Starting /dee2/code/volunteer_pipeline.sh SRR11389790 current disk space = 1545384751104 free memory = 1601797452 SRR11389790 SRAfilesize 74cda3ae9c2beb7fbc78eaec89b8716f SRR11389790.sra SRR11389790.sra file validated SRR11389790 is paired end SRR11389790 is conventional basespace SRR11389790 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389790_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.92875 32.0 32.0 32.0 32.0 32.0 2 31.0155 32.0 32.0 32.0 32.0 32.0 3 30.9905 32.0 32.0 32.0 32.0 32.0 4 30.96925 32.0 32.0 32.0 32.0 32.0 5 30.98 32.0 32.0 32.0 32.0 32.0 6 33.95325 36.0 36.0 36.0 32.0 36.0 7 34.022 36.0 36.0 36.0 32.0 36.0 8 33.8765 36.0 36.0 36.0 32.0 36.0 9 34.01825 36.0 36.0 36.0 32.0 36.0 10-11 33.89375 36.0 36.0 36.0 32.0 36.0 12-13 34.04675 36.0 36.0 36.0 32.0 36.0 14-15 33.951499999999996 36.0 36.0 36.0 32.0 36.0 16-17 34.0565 36.0 36.0 36.0 32.0 36.0 18-19 33.9635 36.0 36.0 36.0 32.0 36.0 20-21 33.871375 36.0 36.0 36.0 32.0 36.0 22-23 33.7155 36.0 36.0 36.0 29.5 36.0 24-25 33.706625 36.0 36.0 36.0 32.0 36.0 26-27 33.497375000000005 36.0 36.0 36.0 21.0 36.0 28-29 33.558499999999995 36.0 36.0 36.0 27.0 36.0 30-31 33.329125 36.0 36.0 36.0 21.0 36.0 32-33 33.21225 36.0 36.0 36.0 21.0 36.0 34-35 33.17875 36.0 36.0 36.0 21.0 36.0 36-37 33.44793762575453 36.0 36.0 36.0 24.0 36.0 38-39 33.14576392316161 36.0 36.0 36.0 14.0 36.0 40-41 33.093459119496856 36.0 36.0 36.0 14.0 36.0 42-43 33.14264150943396 36.0 36.0 36.0 17.5 36.0 44-45 33.0451572327044 36.0 36.0 36.0 14.0 36.0 46-47 32.86050314465409 36.0 36.0 36.0 14.0 36.0 48-49 32.647924528301886 36.0 36.0 36.0 14.0 36.0 50-51 32.59194968553459 36.0 36.0 36.0 14.0 36.0 52-53 32.492578616352205 36.0 32.0 36.0 14.0 36.0 54-55 32.34503144654088 36.0 32.0 36.0 14.0 36.0 56-57 32.29735849056604 36.0 32.0 36.0 14.0 36.0 58-59 32.083647798742135 36.0 32.0 36.0 14.0 36.0 60-61 32.00037735849057 36.0 32.0 36.0 14.0 36.0 62-63 31.90955974842767 36.0 32.0 36.0 14.0 36.0 64-65 31.83190739808757 36.0 32.0 36.0 14.0 36.0 66-67 31.43538930559333 36.0 32.0 36.0 14.0 36.0 68-69 31.425226586102717 36.0 32.0 36.0 14.0 36.0 70-71 31.326428984190798 36.0 32.0 36.0 14.0 36.0 72-73 31.1479880589688 36.0 32.0 36.0 14.0 36.0 74-75 30.961585004257564 36.0 32.0 36.0 14.0 36.0 76 30.36115160349854 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 9.0 24 10.0 25 33.0 26 46.0 27 80.0 28 139.0 29 173.0 30 273.0 31 384.0 32 491.0 33 765.0 34 1008.0 35 563.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.8953722334004 11.091549295774648 11.795774647887324 36.21730382293762 2 26.886317907444667 13.98390342052314 31.18712273641851 27.94265593561368 3 25.27665995975855 20.34708249496982 19.76861167002012 34.60764587525151 4 29.904426559356136 25.402414486921533 18.68712273641851 26.006036217303823 5 27.213279678068407 30.357142857142854 21.202213279678066 21.227364185110666 6 23.80473074987418 30.825364871665826 22.64720684448918 22.72269753397081 7 17.580482897384307 23.74245472837022 36.116700201207244 22.56036217303823 8 20.57344064386318 20.92555331991952 31.01106639839034 27.48993963782696 9 21.856136820925553 20.12072434607646 31.212273641851105 