-35 33.52612499999999 36.0 36.0 36.0 27.0 36.0 36-37 33.422980745186294 36.0 36.0 36.0 24.0 36.0 38-39 33.25943985996499 36.0 36.0 36.0 17.5 36.0 40-41 33.21317829457364 36.0 36.0 36.0 17.5 36.0 42-43 33.055638909727435 36.0 36.0 36.0 14.0 36.0 44-45 33.0891472868217 36.0 36.0 36.0 14.0 36.0 46-47 32.855838959739934 36.0 36.0 36.0 14.0 36.0 48-49 32.83158289572393 36.0 36.0 36.0 14.0 36.0 50-51 32.69739280117678 36.0 36.0 36.0 14.0 36.0 52-53 32.49762381190595 36.0 32.0 36.0 14.0 36.0 54-55 32.478108581436075 36.0 34.0 36.0 14.0 36.0 56-57 32.367275456592445 36.0 32.0 36.0 14.0 36.0 58-59 32.11158368776582 36.0 32.0 36.0 14.0 36.0 60-61 32.05266449837378 36.0 32.0 36.0 14.0 36.0 62-63 31.82524393294971 36.0 32.0 36.0 14.0 36.0 64-65 31.731923942957216 36.0 32.0 36.0 14.0 36.0 66-67 31.468476357267953 36.0 32.0 36.0 14.0 36.0 68-69 31.19789842381786 36.0 32.0 36.0 14.0 36.0 70-71 31.24521513006627 36.0 32.0 36.0 14.0 36.0 72-73 31.127105712602578 36.0 32.0 36.0 14.0 36.0 74-75 31.04815452014595 36.0 32.0 36.0 14.0 36.0 76 30.057282570730003 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 0.0 22 1.0 23 6.0 24 13.0 25 20.0 26 40.0 27 91.0 28 120.0 29 206.0 30 254.0 31 394.0 32 525.0 33 729.0 34 1032.0 35 567.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.76094023505877 9.452363090772693 11.252813203300825 35.533883470867714 2 26.30657664416104 11.952988247061766 32.65816454113528 29.08227056764191 3 25.831457864466117 17.37934483620905 21.255313828457115 35.533883470867714 4 31.50787696924231 23.705926481620406 17.35433858464616 27.431857964491122 5 27.506876719179797 27.68192048012003 21.355338834708675 23.455863965991497 6 24.98748122183275 27.691537305958942 22.283425137706562 25.037556334501755 7 20.230057514378593 21.255313828457115 34.53363340835209 23.980995248812203 8 22.705676419104776 21.205301325331334 28.00700175043761 28.08202050512628 9 23.23080770192548 19.604901225306325 30.50762690672668 26.65666416604151 10-11 25.36884221055264 27.04426106526632 21.61790447611903 25.968992248062015 12-13 26.481620405101275 21.192798199549888 23.443360840210055 28.882220555138783 14-15 24.44361090272568 22.443110777694425 25.18129532383096 27.93198299574894 16-17 24.88122030507627 22.74318579644911 23.705926481620406 28.66966741685421 18-19 25.656414103525883 22.643160790197552 23.018254563640912 28.68217054263566 20-21 24.918729682420604 23.005751437859466 24.243560890222557 27.831957989497376 22-23 25.168792198049513 23.918479619904975 23.93098274568642 26.981745436359088 24-25 25.55638909727432 22.380595148787197 23.605901475368842 28.457114278569644 26-27 25.318829707426854 22.930732683170792 23.668417104276067 28.08202050512628 28-29 26.944236059014752 22.655663915978995 22.918229557389346 27.481870467616904 30-31 26.569142285571395 22.55563890972743 22.9057264316079 27.969492373093274 32-33 24.893723430857715 23.518379594898725 23.905976494123532 27.68192048012003 34-35 25.79394848712178 23.330832708177045 23.068267066766694 27.806951737934483 36-37 26.63165791447862 22.755688922230558 22.605651412853213 28.00700175043761 38-39 26.156539134783696 22.9057264316079 23.43085771442861 27.506876719179797 40-41 25.93148287071768 22.968242060515127 22.455613903475868 28.644661165291325 42-43 26.30657664416104 22.2430607651913 23.468367091772944 27.981995498874717 44-45 25.78144536134033 22.393098274568644 23.755938984746187 28.069517379344838 46-47 27.019254813703427 22.230557639409852 22.818204551137786 27.93198299574894 48-49 25.381345336334082 22.230557639409852 23.58089522380595 28.80720180045011 