Starting /dee2/code/volunteer_pipeline.sh SRR11389787 current disk space = 1545447960576 free memory = 1475902756 SRR11389787 SRAfilesize f78772331599e014e0002a12c22b8954 SRR11389787.sra SRR11389787.sra file validated SRR11389787 is paired end SRR11389787 is conventional basespace SRR11389787 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389787_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.96475 32.0 32.0 32.0 14.0 32.0 2 29.00225 32.0 32.0 32.0 14.0 32.0 3 28.88725 32.0 32.0 32.0 14.0 32.0 4 29.073 32.0 32.0 32.0 14.0 32.0 5 29.0665 32.0 32.0 32.0 14.0 32.0 6 31.677 36.0 36.0 36.0 14.0 36.0 7 31.80175 36.0 36.0 36.0 14.0 36.0 8 31.69675 36.0 36.0 36.0 14.0 36.0 9 31.90725 36.0 36.0 36.0 14.0 36.0 10-11 31.771875 36.0 36.0 36.0 14.0 36.0 12-13 31.83275 36.0 36.0 36.0 14.0 36.0 14-15 31.760125000000002 36.0 36.0 36.0 14.0 36.0 16-17 31.787625 36.0 36.0 36.0 14.0 36.0 18-19 31.902124999999998 36.0 36.0 36.0 14.0 36.0 20-21 31.75825 36.0 36.0 36.0 14.0 36.0 22-23 31.545250000000003 36.0 36.0 36.0 14.0 36.0 24-25 31.4585 36.0 36.0 36.0 14.0 36.0 26-27 31.371875000000003 36.0 34.0 36.0 14.0 36.0 28-29 31.323375 36.0 36.0 36.0 14.0 36.0 30-31 31.212874999999997 36.0 34.0 36.0 14.0 36.0 32-33 31.227249999999998 36.0 34.0 36.0 14.0 36.0 34-35 31.010375 36.0 32.0 36.0 14.0 36.0 36-37 33.47362283989247 36.0 36.0 36.0 24.0 36.0 38-39 33.3763427890252 36.0 36.0 36.0 21.0 36.0 40-41 33.20308692120227 36.0 36.0 36.0 17.5 36.0 42-43 33.017736257784996 36.0 36.0 36.0 14.0 36.0 44-45 32.80760898998105 36.0 36.0 36.0 14.0 36.0 46-47 32.93298131600325 36.0 36.0 36.0 14.0 36.0 48-49 33.0540211210398 36.0 36.0 36.0 17.5 36.0 50-51 32.68966605879942 36.0 36.0 36.0 14.0 36.0 52-53 32.71803900325027 36.0 36.0 36.0 14.0 36.0 54-55 32.57854821235102 36.0 36.0 36.0 14.0 36.0 56-57 32.29834777898158 36.0 32.0 36.0 14.0 36.0 58-59 32.0722329134064 36.0 32.0 36.0 14.0 36.0 60-61 32.07468148549742 36.0 32.0 36.0 14.0 36.0 62-63 31.74238298865628 36.0 32.0 36.0 14.0 36.0 64-65 31.984540276647678 36.0 32.0 36.0 14.0 36.0 66-67 31.580146460537023 36.0 32.0 36.0 14.0 36.0 68-69 31.539497478237244 36.0 32.0 36.0 14.0 36.0 70-71 31.58889746829935 36.0 32.0 36.0 14.0 36.0 72-73 31.24056713608212 36.0 32.0 36.0 14.0 36.0 74-75 31.098132497958886 36.0 32.0 36.0 14.0 36.0 76 30.7 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 304.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 0.0 22 8.0 23 11.0 24 25.0 25 27.0 26 21.0 27 78.0 28 107.0 29 159.0 30 222.0 31 344.0 32 456.0 33 677.0 34 992.0 35 568.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.91233766233766 12.202380952380953 11.093073593073594 32.7922077922078 2 22.835497835497836 17.37012987012987 34.659090909090914 25.13528138528138 3 22.483766233766232 19.345238095238095 25.541125541125542 32.62987012987013 4 27.705627705627705 25.270562770562773 18.479437229437227 28.544372294372295 5 29.68073593073593 28.78787878787879 22.13203463203463 19.399350649350648 6 25.568181818181817 29.924242424242426 24.512987012987015 19.994588744588746 7 16.666666666666664 26.67748917748918 36.066017316017316 20.589826839826838 8 18.12770562770563 