Starting /dee2/code/volunteer_pipeline.sh SRR11389789 current disk space = 1545402871808 free memory = 1599893916 SRR11389789 SRAfilesize 0ab44612b54ae2cf3486cfbf8c08ee3b SRR11389789.sra SRR11389789.sra file validated SRR11389789 is paired end SRR11389789 is conventional basespace SRR11389789 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389789_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.568 32.0 32.0 32.0 32.0 32.0 2 30.47975 32.0 32.0 32.0 32.0 32.0 3 30.60875 32.0 32.0 32.0 32.0 32.0 4 30.5855 32.0 32.0 32.0 32.0 32.0 5 30.612 32.0 32.0 32.0 32.0 32.0 6 33.46525 36.0 36.0 36.0 21.0 36.0 7 33.51025 36.0 36.0 36.0 32.0 36.0 8 33.40225 36.0 36.0 36.0 21.0 36.0 9 33.68125 36.0 36.0 36.0 32.0 36.0 10-11 33.4795 36.0 36.0 36.0 26.5 36.0 12-13 33.626875 36.0 36.0 36.0 32.0 36.0 14-15 33.510125 36.0 36.0 36.0 32.0 36.0 16-17 33.52575 36.0 36.0 36.0 32.0 36.0 18-19 33.5245 36.0 36.0 36.0 32.0 36.0 20-21 33.51925 36.0 36.0 36.0 32.0 36.0 22-23 33.263374999999996 36.0 36.0 36.0 21.0 36.0 24-25 33.159125 36.0 36.0 36.0 21.0 36.0 26-27 33.03275 36.0 36.0 36.0 21.0 36.0 28-29 32.956374999999994 36.0 36.0 36.0 21.0 36.0 30-31 32.945875 36.0 36.0 36.0 21.0 36.0 32-33 32.833625 36.0 36.0 36.0 14.0 36.0 34-35 32.80525 36.0 36.0 36.0 14.0 36.0 36-37 33.37257900101937 36.0 36.0 36.0 21.0 36.0 38-39 33.294131351918935 36.0 36.0 36.0 21.0 36.0 40-41 33.15026765230691 36.0 36.0 36.0 21.0 36.0 42-43 33.19589599796075 36.0 36.0 36.0 21.0 36.0 44-45 33.0229416263064 36.0 36.0 36.0 14.0 36.0 46-47 32.78613306143258 36.0 36.0 36.0 14.0 36.0 48-49 32.76714249299006 36.0 36.0 36.0 14.0 36.0 50-51 32.578893703798116 36.0 34.0 36.0 14.0 36.0 52-53 32.40963548304869 36.0 32.0 36.0 14.0 36.0 54-55 32.39472342594953 36.0 34.0 36.0 14.0 36.0 56-57 32.16904640489546 36.0 32.0 36.0 14.0 36.0 58-59 31.977817440081594 36.0 32.0 36.0 14.0 36.0 60-61 31.804778555460658 36.0 32.0 36.0 14.0 36.0 62-63 31.662586074980872 36.0 32.0 36.0 14.0 36.0 64-65 31.64417871586278 36.0 32.0 36.0 14.0 36.0 66-67 31.28793105019502 36.0 32.0 36.0 14.0 36.0 68-69 31.29203878540444 36.0 32.0 36.0 14.0 36.0 70-71 31.189025396393383 36.0 32.0 36.0 14.0 36.0 72-73 31.121545342547243 36.0 32.0 36.0 14.0 36.0 74-75 30.73244705603189 36.0 32.0 36.0 14.0 36.0 76 30.439645625692137 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 76.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 3.0 23 7.0 24 28.0 25 29.0 26 41.0 27 95.0 28 130.0 29 179.0 30 258.0 31 361.0 32 512.0 33 766.0 34 1004.0 35 511.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.45565749235474 12.640163098878695 11.18756371049949 37.71661569826708 2 25.101936799184504 12.359836901121305 35.85626911314985 26.68195718654434 3 24.79612640163099 19.26605504587156 22.426095820591232 33.51172273190622 4 30.759429153924568 25.739041794087665 17.940876656472987 25.560652395514783 5 26.783893985728845 29.204892966360855 21.967380224260957 22.043832823649335 6 24.285714285714285 29.744897959183675 24.540816326530614 21.428571428571427 7 18.75637104994903 24.159021406727827 36.41692150866463 20.667686034658512 8 20.97349643221203 21.941896024464832 29.587155963302752 27.49745158002039 9 21.58511722731906 20.38735983690112 33.28236493374108 24.745158002038735 10-11 24.32466870540265 29.077471967380227 22.770132517838938 23.827726809378184 12-13 24.745158002038735 22.80835881753313 