50-51 25.70964111541828 22.19582343378767 23.48380642741028 28.61072902338377 52-53 26.863431715857928 22.02351175587794 23.449224612306153 27.66383191595798 54-55 26.79509632224168 22.504378283712782 23.15486614961221 27.545659244433324 56-57 26.38228671503628 21.778834125594194 23.555166374781088 28.283712784588445 58-59 26.35726795096322 22.116587440580435 22.9672254190643 28.558919189392046 60-61 25.456592444333246 21.966474856142106 23.867900925694272 28.709031773830375 62-63 26.157117838378785 22.0540405303978 23.30497873405054 28.48386289717288 64-65 26.56992744558419 22.91718789091819 22.829622216662496 27.683262446835126 66-67 26.732549412059043 22.979734801100825 22.679509632224168 27.60820615461596 68-69 26.745058794095574 21.891418563922944 22.779584688516387 28.5839379534651 70-71 26.51069685975228 23.05767546603278 22.44463905917678 27.98698861503816 72-73 26.87821397215603 21.93653580835319 22.60127931769723 28.583970901793553 74-75 27.276326207442597 19.14753233043019 23.43626286619161 30.139878595935603 76 29.02549772965421 0.0 30.10827803003842 40.86622424030737 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 1.0 22 1.5 23 1.0 24 1.0 25 2.0 26 4.5 27 6.5 28 9.0 29 11.5 30 15.5 31 20.5 32 24.0 33 34.5 34 46.5 35 54.5 36 61.5 37 73.5 38 81.0 39 93.5 40 121.5 41 140.5 42 146.0 43 144.5 44 147.0 45 150.0 46 146.0 47 144.5 48 155.0 49 150.0 50 139.5 51 146.0 52 156.5 53 151.5 54 140.5 55 133.0 56 116.5 57 110.0 58 116.5 59 127.0 60 140.0 61 152.5 62 156.0 63 140.0 64 132.0 65 142.0 66 130.5 67 122.0 68 126.5 69 116.5 70 97.5 71 83.5 72 76.5 73 68.0 74 58.5 75 53.0 76 47.5 77 34.0 78 21.0 79 17.0 80 16.0 81 14.0 82 9.0 83 5.0 84 3.0 85 1.0 86 1.0 87 1.0 88 1.5 89 1.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.15 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 1.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 1.0 71 2.0 72 15.0 73 59.0 74 262.0 75 795.0 76 2863.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1166077738516 98.175 2 0.8329126703685007 1.6500000000000001 3 0.025239777889954566 0.075 4 0.025239777889954566 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389786 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389786_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.781 32.0 32.0 32.0 32.0 32.0 2 30.4325 32.0 32.0 32.0 32.0 32.0 3 30.41325 32.0 32.0 32.0 32.0 32.0 4 30.36 32.0 32.0 32.0 21.0 32.0 5 30.46925 32.0 32.0 32.0 32.0 32.0 6 33.522 36.0 36.0 36.0 21.0 36.0 7 33.54025 36.0 36.0 36.0 21.0 36.0 8 33.52225 36.0 36.0 36.0 21.0 36.0 9 33.47425 36.0 36.0 36.0 21.0 36.0 10-11 33.447375 36.0 36.0 36.0 21.0 36.0 12-13 33.53925 36.0 36.0 36.0 26.5 36.0 14-15 33.27975 36.0 36.0 36.0 21.0 36.0 16-17 33.400999999999996 36.0 36.0 36.0 21.0 36.0 18-19 33.367125 36.0 36.0 36.0 21.0 36.0 20-21 33.3025 36.0 36.0 36.0 21.0 36.0 22-23 33.1995 36.0 36.0 36.0 21.0 36.0 24-25 33.073 36.0 36.0 36.0 17.5 36.0 26-27 33.11025 36.0 36.0 36.0 17.5 36.0 28-29 33.0895 36.0 36.0 36.0 17.5 36.0 30-31 32.872 36.0 36.0 36.0 14.0 36.0 32-33 32.73525 36.0 36.0 36.0 14.0 36.0 34-35 32.787625000000006 36.0 36.0 36.0 14.0 36.0 36-37 32.828614382360314 36.0 36.0 36.0 14.0 36.0 38-39 32.80380856928088 36.0 36.0 36.0 14.0 36.0 40-41 32.559133049361066 36.0 36.0 36.0 14.0 36.0 42-43 32.466424455023805 36.0 36.0 36.0 14.0 36.0 44-45 32.376221498371336 36.0 36.0 36.0 14.0 36.0 46-47 32.34865948383864 36.0 34.0 36.0 14.0 36.0 48-49 32.20821849160612 36.0 34.0 36.0 14.0 36.0 50-51 32.08994947277992 36.0 32.0 36.0 14.0 36.0 52-53 31.69736842105263 36.0 32.0 36.0 14.0 36.0 54-55 