26.515151515151516 29.274891774891778 26.082251082251084 9 23.72835497835498 19.182900432900432 31.11471861471862 25.97402597402597 10-11 24.18831168831169 30.898268398268396 22.091450216450216 22.821969696969695 12-13 22.767857142857142 24.702380952380953 24.458874458874458 28.070887445887443 14-15 22.456709956709954 25.297619047619047 26.8262987012987 25.419372294372295 16-17 24.499458874458874 24.54004329004329 24.91883116883117 26.041666666666668 18-19 23.471320346320347 23.376623376623375 26.853354978354975 26.2987012987013 20-21 24.756493506493506 24.93235930735931 25.97402597402597 24.33712121212121 22-23 23.647186147186147 27.908549783549784 24.09361471861472 24.350649350649352 24-25 23.038419913419915 24.83766233766234 25.90638528138528 26.217532467532468 26-27 22.808441558441558 24.8241341991342 24.567099567099568 27.800324675324678 28-29 25.419372294372295 26.190476190476193 23.41720779220779 24.97294372294372 30-31 22.199675324675326 24.91883116883117 25.82521645021645 27.056277056277057 32-33 23.160173160173162 25.324675324675322 24.499458874458874 27.01569264069264 34-35 25.108225108225106 23.011363636363637 24.878246753246753 27.0021645021645 36-37 24.87144790257104 23.734776725304467 24.925575101488498 26.468200270635993 38-39 22.729118722079328 26.045756057939624 26.275890077162583 24.949235142818466 40-41 24.898456539398865 23.88302193338749 26.062821554291904 25.15569997292174 42-43 23.842404549147034 24.180882751150826 26.252369347414028 25.724343352288116 44-45 22.7592743027349 24.11318711075007 26.577308421337666 26.550230165177364 46-47 25.264012997562958 24.37043054427295 23.91010018954779 26.455456268616302 48-49 23.24668291362036 25.87327376116978 26.496073652856754 24.3839696723531 50-51 24.955991875423155 23.493568043331077 26.228842247799594 25.321597833446173 52-53 23.009209100758397 23.104008667388946 24.079089924160346 29.807692307692307 54-55 25.311484290357527 23.036294691224267 25.663596966413866 25.988624052004333 56-57 23.307150595882987 24.255146262188514 25.55525460455038 26.882448537378117 58-59 23.089430894308943 24.34959349593496 26.097560975609756 26.463414634146343 60-61 25.56248305773923 23.52941176470588 24.722146923285443 26.185958254269448 62-63 22.901694915254236 24.0135593220339 26.71186440677966 26.372881355932204 64-65 25.07458638459452 23.257390832655275 26.66124220233252 25.006780580417683 66-67 23.596419853539462 26.82397613235693 23.71847030105777 25.861133713045838 68-69 24.534709957886154 26.015487026219265 24.004890639858715 25.444912376035866 70-71 24.170293797606092 26.94504896626768 23.803046789989118 25.081610446137105 72-73 23.644310886490917 26.622046168556206 24.559486408960524 25.17415653599235 74-75 23.355646100116413 23.39930151338766 26.295110593713623 26.949941792782305 76 28.821138211382113 0.0 34.83739837398374 36.34146341463415 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 308.0 1 154.