24.260958205912335 28.1855249745158 14-15 24.426605504587158 25.15290519877676 25.369520897043834 25.050968399592254 16-17 24.32466870540265 23.853211009174313 24.859836901121305 26.962283384301735 18-19 25.28032619775739 24.643221202854228 24.222731906218144 25.853720693170235 20-21 24.375637104994905 24.299184505606526 24.872579001019368 26.452599388379205 22-23 24.554026503567787 24.7579001019368 25.35677879714577 25.33129459734964 24-25 25.293068297655452 24.184505606523953 23.585626911314986 26.936799184505606 26-27 24.184505606523953 24.31192660550459 25.840978593272173 25.662589194699287 28-29 23.980632008154945 25.35677879714577 23.68756371049949 26.975025484199794 30-31 23.84046890927625 25.726299694189603 24.299184505606526 26.134046890927625 32-33 24.694189602446485 24.71967380224261 24.770642201834864 25.815494393476047 34-35 24.79612640163099 23.865953109072375 24.171763506625894 27.166156982670742 36-37 24.898063200815496 24.464831804281346 24.515800203873596 26.12130479102956 38-39 24.455205811138015 23.614120045877403 25.4747037084236 26.455970434560978 40-41 24.64950293143003 23.846546010706092 24.203415753250063 27.300535304613817 42-43 25.375987764465968 24.13968901351007 24.47106806015804 26.013255161865917 44-45 24.547540147846036 24.573030843742032 24.776956410910017 26.102472597501915 46-47 25.63089472342595 24.318123884782057 24.037726229926076 26.013255161865917 48-49 25.47795054804996 23.948508794290085 23.438694876370125 27.13484578128983 50-51 25.044608717817994 23.706347183278105 24.47106806015804 26.77797603874586 52-53 25.375987764465968 22.73770073923018 23.515166964058118 28.37114453224573 54-55 24.585776191690034 23.706347183278105 24.48381340810604 27.22406321692582 56-57 24.55379908210097 24.209586945436 24.400815910249875 26.835798062213158 58-59 24.74502804691484 23.71239163691994 24.42631310555839 27.116267210606832 60-61 25.882952951676653 23.34565854902461 24.3911768455948 26.380211653703938 62-63 24.674827850038255 23.718439173680185 24.891609283346085 26.715123692935478 64-65 25.073332483101645 23.55566891978064 24.320877439102155 27.05012115801556 66-67 25.156269932389336 22.9876259727006 23.102436535272357 28.75366755963771 68-69 25.363613166624138 23.054350599642767 24.993620821638174 26.588415412094925 70-71 25.357325165900967 23.64726901480347 23.532414497192445 27.462991322103115 72-73 24.836685026258486 23.55578327142308 23.760727552196748 27.846804150121685 74-75 25.026954177897576 20.87601078167116 25.822102425876007 28.274932614555254 76 28.497600590623843 0.0 33.14876338132152 38.35363602805463 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 78.0 1 39.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 3.0 19 6.5 20 9.0 21 12.0 22 11.0 23 10.5 24 8.0 25 6.0 26 11.5 27 22.5 28 31.0 29 31.0 30 32.0 31 34.0 32 43.0 33 55.0 34 58.5 35 64.0 36 77.5 37 91.5 38 106.5 39 121.0 40 129.0 41 149.0 42 168.0 43 160.0 44 148.5 45 162.5 46 184.5 47 182.5 48 174.5 49 161.0 50 146.0 51 138.5 52 124.5 53 120.5 54 121.0 55 116.5 56 111.0 57 118.5 58 127.5 59 138.0 60 132.0 61 104.0 62 93.5 63 98.5 64 96.0 65 91.0 66 100.0 67 104.5 68 94.0 69 83.0 70 71.5 71 61.0 72 56.0 73 54.0 74 52.0 75 42.5 76 33.5 77 29.0 78 21.5 79 15.0 80 18.0 81 17.0 82 9.0 83 3.5 84 2.