31.671596891451493 36.0 32.0 36.0 14.0 36.0 56-57 31.69252945600401 36.0 32.0 36.0 14.0 36.0 58-59 31.32777638505891 36.0 32.0 36.0 14.0 36.0 60-61 31.21709701679619 36.0 32.0 36.0 14.0 36.0 62-63 31.214958959354874 36.0 32.0 36.0 14.0 36.0 64-65 30.89568706118355 36.0 29.5 36.0 14.0 36.0 66-67 31.014167502507522 36.0 32.0 36.0 14.0 36.0 68-69 30.6765295887663 36.0 29.5 36.0 14.0 36.0 70-71 30.70962444129116 36.0 27.0 36.0 14.0 36.0 72-73 30.461559024302847 36.0 27.0 36.0 14.0 36.0 74-75 30.223543756072885 36.0 27.0 36.0 14.0 36.0 76 29.293338108882523 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 0.0 4 1.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 4.0 16 6.0 17 7.0 18 1.0 19 13.0 20 7.0 21 16.0 22 17.0 23 26.0 24 37.0 25 57.0 26 85.0 27 123.0 28 161.0 29 202.0 30 286.0 31 355.0 32 457.0 33 695.0 34 905.0 35 526.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.43107769423559 17.042606516290725 9.899749373433583 30.626566416040102 2 29.79949874686717 22.355889724310778 25.263157894736842 22.581453634085214 3 26.033575544976195 26.835379604109242 19.86970684039088 27.261338010523676 4 31.170132798797294 29.16562265096467 15.534953645702831 24.129290904535207 5 29.29090453520421 32.02204961162616 16.762716111250313 21.92432974191932 6 23.903783512904035 33.57554497619644 19.644199448759707 22.876472062139815 7 23.95389626659985 15.284389877223752 31.470809320972187 29.29090453520421 8 26.917293233082706 20.125313283208023 21.428571428571427 31.528822055137844 9 25.24442216094259 22.286287290047632 24.191526698420656 28.27776385058912 10-11 28.970791024194558 25.93706907358656 17.600601729973675 27.491538172245207 12-13 28.385155466399198 21.351554663991976 21.288866599799398 28.974423269809428 14-15 27.089084065244666 24.015056461731493 22.271016311166875 26.624843161856965 16-17 27.986947791164656 23.004518072289155 21.021586345381525 27.986947791164656 18-19 27.797290516808832 22.453587556447566 21.18665328650276 28.562468640240844 20-21 27.825213460572577 22.802611752887998 22.024108488196887 27.348066298342545 22-23 29.181315921647418 22.84028126569563 20.66800602712205 27.310396785534905 24-25 27.902598217647796 23.660097903853394 20.647671645537844 27.789632232960965 26-27 27.8733827408617 24.054766989071723 20.90189674663987 27.169953523426706 28-29 28.42276830491474 23.37011033099298 21.100802407221664 27.106318956870613 30-31 26.70262134704628 24.670763827919227 21.1714536560893 27.455161168945192 32-33 28.40837827668381 22.977549228646684 21.24670763827919 27.36736485639032 34-35 27.43029389600603 23.78799296659131 21.55237377543331 27.229339361969355 36-37 27.561526870919135 23.455549974886992 21.069814163736815 27.913108990457058 38-39 27.37886015566156 23.424554356013054 21.441124780316343 27.75546070800904 40-41 27.90872617853561 23.207121364092277 20.787362086258774 28.09679037111334 42-43 28.413654618473892 22.527610441767067 21.34789156626506 27.710843373493976 44-45 27.93471437539234 23.465160075329567 21.30571249215317 27.29441305712492 46-47 28.798896690070208 23.37011033099298 20.43630892678034 27.39468405215647 48-49 27.53295668549906 23.27683615819209 21.192718141870685 27.997489014438166 50-51 28.514056224899598 23.15512048192771 21.121987951807228 27.20883534136546 52-53 29.380731063936693 23.439266423816104 20.23615123728175 26.943851274965457 54-55 27.44162691438614 23.374340949033392 21.21516444890786 27.96886768767261 56-57 28.548123980424144 22.449491780650018 22.04793575103526 26.954448487890577 58-59 28.261142498430637 23.163841807909606 20.251098556183305 