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 4.5 19 9.5 20 12.0 21 11.5 22 14.0 23 11.0 24 5.5 25 6.5 26 12.5 27 20.0 28 23.0 29 26.5 30 28.5 31 35.5 32 45.5 33 50.0 34 49.5 35 54.0 36 75.5 37 101.0 38 110.0 39 119.0 40 134.0 41 148.0 42 166.5 43 173.5 44 175.0 45 170.5 46 168.5 47 223.5 48 229.5 49 170.5 50 150.0 51 136.5 52 130.0 53 116.5 54 102.0 55 109.5 56 104.5 57 108.5 58 125.0 59 116.5 60 111.5 61 111.5 62 102.0 63 87.0 64 80.0 65 70.5 66 62.5 67 64.0 68 65.0 69 57.5 70 44.5 71 45.0 72 42.0 73 33.0 74 28.5 75 27.5 76 24.5 77 19.0 78 11.0 79 5.5 80 9.0 81 9.0 82 4.5 83 4.0 84 2.5 85 1.5 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.6 2 7.6 3 7.6 4 7.6 5 7.6 6 7.6 7 7.6 8 7.6 9 7.6 10-11 7.6 12-13 7.6 14-15 7.6 16-17 7.6 18-19 7.6 20-21 7.6 22-23 7.6 24-25 7.6 26-27 7.6 28-29 7.6 30-31 7.6 32-33 7.6 34-35 7.6 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 304.0 36 2.0 37 0.0 38 1.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 1.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 1.0 58 2.0 59 0.0 60 0.0 61 1.0 62 1.0 63 0.0 64 0.0 65 0.0 66 0.0 67 6.0 68 1.0 69 2.0 70 4.0 71 7.0 72 13.0 73 50.0 74 336.0 75 808.0 76 2460.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.55 #Duplication Level Percentage of deduplicated Percentage of total 1 97.65848086807539 85.5 2 1.599086236436322 2.8000000000000003 3 0.48543689320388345 1.275 4 0.05711022272986865 0.2 5 0.028555111364934323 0.125 6 0.05711022272986865 0.3 7 0.0 0.0 8 0.0 0.0 9 0.028555111364934323 0.22499999999999998 >10 0.028555111364934323 0.325 >50 0.028555111364934323 1.6500000000000001 >100 0.028555111364934323 7.6 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 304 7.6 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 66 1.6500000000000001 TruSeq Adapter, Index 7 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 13 0.325 TruSeq Adapter, Index 7 (97% over 36bp) GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 9 0.22499999999999998 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATGTCGTAT 6 0.15 TruSeq Adapter, Index 7 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATGTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 6 0.15 TruSeq Adapter, Index 7 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGAGCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 5 0.125 TruSeq Adapter, Index 7 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.075 0.0 0.0 0.0 0.0 38 0.075 0.0 0.0 0.0 0.0 39 0.075 0.0 0.0 0.0 0.0 40 0.075 0.0 0.0 0.0 0.0 41 0.075 0.0 0.0 0.0 0.0 42 0.075 0.0 0.0 0.0 0.0 43 0.075 0.0 0.0 0.0 0.0 44 0.075 0.0 0.0 0.0 0.0 45 0.075 0.0 0.0 0.0 0.0 46 0.075 0.0 0.0 0.0 0.0 47 0.075 0.0 0.0 0.0 0.0 48 0.075 0.0 0.0 0.0 0.0 49 0.075 0.0 0.0 0.0 0.0 50 0.075 0.0 0.0 0.0 0.0 51 0.075 0.0 0.0 0.0 0.0 52 0.075 0.0 0.0 0.0 0.0 53 0.075 0.0 0.0 0.0 0.0 54 0.075 0.0 0.0 0.0 0.0 55 0.075 0.0 0.0 0.0 0.0 56 0.075 0.0 0.0 0.0 0.0 57 0.075 0.0 0.0 0.0 0.0 58 0.1 0.0 0.0 0.0 0.0 59 0.1 0.0 0.0 0.0 0.0 60 0.1 0.0 0.0 0.0 0.0 61 0.1 0.0 0.0 0.0 0.0 62 0.1 0.0 0.0 0.0 0.0 63 0.1 0.0 0.0 0.0 0.0 64 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389787 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389787_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.72175 32.0 32.0 32.0 14.0 32.0 2 28.13325 32.0 32.0 32.0 14.0 32.0 3 27.9075 32.0 