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.9 2 1.9 3 1.9 4 1.9 5 1.9 6 2.0 7 1.9 8 1.9 9 1.9 10-11 1.9 12-13 1.9 14-15 1.9 16-17 1.9 18-19 1.9 20-21 1.9 22-23 1.9 24-25 1.9 26-27 1.9 28-29 1.9 30-31 1.9 32-33 1.9 34-35 1.9 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 76.0 36 0.0 37 0.0 38 1.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 0.0 57 0.0 58 0.0 59 0.0 60 1.0 61 0.0 62 0.0 63 0.0 64 1.0 65 0.0 66 1.0 67 0.0 68 0.0 69 0.0 70 2.0 71 6.0 72 15.0 73 55.0 74 262.0 75 870.0 76 2709.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.525 #Duplication Level Percentage of deduplicated Percentage of total 1 97.93247840879351 93.55 2 1.7011253598534413 3.25 3 0.20936927505888508 0.6 4 0.026171159382360636 0.1 5 0.05234231876472127 0.25 6 0.026171159382360636 0.15 7 0.0 0.0 8 0.026171159382360636 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.026171159382360636 1.9 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 76 1.9 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 8 0.2 No Hit GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCT 6 0.15 No Hit GAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTGAGCTGAC 5 0.125 No Hit CAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.075 0.0 0.0 0.0 0.0 30 0.075 0.0 0.0 0.0 0.0 31 0.1 0.0 0.0 0.0 0.0 32 0.1 0.0 0.0 0.0 0.0 33 0.125 0.0 0.0 0.0 0.0 34 0.125 0.0 0.0 0.0 0.0 35 0.125 0.0 0.0 0.0 0.0 36 0.125 0.0 0.0 0.0 0.0 37 0.125 0.0 0.0 0.0 0.0 38 0.125 0.0 0.0 0.0 0.0 39 0.125 0.0 0.0 0.0 0.0 40 0.125 0.0 0.0 0.0 0.0 41 0.125 0.0 0.0 0.0 0.0 42 0.125 0.0 0.0 0.0 0.0 43 0.125 0.0 0.0 0.0 0.0 44 0.125 0.0 0.0 0.0 0.0 45 0.125 0.0 0.0 0.0 0.0 46 0.125 0.0 0.0 0.0 0.0 47 0.125 0.0 0.0 0.0 0.0 48 0.125 0.0 0.0 0.0 0.0 49 0.125 0.0 0.0 0.0 0.0 50 0.125 0.0 0.0 0.0 0.0 51 0.125 0.0 0.0 0.0 0.0 52 0.125 0.0 0.0 0.0 0.0 53 0.125 0.0 0.0 0.0 0.0 54 0.125 0.0 0.0 0.0 0.0 55 0.125 0.0 0.0 0.0 0.0 56 0.125 0.0 0.0 0.0 0.0 57 0.125 0.0 0.0 0.0 0.0 58 0.125 0.0 0.0 0.0 0.0 59 0.125 0.0 0.0 0.0 0.0 60 0.125 0.0 0.0 0.0 0.0 61 0.125 0.0 0.0 0.0 0.0 62 0.125 0.0 0.0 0.0 0.0 63 0.125 0.0 0.0 0.0 0.0 64 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389789 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389789_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.063 32.0 32.0 32.0 21.0 32.0 2 29.73 32.0 32.0 32.0 21.0 32.0 3 29.62 32.0 32.0 32.0 14.0 32.0 4 29.8505 32.0 32.0 32.0 21.0 32.0 5 29.861 32.0 32.0 32.0 21.0 32.0 6 32.9115 36.0 36.0 36.0 21.0 36.0 7 32.74375 36.0 36.0 36.0 21.0 36.0 8 32.71175 36.0 36.0 36.0 14.0 36.0 9 32.758 36.0 36.0 36.0 14.0 36.0 10-11 32.67 36.0 36.0 36.0 14.0 36.0 12-13 32.660624999999996 36.0 36.0 36.0 17.5 36.0 14-15 32.558125000000004 36.0 36.0 36.0 14.0 36.0 16-17 32.676 36.0 36.0 36.0 17.5 36.0 18-19 32.599000000000004 36.0 36.0 36.0 14.0 36.0 20-21 32.36925 36.0 36.0 36.0 14.0 36.0 22-23 32.426249999999996 36.0 36.0 36.0 14.0 36.0 24-25 32.3305 36.0 36.0 36.0 14.0 36.0 26-27 32.216750000000005 36.0 36.0 36.0 14.0 36.0 28-29 32.163375 36.0 36.0 36.0 14.0 36.0 30-31 32.171625 36.0 36.0 36.0 14.0 36.0 32-33 32.0375 36.0 36.0 36.0 14.0 36.0 34-35 31.974875 36.0 36.0 36.0 14.0 36.0 36-37 32.57306732097871 36.0 36.0 36.0 14.0 36.0 38-39 32.58391947648121 36.0 36.0 36.0 14.0 36.0 40-41 32.46182328907048 36.0 36.0 36.0 14.0 36.0 42-43 32.410367722165475 36.0 36.0 36.0 14.0 36.0 44-45 32.25427841634738 36.0 36.0 36.0 14.0 36.0 46-47 32.0 36.0 32.0 36.0 14.0 36.0 48-49 31.675989782886333 36.0 32.0 36.0 