28.323917137476464 60-61 27.945239889475005 22.95905551369003 22.029640793770408 27.066063803064555 62-63 28.551706827309236 23.36847389558233 21.20983935742972 26.869979919678716 64-65 28.824415975885454 22.645064054257723 21.43933685003768 27.09118311981914 66-67 27.65370138017566 22.521957340025097 21.93224592220828 27.892095357590968 68-69 28.09792843691149 23.4526051475204 21.28060263653484 27.16886377903327 70-71 28.126569563033648 23.505775991963837 20.379206428930186 27.988448016072326 72-73 28.161209068010074 22.770780856423173 20.91939546599496 28.148614609571787 74-75 28.672732138078672 19.96253679421996 22.906074391222905 28.458656676478462 76 30.584438866977408 0.0 27.931158121190393 41.4844030118322 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 10.0 1 5.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.5 7 1.0 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 1.5 19 3.0 20 3.5 21 2.5 22 1.5 23 2.0 24 2.0 25 4.5 26 6.0 27 8.5 28 12.0 29 10.0 30 13.0 31 19.5 32 22.0 33 22.5 34 25.0 35 33.5 36 46.0 37 54.5 38 67.0 39 89.0 40 93.0 41 99.5 42 115.0 43 122.0 44 131.0 45 137.0 46 140.0 47 142.0 48 147.5 49 148.5 50 143.0 51 150.5 52 160.5 53 150.0 54 134.5 55 139.0 56 151.5 57 150.5 58 150.5 59 149.5 60 144.0 61 149.0 62 154.0 63 143.0 64 131.0 65 139.5 66 144.5 67 132.5 68 124.5 69 114.5 70 108.5 71 108.5 72 90.0 73 75.0 74 67.5 75 61.5 76 53.0 77 40.0 78 30.5 79 21.5 80 20.5 81 15.5 82 8.0 83 6.5 84 6.5 85 3.5 86 0.0 87 0.0 88 1.5 89 2.5 90 1.0 91 0.5 92 1.0 93 0.5 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.25 3 0.22499999999999998 4 0.22499999999999998 5 0.22499999999999998 6 0.22499999999999998 7 0.22499999999999998 8 0.25 9 0.27499999999999997 10-11 0.2875 12-13 0.3 14-15 0.375 16-17 0.4 18-19 0.35000000000000003 20-21 0.44999999999999996 22-23 0.44999999999999996 24-25 0.41250000000000003 26-27 0.4875 28-29 0.3 30-31 0.3375 32-33 0.3375 34-35 0.475 36-37 0.22550739163117012 38-39 0.20045101478326235 40-41 0.07516913054372337 42-43 0.17539463793535454 44-45 0.21297920320721622 46-47 0.07516913054372337 48-49 0.21297920320721622 50-51 0.16288685628367372 52-53 0.2380952380952381 54-55 0.1504136375031336 56-57 0.11281022812735021 58-59 0.16294810729506143 60-61 0.2005515166708448 62-63 0.11282437006393381 64-65 0.17552657973921765 66-67 0.07522567703109327 68-69 0.137913741223671 70-71 0.10035122930255895 72-73 0.07550969041026932 74-75 0.09357037829167224 76 0.10744985673352436 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 9.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 1.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 1.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 1.0 70 2.0 71 6.0 72 12.0 73 80.0 74 293.0 75 802.0 76 2792.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.45 #Duplication Level Percentage of deduplicated Percentage of total 1 98.75571356018284 97.225 2 1.0919248349415946 2.15 3 0.10157440325038089 0.3 4 0.025393600812595223 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025393600812595223 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.025 21 0.0 0.0 0.0 0.0 0.025 22 0.0 0.0 0.0 0.0 0.025 23 0.0 0.0 0.0 0.0 0.025 24 0.0 0.0 0.0 0.0 0.025 25 0.0 0.0 0.0 0.0 0.025 26 0.0 0.0 0.0 0.0 0.025 27 0.0 0.0 0.0 0.0 0.025 28 0.0 0.0 0.0 0.0 0.025 29 0.0 0.0 0.0 0.0 0.025 30 0.0 0.0 0.0 0.0 0.025 31 0.0 0.0 0.0 0.0 0.025 32 0.0 0.0 0.0 0.0 0.025 33 0.0 0.0 0.0 0.0 0.025 34 0.0 0.0 0.0 0.0 0.025 35 0.0 0.0 0.0 0.0 0.025 36 0.0 0.0 0.0 0.0 0.025 37 0.0 0.0 0.0 0.0 0.025 38 0.0 0.0 0.0 0.0 0.025 39 0.0 0.0 0.0 0.0 0.025 