32.0 32.0 14.0 32.0 4 27.8285 32.0 32.0 32.0 14.0 32.0 5 27.954 32.0 32.0 32.0 14.0 32.0 6 30.9555 36.0 32.0 36.0 14.0 36.0 7 30.86625 36.0 32.0 36.0 14.0 36.0 8 30.64775 36.0 32.0 36.0 14.0 36.0 9 30.6255 36.0 32.0 36.0 14.0 36.0 10-11 30.4755 36.0 32.0 36.0 14.0 36.0 12-13 30.605 36.0 32.0 36.0 14.0 36.0 14-15 30.586624999999998 36.0 32.0 36.0 14.0 36.0 16-17 30.62775 36.0 32.0 36.0 14.0 36.0 18-19 30.547874999999998 36.0 32.0 36.0 14.0 36.0 20-21 30.20275 36.0 32.0 36.0 14.0 36.0 22-23 30.4195 36.0 32.0 36.0 14.0 36.0 24-25 30.255000000000003 36.0 32.0 36.0 14.0 36.0 26-27 30.15475 36.0 32.0 36.0 14.0 36.0 28-29 30.0935 36.0 32.0 36.0 14.0 36.0 30-31 29.972749999999998 36.0 32.0 36.0 14.0 36.0 32-33 29.918 36.0 32.0 36.0 14.0 36.0 34-35 29.87825 36.0 32.0 36.0 14.0 36.0 36-37 32.088761548228746 36.0 34.0 36.0 14.0 36.0 38-39 32.002298539751216 36.0 32.0 36.0 14.0 36.0 40-41 32.02920497566252 36.0 32.0 36.0 14.0 36.0 42-43 31.885749053542455 36.0 32.0 36.0 14.0 36.0 44-45 31.74256354786371 36.0 32.0 36.0 14.0 36.0 46-47 31.48512709572742 36.0 32.0 36.0 14.0 36.0 48-49 31.45808545159546 36.0 32.0 36.0 14.0 36.0 50-51 31.450301890662228 36.0 32.0 36.0 14.0 36.0 52-53 31.254665945361104 36.0 32.0 36.0 14.0 36.0 54-55 31.285231268596156 36.0 32.0 36.0 14.0 36.0 56-57 31.103597511495806 36.0 32.0 36.0 14.0 36.0 58-59 30.955599867649987 36.0 32.0 36.0 14.0 36.0 60-61 30.722583265637695 36.0 29.5 36.0 14.0 36.0 62-63 30.729460962259814 36.0 29.5 36.0 14.0 36.0 64-65 30.41411541587646 36.0 27.0 36.0 14.0 36.0 66-67 30.353427255486316 36.0 27.0 36.0 14.0 36.0 68-69 30.210971838876944 36.0 27.0 36.0 14.0 36.0 70-71 29.99966786566693 36.0 27.0 36.0 14.0 36.0 72-73 30.15360441959787 36.0 27.0 36.0 14.0 36.0 74-75 29.95955829862863 36.0 27.0 36.0 14.0 36.0 76 29.03067993366501 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 299.0 3 0.0 4 1.0 5 3.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 34.0 16 51.0 17 32.0 18 25.0 19 13.0 20 17.0 21 14.0 22 24.0 23 49.0 24 43.0 25 46.0 26 79.0 27 100.0 28 102.0 29 169.0 30 258.0 31 303.0 32 413.0 33 573.0 34 833.0 35 516.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.027027027027025 17.91891891891892 10.027027027027028 31.027027027027028 2 32.432432432432435 22.89189189189189 27.16216216216216 17.513513513513512 3 27.72223723318022 26.64144825722778 22.345312077816807 23.291002431775194 4 31.342880302620912 29.58659821669819 16.779248851661713 22.291272629019186 5 30.883544987841123 30.883544987841123 19.211024047554716 19.021885976763038 6 25.668738178870576 32.910024317751954 20.670089165090516 20.75114833828695 7 25.74979735206701 17.64388003242367 32.937044042150774 23.66927857335855 8 25.2364225884896 23.291002431775194 23.507160226965684 27.965414752769526 9 26.668467981626588 22.453390975412052 25.425560659281278 25.452580383680086 10-11 28.032454361054764 28.69506423258959 19.54022988505747 23.732251521298174 12-13 28.990800865800864 21.536796536796537 22.091450216450216 27.380952380952383 14-15 27.852212748680472 24.53647313574232 23.60265259169035 24.00866152388686 16-17 28.32588983624306 24.238733252131546 