14.0 36.0 50-51 31.813793103448276 36.0 32.0 36.0 14.0 36.0 52-53 31.575223499361428 36.0 32.0 36.0 14.0 36.0 54-55 31.496934865900386 36.0 32.0 36.0 14.0 36.0 56-57 31.348237097598364 36.0 32.0 36.0 14.0 36.0 58-59 31.33571793561574 36.0 32.0 36.0 14.0 36.0 60-61 31.12646467802972 36.0 32.0 36.0 14.0 36.0 62-63 30.81906465627396 36.0 29.5 36.0 14.0 36.0 64-65 30.848948558812662 36.0 32.0 36.0 14.0 36.0 66-67 30.6953780603604 36.0 29.5 36.0 14.0 36.0 68-69 30.57261569930964 36.0 29.5 36.0 14.0 36.0 70-71 30.576222328230607 36.0 27.0 36.0 14.0 36.0 72-73 30.480558555129935 36.0 27.0 36.0 14.0 36.0 74-75 30.222800518145014 36.0 27.0 36.0 14.0 36.0 76 28.891344383057092 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 82.0 3 0.0 4 1.0 5 3.0 6 3.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 8.0 16 6.0 17 9.0 18 6.0 19 7.0 20 11.0 21 11.0 22 33.0 23 49.0 24 32.0 25 67.0 26 83.0 27 114.0 28 171.0 29 204.0 30 254.0 31 351.0 32 497.0 33 653.0 34 866.0 35 477.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.651352730985195 19.729453802960695 10.566615620214396 33.052577845839714 2 31.31699846860643 22.588055130168453 26.64624808575804 19.448698315467077 3 24.98723838693211 26.544155181214908 21.92445125063808 26.544155181214908 4 30.04083716181725 29.88769780500255 17.866258295048496 22.2052067381317 5 29.45380296069423 32.414497192445126 17.84073506891271 20.29096477794793 6 22.2052067381317 34.30321592649311 20.62276671771312 22.86881061766207 7 22.537008677896885 17.100561510974988 33.25676365492598 27.105666156202147 8 24.9936175644626 20.194026040336993 25.04467704876181 29.7676793464386 9 25.79162410623085 21.29724208375894 25.0 27.911133810010213 10-11 27.926891615541923 26.508179959100204 19.32515337423313 26.23977505112474 12-13 27.82608695652174 21.29156010230179 22.813299232736572 28.069053708439895 14-15 26.17372393501343 23.998976589484457 23.3081744914929 26.519124984009213 16-17 27.42162507997441 23.749200255918108 22.277671145233523 26.551503518873957 18-19 26.573694984646878 23.36233367451382 23.92528147389969 26.138689866939615 20-21 27.220373688251854 22.99718454056821 24.187356027642693 25.59508574353724 22-23 28.11620168927566 24.033785513181467 22.17814179677502 25.671871000767855 24-25 26.70505438259757 24.70889315419066 23.198976327575178 25.387076135636594 26-27 25.45757071547421 25.521566619736337 23.37130423652886 25.649558428260594 28-29 26.80992581222819 24.36684574059862 22.678434382194933 26.144794064978257 30-31 26.519124984009213 24.293207112703083 23.743123960598695 25.444543942689013 32-33 26.659843929896383 23.935013432263016 23.807087117820135 25.59805552002047 34-35 28.0174068859593 23.473697683348266 22.87213618328427 25.636759247408165 36-37 27.044669141174964 23.66568539613465 23.53769358761039 25.751951875079993 38-39 28.008192524321558 24.347158218125962 21.927803379416282 25.7168458781362 40-41 26.9575230296827 24.232343909928353 22.7482088024565 26.061924257932446 42-43 27.700972862263185 23.899129544290833 22.01740911418331 26.382488479262673 44-45 27.42637644046095 23.52112676056338 22.701664532650447 26.350832266325224 46-47 26.18042226487524 25.24632117722329 22.31605886116443 26.257197696737045 48-49 26.917659111281857 23.549750288129083 23.421692918427457 26.11089768216161 50-51 27.508960573476703 24.321556579621095 22.887864823348693 25.28161802355351 