40 0.0 0.0 0.0 0.0 0.025 41 0.0 0.0 0.0 0.0 0.025 42 0.0 0.0 0.0 0.0 0.025 43 0.0 0.0 0.0 0.0 0.025 44 0.0 0.0 0.0 0.0 0.025 45 0.0 0.0 0.0 0.0 0.025 46 0.0 0.0 0.0 0.0 0.025 47 0.0 0.0 0.0 0.0 0.025 48 0.0 0.0 0.0 0.0 0.025 49 0.0 0.0 0.0 0.0 0.025 50 0.0 0.0 0.0 0.0 0.025 51 0.0 0.0 0.0 0.0 0.025 52 0.0 0.0 0.0 0.0 0.025 53 0.0 0.0 0.0 0.0 0.025 54 0.0 0.0 0.0 0.0 0.025 55 0.0 0.0 0.0 0.0 0.025 56 0.0 0.0 0.0 0.0 0.025 57 0.0 0.0 0.0 0.0 0.025 58 0.0 0.0 0.0 0.0 0.025 59 0.0 0.0 0.0 0.0 0.025 60 0.0 0.0 0.0 0.0 0.025 61 0.0 0.0 0.0 0.0 0.025 62 0.0 0.0 0.0 0.0 0.025 63 0.0 0.0 0.0 0.0 0.025 64 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 890908 spots for SRR11389786.sra Written 890908 spots for SRR11389786.sra Read 890908 spots for SRR11389786.sra Written 890908 spots for SRR11389786.sra Read 890908 spots for SRR11389786.sra Written 890908 spots for SRR11389786.sra Read 890908 spots for SRR11389786.sra Written 890908 spots for SRR11389786.sra Read 890908 spots for SRR11389786.sra Written 890908 spots for SRR11389786.sra Read 890908 spots for SRR11389786.sra Written 890908 spots for SRR11389786.sra Read 890908 spots for SRR11389786.sra Written 890908 spots for SRR11389786.sra Read 890908 spots for SRR11389786.sra Written 890908 spots for SRR11389786.sra Read 890908 spots for SRR11389786.sra Written 890908 spots for SRR11389786.sra Read 890908 spots for SRR11389786.sra Written 890908 spots for SRR11389786.sra Read 890908 spots for SRR11389786.sra Written 890908 spots for SRR11389786.sra Read 890924 spots for SRR11389786.sra Written 890924 spots for SRR11389786.sra Read 890908 spots for SRR11389786.sra Written 890908 spots for SRR11389786.sra Read 890908 spots for SRR11389786.sra Written 890908 spots for SRR11389786.sra Read 890908 spots for SRR11389786.sra Written 890908 spots for SRR11389786.sra Read 890908 spots for SRR11389786.sra Written 890908 spots for SRR11389786.sra Read 890908 spots for SRR11389786.sra Written 890908 spots for SRR11389786.sra Read 890908 spots for SRR11389786.sra Written 890908 spots for SRR11389786.sra Read 890908 spots for SRR11389786.sra Written 890908 spots for SRR11389786.sra Read 890908 spots for SRR11389786.sra Written 890908 spots for SRR11389786.sra SRR ids: ['SRR11389786.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jpk80x0z SRR11389786.sra spots: 17818176 blocks: [[1, 890908], [890909, 1781816], [1781817, 2672724], [2672725, 3563632], [3563633, 4454540], [4454541, 5345448], [5345449, 6236356], [6236357, 7127264], [7127265, 8018172], [8018173, 8909080], [8909081, 9799988], [9799989, 10690896], [10690897, 11581804], [11581805, 12472712], [12472713, 13363620], [13363621, 14254528], [14254529, 15145436], [15145437, 16036344], [16036345, 16927252], [16927253, 17818176]] SRR11389786 file size 3391283 SRR11389786 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389786 SRR11389786_1.fastq SRR11389786_2.fastq Input file: SRR11389786_1.fastq Paired file: SRR11389786_2.fastq trimmed: SRR11389786-trimmed-pair1.fastq, SRR11389786-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:25:09 2024 >> started Sat Dec 7 06:25:24 2024 >> done (14.983s) 17818176 read pairs processed; of these: 617 ( 0.00%) short read pairs filtered out after trimming by size control 12454 ( 0.07%) empty read pairs filtered out after trimming by size control 17805105 (99.93%) read pairs available; of these: 12773 ( 0.07%) trimmed read pairs available after processing 17792332 (99.