22.966571931249156 24.468804980376234 18-19 28.892499323043598 23.05713512049824 22.935282967776875 25.115082588681286 20-21 27.35772357723577 25.37940379403794 23.78048780487805 23.48238482384824 22-23 30.34529451591063 22.721733243060257 22.613405551794177 24.319566689234936 24-25 27.639415268002164 25.216567406605307 22.428262046561994 24.715755278830535 26-27 26.15467966951104 26.263036705946092 23.486387647297846 24.09589597724502 28-29 26.806495263870094 25.358592692828147 22.354533152909337 25.480378890392423 30-31 27.452306859694225 24.92220267893384 23.460966039778107 24.164524421593832 32-33 26.856988228927076 25.20633202543634 24.32688404816669 23.609795697469895 34-35 29.471544715447155 23.67208672086721 22.289972899728998 24.566395663956637 36-37 28.226681127982644 24.38991323210412 23.169739696312362 24.21366594360087 38-39 28.32746001626457 24.722146923285443 22.892382759555435 24.05801030089455 40-41 29.076381365113757 23.875947995666305 22.034127843986997 25.013542795232937 42-43 28.99512459371614 24.52600216684724 22.345612134344528 24.133261105092092 44-45 26.88608966544765 24.190708384125696 23.933360422592443 24.989841527834216 46-47 28.530767145567903 25.264299268094337 22.241799945784766 23.963133640552993 48-49 26.999186771482787 23.556519381946327 24.627270262943888 24.817023583626998 50-51 27.636215776633232 24.16644076985633 23.597180807806993 24.600162645703445 52-53 28.925956061838892 24.627068077027396 21.34526715486846 25.101708706265256 54-55 28.219029547302792 24.451070750880998 23.27188940092166 24.05801030089455 56-57 28.271471146030887 24.39718233541046 23.096721755621783 24.234624762936875 58-59 29.251423921887714 23.108218063466232 23.162462706807702 24.477895307838352 60-61 27.95334327953343 24.72534924725349 22.93503322935033 24.386274243862744 62-63 29.629629629629626 23.61959028625695 22.507122507122507 24.24365757699091 64-65 29.176279006649473 23.97883023476727 22.689645813543223 24.15524494504003 66-67 27.604449267498644 25.393380358111774 22.80249593054802 24.199674443841563 68-69 26.85776389077571 25.86605080831409 23.67884798261106 23.597337318299143 70-71 26.27280152463926 25.238224884290773 23.645521372175335 24.843452218894637 72-73 25.64454196379594 26.618211738891933 23.587493143170597 24.149753154141525 74-75 25.545533895839394 25.181844631946465 24.236252545824847 25.03636892638929 76 28.417116742833404 0.0 32.73784794349813 38.84503531366847 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 302.0 1 151.0 2 0.0 3 0.5 4 1.0 5 0.5 6 1.5 7 1.5 8 0.0 9 1.5 10 1.5 11 0.0 12 0.0 13 0.5 14 1.5 15 2.0 16 1.5 17 2.5 18 5.0 19 6.0 20 6.0 21 7.0 22 8.5 23 9.0 24 11.0 25 13.0 26 13.5 27 16.5 28 16.5 29 15.5 30 19.5 31 23.5 32 33.5 33 42.0 34 47.0 35 58.5 36 65.5 37 68.0 38 91.5 39 107.0 40 104.0 41 120.0 42 143.5 43 157.0 44 154.5 45 138.5 46 129.5 47 140.5 48 146.0 49 146.5 50 146.0 51 138.0 52 123.5 53 110.5 54 111.0 55 117.0 56 126.0 57 134.0 58 142.5 59 139.0 60 132.0 61 130.0 62 118.5 63 105.5 64 88.0 65 81.0 66 81.0 67 79.0 68 84.0 69 80.5 70 70.0 71 60.5 72 52.5 73 49.0 74 45.5 75 43.0 76 41.0 77 34.5 78 24.0 79 12.5 80 11.0 81 16.0 82 11.0 83 3.5 84 2.5 85 2.5 86 3.5 87 3.5 88 2.5 89 1.5 90 1.5 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 1.0 99 1.5 100 2.