52-53 27.56722151088348 24.39180537772087 21.69014084507042 26.350832266325224 54-55 27.278545826932927 24.6031746031746 22.375832053251408 25.742447516641064 56-57 27.922161054922544 24.004608884905902 22.301881961336576 25.771348098834977 58-59 28.10859264950698 22.76860033294916 23.39608144448713 25.72672557305673 60-61 26.869877049180328 24.60297131147541 22.054303278688526 26.47284836065574 62-63 26.917659111281857 24.42054040210014 23.319247022666154 25.34255346395185 64-65 28.055342044581096 22.9054573405073 22.444273635664874 26.594926979246736 66-67 26.98514344262295 24.59016393442623 22.28483606557377 26.13985655737705 68-69 27.418321588725174 24.30493273542601 23.510570147341447 24.766175528507368 70-71 26.87083546899026 24.24397744746284 23.090722706304458 25.794464377242438 72-73 26.146907216494846 23.5180412371134 23.04123711340206 27.293814432989688 74-75 26.460104195228958 21.45599122566493 24.239100630655333 27.84480394845078 76 27.91728212703102 0.0 33.53028064992615 38.55243722304284 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 85.0 1 42.5 2 0.0 3 1.0 4 2.0 5 1.5 6 1.5 7 3.0 8 3.5 9 2.0 10 0.5 11 0.5 12 1.0 13 0.5 14 1.0 15 1.0 16 0.0 17 1.0 18 3.0 19 5.0 20 6.5 21 9.5 22 7.5 23 6.0 24 10.5 25 9.0 26 10.5 27 13.0 28 11.0 29 11.0 30 13.0 31 25.0 32 40.0 33 40.5 34 41.0 35 59.0 36 79.0 37 87.0 38 93.0 39 105.5 40 117.5 41 133.5 42 154.0 43 167.0 44 156.5 45 142.5 46 135.5 47 153.0 48 161.5 49 150.5 50 153.0 51 141.0 52 121.5 53 115.0 54 114.5 55 116.0 56 121.5 57 117.5 58 117.5 59 121.5 60 125.5 61 135.0 62 140.5 63 128.5 64 119.0 65 122.5 66 120.5 67 112.0 68 106.0 69 99.5 70 87.5 71 80.5 72 72.5 73 66.0 74 56.0 75 42.5 76 39.5 77 29.0 78 16.0 79 11.5 80 12.0 81 10.5 82 10.0 83 13.0 84 9.5 85 3.0 86 2.0 87 4.0 88 2.0 89 0.5 90 0.5 91 0.0 92 0.0 93 1.0 94 1.0 95 0.0 96 0.0 97 0.5 98 1.0 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 2.0500000000000003 3 2.0500000000000003 4 2.0500000000000003 5 2.0500000000000003 6 2.0500000000000003 7 2.0500000000000003 8 2.075 9 2.1 10-11 2.1999999999999997 12-13 2.25 14-15 2.2875 16-17 2.3125 18-19 2.3 20-21 2.325 22-23 2.325 24-25 2.3125 26-27 2.3375 28-29 2.275 30-31 2.2875 32-33 2.2875 34-35 2.3375 36-37 0.2807913209955329 38-39 0.2680965147453083 40-41 0.20429009193054137 42-43 0.2553626149131767 44-45 0.2554278416347382 46-47 0.19157088122605362 48-49 0.2681992337164751 50-51 0.22988505747126436 52-53 0.2554278416347382 54-55 0.22988505747126436 56-57 0.21716913643331628 58-59 0.24271844660194172 60-61 0.24274945700779355 62-63 0.21722463582928697 64-65 0.24281150159744408 66-67 0.19174229835101625 68-69 0.21733571976476604 70-71 0.20460358056265981 72-73 0.18008747105737072 74-75 0.19157088122605362 76 0.2578268876611418 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 82.0 36 1.0 37 0.0 38 1.0 39 0.0 40 0.0 41 0.0 42 0.0 43 1.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 1.0 56 0.0 57 0.0 58 0.0 59 0.0 60 1.0 61 0.0 62 0.0 63 0.0 64 1.0 65 0.0 66 1.0 67 0.0 68 0.0 69 0.0 70 2.0 71 10.0 72 24.0 73 84.0 74 274.0 75 802.0 76 2715.