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 20 0.00% 21 14 0.00% 22 13 0.00% 23 21 0.00% 24 36 0.00% 25 21 0.00% 26 34 0.00% 27 16 0.00% 28 29 0.00% 29 17 0.00% 30 26 0.00% 31 12 0.00% 32 28 0.00% 33 18 0.00% 34 29 0.00% 35 370 0.00% 36 341 0.00% 37 385 0.00% 38 439 0.00% 39 373 0.00% 40 470 0.00% 41 415 0.00% 42 402 0.00% 43 447 0.00% 44 498 0.00% 45 543 0.00% 46 482 0.00% 47 488 0.00% 48 503 0.00% 49 495 0.00% 50 576 0.00% 51 616 0.00% 52 617 0.00% 53 644 0.00% 54 622 0.00% 55 921 0.01% 56 1016 0.01% 57 1095 0.01% 58 1241 0.01% 59 1174 0.01% 60 1351 0.01% 61 1091 0.01% 62 1230 0.01% 63 1387 0.01% 64 1370 0.01% 65 1658 0.01% 66 1786 0.01% 67 2043 0.01% 68 1768 0.01% 69 1946 0.01% 70 2523 0.01% 71 3809 0.02% 72 13241 0.07% 73 134007 0.75% 74 1150551 6.46% 75 7420038 41.67% 76 9049786 50.83% 17805105 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=6.48 fanout-score-rank=15 prefix-density=0.54 prefix-fanout=4.2 sequence=GCCTTGAACACGTGCGCCTCGGGGGTCTCCTTCCAGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=33 fanout-score=15.17 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=3.1 sequence=TCCAGCTCCTTTAGCACCTGCGTGGCGTCGGTGCACCCGAACATGGG criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=4.39 fanout-score-rank=18 prefix-density=0.45 prefix-fanout=3.7 sequence=ACAATGTCGCTGGTGAGGAGGAGCAGCGTGTTCGACC criterion=fanout-score sequence-density=0.09 sequence-density-rank=31 fanout-score=35.07 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=7.2 sequence=GAGGACAAGATGAAGGAG SRR11389786 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:25:52 Started mapping on | Dec 07 06:25:52 Finished on | Dec 07 06:27:38 Mapping speed, Million of reads per hour | 604.70 Number of input reads | 17805105 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 16168185 Uniquely mapped reads % | 90.81% Average mapped length | 149.99 Number of splices: Total | 5100090 Number of splices: Annotated (sjdb) | 4880544 Number of splices: GT/AG | 5042788 Number of splices: GC/AG | 48110 Number of splices: AT/AC | 1886 Number of splices: Non-canonical | 7306 Mismatch rate per base, % | 1.32% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 343632 % of reads mapped to multiple loci | 1.93% Number of reads mapped to too many loci | 66317 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.97% % of reads unmapped: other | 1.92% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1293303 1293303 1293303 N_multimapping 343632 343632 343632 N_noFeature 697171 15625969 989916 N_ambiguous 303937 1740 55263 UnstrandedReadsAssigned:15167077 PositiveStrandReadsAssigned:540476 NegativeStrandReadsAssigned:15123006 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389786 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389786-trimmed-pair1.fastq SRR11389786-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,805,105 reads, 15,312,624 reads pseudoaligned [quant] estimated average fragment length: 222.77 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,025 rounds 52973 SRR11389786.ke.tsv 35125 SRR11389786.se.tsv 88098 total ==> SRR11389786.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 714.365 18.3461 2.06372 PNS24247 1044 822.23 0 0 PNS24249 1928 1706.23 106.654 5.02306 PNS24246 1044 822.23 0 0 PNS24248 1044 822.23 0 0 PNS24244 1471 1249.23 0 0 PNS24243 293 91.8203 0 0 KQK14069 1603 1381.23 3368.44 195.971 KQK14071 474 254.575 107.888 34.0553 ==> SRR11389786.se.tsv <== BRADI_1g14170v3 3484 BRADI_1g53295v3 1814 BRADI_1g59795v3 80 BRADI_1g07683v3 0 BRADI_1g00485v3 15 BRADI_1g20270v3 147 BRADI_1g74790v3 285 BRADI_1g09890v3 1 BRADI_1g77505v3 150 BRADI_1g48960v3 1 SRR11389786 completed mapping pipeline successfully