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.5 2 7.5 3 7.475 4 7.475 5 7.475 6 7.475 7 7.475 8 7.475 9 7.475 10-11 7.5625 12-13 7.6 14-15 7.6375 16-17 7.6375 18-19 7.675 20-21 7.75 22-23 7.6875 24-25 7.6499999999999995 26-27 7.7125 28-29 7.625 30-31 7.6125 32-33 7.6125 34-35 7.75 36-37 0.3108528179483714 38-39 0.24337479718766902 40-41 0.16224986479177933 42-43 0.16224986479177933 44-45 0.17577068685776095 46-47 0.24337479718766902 48-49 0.24337479718766902 50-51 0.22988505747126436 52-53 0.2704895861509332 54-55 0.21639166892074654 56-57 0.1622937516905599 58-59 0.18949648077964265 60-61 0.1760086650419713 62-63 0.16253555465258024 64-65 0.1761040368463831 66-67 0.135464643727987 68-69 0.135666802333469 70-71 0.13594344752582926 72-73 0.16429353778751368 74-75 0.20325203252032523 76 0.20729684908789386 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 299.0 36 3.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 1.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 2.0 58 2.0 59 0.0 60 0.0 61 1.0 62 1.0 63 0.0 64 0.0 65 0.0 66 0.0 67 5.0 68 1.0 69 2.0 70 10.0 71 9.0 72 24.0 73 65.0 74 262.0 75 901.0 76 2412.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.15223386651958 88.97500000000001 2 1.5995587424158852 2.9000000000000004 3 0.1654715940430226 0.44999999999999996 4 0.05515719801434087 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.027578599007170437 7.475 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 299 7.475 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.075 0.0 0.0 0.0 0.0 20 0.075 0.0 0.0 0.0 0.0 21 0.1 0.0 0.0 0.0 0.0 22 0.1 0.0 0.0 0.0 0.0 23 0.125 0.0 0.0 0.0 0.0 24 0.125 0.0 0.0 0.0 0.0 25 0.15 0.0 0.0 0.0 0.0 26 0.15 0.0 0.0 0.0 0.0 27 0.225 0.0 0.0 0.0 0.0 28 0.225 0.0 0.0 0.0 0.0 29 0.225 0.0 0.0 0.0 0.0 30 0.225 0.0 0.0 0.0 0.0 31 0.225 0.0 0.0 0.0 0.0 32 0.225 0.0 0.0 0.0 0.0 33 0.25 0.0 0.0 0.0 0.0 34 0.25 0.0 0.0 0.0 0.0 35 0.25 0.0 0.0 0.0 0.0 36 0.25 0.0 0.0 0.0 0.0 37 0.25 0.0 0.0 0.0 0.0 38 0.25 0.0 0.0 0.0 0.0 39 0.25 0.0 0.0 0.0 0.0 40 0.25 0.0 0.0 0.0 0.0 41 0.25 0.0 0.0 0.0 0.0 42 0.25 0.0 0.0 0.0 0.0 43 0.25 0.0 0.0 0.0 0.0 44 0.25 0.0 0.0 0.0 0.0 45 0.25 0.0 0.0 0.0 0.0 46 0.25 0.0 0.0 0.0 0.0 47 0.25 0.0 0.0 0.0 0.0 48 0.25 0.0 0.0 0.0 0.0 49 0.25 0.0 0.0 0.0 0.0 50 0.25 0.0 0.0 0.0 0.0 51 0.25 0.0 0.0 0.0 0.0 52 0.25 0.0 0.0 0.0 0.0 53 0.25 0.0 0.0 0.0 0.0 54 0.25 0.0 0.0 0.0 0.0 55 0.25 0.0 0.0 0.0 0.0 56 0.25 0.0 0.0 0.0 0.0 57 0.25 0.0 0.0 0.0 0.0 58 0.25 0.0 0.0 0.0 0.0 59 0.25 0.0 0.0 0.0 0.0 60 0.25 0.0 0.0 0.0 0.0 61 0.25 0.0 0.0 0.0 0.0 62 0.25 0.0 0.0 0.0 0.0 63 0.25 0.0 0.0 0.0 0.0 64 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCCTG 15 0.0021220462 69.44 7 >>END_MODULE Read 682443 spots for SRR11389787.sra Written 682443 spots for SRR11389787.sra Read 682443 spots for SRR11389787.sra Written 682443 spots for SRR11389787.sra Read 682454 spots for SRR11389787.sra Written 682454 spots for SRR11389787.sra Read 682443 spots for SRR11389787.sra