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.38919199792154 94.675 2 1.4549233567160302 2.8000000000000003 3 0.05196154845414394 0.15 4 0.05196154845414394 0.2 5 0.02598077422707197 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02598077422707197 2.0500000000000003 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 82 2.0500000000000003 No Hit GGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 859705 spots for SRR11389789.sra Written 859705 spots for SRR11389789.sra Read 859705 spots for SRR11389789.sra Written 859705 spots for SRR11389789.sra Read 859705 spots for SRR11389789.sra Written 859705 spots for SRR11389789.sra Read 859705 spots for SRR11389789.sra Written 859705 spots for SRR11389789.sra Read 859705 spots for SRR11389789.sra Written 859705 spots for SRR11389789.sra Read 859705 spots for SRR11389789.sra Written 859705 spots for SRR11389789.sra Read 859705 spots for SRR11389789.sra Written 859705 spots for SRR11389789.sra Read 859705 spots for SRR11389789.sra Written 859705 spots for SRR11389789.sra Read 859705 spots for SRR11389789.sra Written 859705 spots for SRR11389789.sra Read 859705 spots for SRR11389789.sra Written 859705 spots for SRR11389789.sra Read 859705 spots for SRR11389789.sra Written 859705 spots for SRR11389789.sra Read 859705 spots for SRR11389789.sra Written 859705 spots for SRR11389789.sra Read 859705 spots for SRR11389789.sra Written 859705 spots for SRR11389789.sra Read 859705 spots for SRR11389789.sra Written 859705 spots for SRR11389789.sra Read 859705 spots for SRR11389789.sra Written 859705 spots for SRR11389789.sra Read 859710 spots for SRR11389789.sra Written 859710 spots for SRR11389789.sra Read 859705 spots for SRR11389789.sra Written 859705 spots for SRR11389789.sra Read 859705 spots for SRR11389789.sra Written 859705 spots for SRR11389789.sra Read 859705 spots for SRR11389789.sra Written 859705 spots for SRR11389789.sra Read 859705 spots for SRR11389789.sra Written 859705 spots for SRR11389789.sra SRR ids: ['SRR11389789.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4juicnii SRR11389789.sra spots: 17194105 blocks: [[1, 859705], [859706, 1719410], [1719411, 2579115], [2579116, 3438820], [3438821, 4298525], [4298526, 5158230], [5158231, 6017935], [6017936, 6877640], [6877641, 7737345], [7737346, 8597050], [8597051, 9456755], [9456756, 10316460], [10316461, 11176165], [11176166, 12035870], [12035871, 12895575], [12895576, 13755280], [13755281, 14614985], [14614986, 15474690], [15474691, 16334395], [16334396, 17194105]] SRR11389789 file size 3241535 SRR11389789 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389789 SRR11389789_1.fastq SRR11389789_2.fastq Input file: SRR11389789_1.fastq Paired file: SRR11389789_2.fastq trimmed: SRR11389789-trimmed-pair1.fastq, SRR11389789-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:32:00 2024 >> started Sat Dec 7 06:32:17 2024 >> done (17.417s) 17194105 read pairs processed; of these: 1083 ( 0.01%) short read pairs filtered out after trimming by size control 405376 ( 2.36%) empty read pairs filtered out after trimming by size control 16787646 (97.64%) read pairs available; of these: 32689 ( 0.19%) trimmed read pairs available after processing 16754957 (99.