Written 682443 spots for SRR11389787.sra Read 682443 spots for SRR11389787.sra Written 682443 spots for SRR11389787.sra Read 682443 spots for SRR11389787.sra Written 682443 spots for SRR11389787.sra Read 682443 spots for SRR11389787.sra Written 682443 spots for SRR11389787.sra Read 682443 spots for SRR11389787.sra Written 682443 spots for SRR11389787.sra Read 682443 spots for SRR11389787.sra Written 682443 spots for SRR11389787.sra Read 682443 spots for SRR11389787.sra Written 682443 spots for SRR11389787.sra Read 682443 spots for SRR11389787.sra Written 682443 spots for SRR11389787.sra Read 682443 spots for SRR11389787.sra Written 682443 spots for SRR11389787.sra Read 682443 spots for SRR11389787.sra Written 682443 spots for SRR11389787.sra Read 682443 spots for SRR11389787.sra Written 682443 spots for SRR11389787.sra Read 682443 spots for SRR11389787.sra Written 682443 spots for SRR11389787.sra Read 682443 spots for SRR11389787.sra Written 682443 spots for SRR11389787.sra Read 682443 spots for SRR11389787.sra Written 682443 spots for SRR11389787.sra Read 682443 spots for SRR11389787.sra Written 682443 spots for SRR11389787.sra Read 682443 spots for SRR11389787.sra Written 682443 spots for SRR11389787.sra Read 682443 spots for SRR11389787.sra Written 682443 spots for SRR11389787.sra SRR ids: ['SRR11389787.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7efry_xq SRR11389787.sra spots: 13648871 blocks: [[1, 682443], [682444, 1364886], [1364887, 2047329], [2047330, 2729772], [2729773, 3412215], [3412216, 4094658], [4094659, 4777101], [4777102, 5459544], [5459545, 6141987], [6141988, 6824430], [6824431, 7506873], [7506874, 8189316], [8189317, 8871759], [8871760, 9554202], [9554203, 10236645], [10236646, 10919088], [10919089, 11601531], [11601532, 12283974], [12283975, 12966417], [12966418, 13648871]] SRR11389787 file size 2487116 SRR11389787 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389787 SRR11389787_1.fastq SRR11389787_2.fastq Input file: SRR11389787_1.fastq Paired file: SRR11389787_2.fastq trimmed: SRR11389787-trimmed-pair1.fastq, SRR11389787-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:31:28 2024 >> started Sat Dec 7 06:33:20 2024 >> done (111.287s) 13648871 read pairs processed; of these: 2246 ( 0.02%) short read pairs filtered out after trimming by size control 1939459 (14.21%) empty read pairs filtered out after trimming by size control 11707166 (85.77%) read pairs available; of these: 74163 ( 0.63%) trimmed read pairs available after processing 11633003 (99.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5734 0.05% 19 143 0.00% 20 8019 0.07% 21 126 0.00% 22 8922 0.08% 23 145 0.00% 24 9334 0.08% 25 111 0.00% 26 9164 0.08% 27 122 0.00% 28 7627 0.07% 29 73 0.00% 30 5697 0.05% 31 82 0.00% 32 4251 0.04% 33 63 0.00% 34 3093 0.03% 35 234 0.00% 36 5927 0.05% 37 218 0.00% 38 3057 0.03% 39 246 0.00% 40 1404 0.01% 41 307 0.00% 42 748 0.01% 43 374 0.00% 44 676 0.01% 45 443 0.00% 46 582 0.00% 47 619 0.01% 48 744 0.01% 49 716 0.01% 50 827 0.01% 51 897 0.01% 52 977 0.01% 53 1130 0.01% 54 1178 0.01% 55 2009 0.02% 56 3538 0.03% 57 2643 0.02% 58 2229 0.02% 