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1556 0.01% 19 37 0.00% 20 2152 0.01% 21 46 0.00% 22 2602 0.02% 23 46 0.00% 24 2951 0.02% 25 47 0.00% 26 3137 0.02% 27 46 0.00% 28 3151 0.02% 29 63 0.00% 30 2579 0.02% 31 46 0.00% 32 2275 0.01% 33 46 0.00% 34 1862 0.01% 35 129 0.00% 36 3723 0.02% 37 112 0.00% 38 2253 0.01% 39 136 0.00% 40 1161 0.01% 41 119 0.00% 42 657 0.00% 43 138 0.00% 44 438 0.00% 45 173 0.00% 46 251 0.00% 47 174 0.00% 48 336 0.00% 49 219 0.00% 50 284 0.00% 51 247 0.00% 52 336 0.00% 53 328 0.00% 54 350 0.00% 55 548 0.00% 56 2090 0.01% 57 1613 0.01% 58 1147 0.01% 59 846 0.01% 60 1039 0.01% 61 872 0.01% 62 989 0.01% 63 1159 0.01% 64 1361 0.01% 65 1446 0.01% 66 1613 0.01% 67 1986 0.01% 68 1810 0.01% 69 2234 0.01% 70 2970 0.02% 71 4712 0.03% 72 18317 0.11% 73 142547 0.85% 74 1113238 6.63% 75 7302936 43.50% 76 8147967 48.54% 16787646 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=27 prefix-density=0.45 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=13.89 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=5.9 sequence=CTTCTTCTCCGGGTCC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=36 prefix-density=0.35 prefix-fanout=2.0 sequence=GACGCCTATGTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=108.58 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=2.4 sequence=CCGCTCCAACACTTCAGTTCTCACTCCACAGCTCAGAGTCAGAGCTACTAGCAATGGCAGCGGCGACCATGGCGCTCTCCTCCCCCGCGATGGCCGGCACCCCGGTGAAGGTCTCCAGGGCCACCCCCTTCGGCGAGGGCCGCATCAC SRR11389789 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:32:51 Started mapping on | Dec 07 06:32:51 Finished on | Dec 07 06:35:18 Mapping speed, Million of reads per hour | 411.13 Number of input reads | 16787646 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 13996073 Uniquely mapped reads % | 83.37% Average mapped length | 149.79 Number of splices: Total | 5303936 Number of splices: Annotated (sjdb) | 5056692 Number of splices: GT/AG | 5233675 Number of splices: GC/AG | 60401 Number of splices: AT/AC | 1568 Number of splices: Non-canonical | 8292 Mismatch rate per base, % | 1.41% Deletion rate per base | 0.01% Deletion average length | 1.69 Insertion rate per base | 0.01% Insertion average length | 1.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1638028 % of reads mapped to multiple loci | 9.76% Number of reads mapped to too many loci | 48848 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.22% % of reads unmapped: other | 1.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1153550 1153550 1153550 N_multimapping 1638028 1638028 1638028 N_noFeature 503249 13566599 648589 N_ambiguous 406489 1951 133781 UnstrandedReadsAssigned:13086335 PositiveStrandReadsAssigned:427523 NegativeStrandReadsAssigned:13213703 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389789 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389789-trimmed-pair1.fastq SRR11389789-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,787,646 reads, 14,730,686 reads pseudoaligned [quant] estimated average fragment length: 194.719 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,121 rounds 52973 SRR11389789.ke.tsv 35125 SRR11389789.se.tsv 88098 total ==> SRR11389789.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 742.435 0 0 PNS24247 1044 850.281 24.8204 2.58624 PNS24249 1928 1734.28 99.056 5.06038 PNS24246 1044 850.281 24.8204 2.58624 PNS24248 1044 850.281 24.8204 2.58624 PNS24244 1471 1277.28 29.4829 2.04506 PNS24243 293 112.117 0 0 KQK14069 1603 1409.28 4400.3 276.635 KQK14071 474 282.069 352.382 110.683 ==> SRR11389789.se.tsv <== BRADI_1g14170v3 5147 BRADI_1g53295v3 15 BRADI_1g59795v3 332 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 92 BRADI_1g74790v3 81 BRADI_1g09890v3 0 BRADI_1g77505v3 214 BRADI_1g48960v3 0 SRR11389789 completed mapping pipeline successfully