59 2110 0.02% 60 2258 0.02% 61 2290 0.02% 62 2568 0.02% 63 2902 0.02% 64 3200 0.03% 65 3463 0.03% 66 3775 0.03% 67 4547 0.04% 68 4143 0.04% 69 4760 0.04% 70 5461 0.05% 71 7578 0.06% 72 17680 0.15% 73 109877 0.94% 74 801846 6.85% 75 5114051 43.68% 76 5520228 47.15% 11707166 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=22 prefix-density=0.59 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=8.38 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=1.0 sequence=AGAGTCTTGATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAG criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=19 prefix-density=0.69 prefix-fanout=2.1 sequence=GTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=7.96 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.2 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC SRR11389787 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:38:52 Started mapping on | Dec 07 06:38:53 Finished on | Dec 07 07:08:27 Mapping speed, Million of reads per hour | 23.76 Number of input reads | 11707166 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 9594597 Uniquely mapped reads % | 81.95% Average mapped length | 149.74 Number of splices: Total | 3741506 Number of splices: Annotated (sjdb) | 3575444 Number of splices: GT/AG | 3690698 Number of splices: GC/AG | 44201 Number of splices: AT/AC | 1263 Number of splices: Non-canonical | 5344 Mismatch rate per base, % | 1.31% Deletion rate per base | 0.01% Deletion average length | 1.72 Insertion rate per base | 0.01% Insertion average length | 1.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1086932 % of reads mapped to multiple loci | 9.28% Number of reads mapped to too many loci | 45351 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.16% % of reads unmapped: other | 2.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1025641 1025641 1025641 N_multimapping 1086932 1086932 1086932 N_noFeature 341148 9306690 438157 N_ambiguous 274661 1720 91203 UnstrandedReadsAssigned:8978788 PositiveStrandReadsAssigned:286187 NegativeStrandReadsAssigned:9065237 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389787 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389787-trimmed-pair1.fastq SRR11389787-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,707,166 reads, 10,023,017 reads pseudoaligned [quant] estimated average fragment length: 185.01 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52973 SRR11389787.ke.tsv 35125 SRR11389787.se.tsv 88098 total ==> SRR11389787.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 752.103 0 0 PNS24247 1044 859.99 6.85549 1.05034 PNS24249 1928 1743.99 51.5508 3.89472 PNS24246 1044 859.99 6.85549 1.05034 PNS24248 1044 859.99 6.85549 1.05034 PNS24244 1471 1286.99 46.8827 4.79979 PNS24243 293 121.021 0 0 KQK14069 1603 1418.99 173.63 16.1224 KQK14071 474 291.466 2.79986 1.26571 ==> SRR11389787.se.tsv <== BRADI_1g14170v3 196 BRADI_1g53295v3 6 BRADI_1g59795v3 146 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 154 BRADI_1g74790v3 166 BRADI_1g09890v3 2 BRADI_1g77505v3 152 BRADI_1g48960v3 0 SRR11389787 completed mapping pipeline successfully