26.81086519114688 10-11 23.56639839034205 29.049295774647888 22.83702213279678 24.547283702213278 12-13 24.823943661971832 22.585513078470825 25.088028169014088 27.502515090543262 14-15 23.40291750503018 24.295774647887324 25.213782696177063 27.087525150905435 16-17 25.037726358148895 24.258048289738433 24.585010060362173 26.119215291750503 18-19 25.28923541247485 24.4341046277666 24.182595573440643 26.094064386317907 20-21 24.673038229376257 25.012575452716295 24.232897384305836 26.08148893360161 22-23 24.811368209255534 24.660462776659962 24.798792756539235 25.729376257545272 24-25 24.76106639839034 24.09456740442656 24.635311871227366 26.509054325955734 26-27 23.767605633802816 25.15090543259557 23.591549295774648 27.48993963782696 28-29 24.220321931589535 25.364688128772634 23.52867203219316 26.886317907444667 30-31 24.76106639839034 24.220321931589535 24.77364185110664 26.244969818913482 32-33 25.088028169014088 24.295774647887324 23.830482897384307 26.785714285714285 34-35 24.647887323943664 24.4341046277666 24.295774647887324 26.62223340040241 36-37 24.87424547283702 24.35865191146881 23.8682092555332 26.898893360160965 38-39 24.487485850836375 24.600679159854106 23.921519305747704 26.990315683561818 40-41 24.60377358490566 24.20125786163522 23.91194968553459 27.28301886792453 42-43 25.647798742138367 24.0 23.77358490566038 26.578616352201255 44-45 24.968553459119498 24.553459119496857 24.050314465408807 26.427672955974842 46-47 24.81761006289308 24.037735849056606 24.30188679245283 26.842767295597486 48-49 25.333333333333336 23.924528301886795 23.91194968553459 26.830188679245282 50-51 25.446540880503143 23.660377358490567 23.82389937106918 27.069182389937108 52-53 25.119496855345915 23.433962264150942 23.962264150943398 27.48427672955975 54-55 25.50943396226415 24.0125786163522 23.169811320754715 27.308176100628927 56-57 24.641509433962263 24.251572327044023 24.767295597484278 26.339622641509436 58-59 25.534591194968552 24.22641509433962 24.037735849056606 26.20125786163522 60-61 25.345911949685533 23.79874213836478 24.12578616352201 26.729559748427672 62-63 24.742138364779876 24.22641509433962 24.17610062893082 26.855345911949684 64-65 26.86210367388022 23.125314544539506 23.77956718671364 26.23301459486663 66-67 26.123065307663268 23.342141688687555 23.606392349314206 26.928400654334972 68-69 24.911883182275933 23.376132930513595 23.96777442094663 27.744209466263847 70-71 25.676866893338367 23.24644251353734 24.32942954287873 26.747261050245562 72-73 25.23034204215575 23.400227186671714 24.10703016534141 27.26240060583112 74-75 25.69610182975338 20.96260938743039 25.192256695836647 28.14903208697958 76 27.368804664723033 0.0 36.11516034985422 36.51603498542274 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 24.0 1 12.5 2 1.0 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 3.5 19 8.0 20 7.5 21 6.5 22 13.0 23 12.0 24 6.5 25 9.5 26 12.0 27 17.0 28 17.0 29 12.5 30 19.0 31 30.5 32 38.5 33 42.5 34 46.0 35 65.0 36 86.5 37 95.5 38 105.0 39 121.5 40 135.0 41 147.0 42 157.0 43 176.5 44 186.5 45 178.0 46 177.5 47 181.5 48 178.0 49 166.5 50 167.0 51 151.0 52 124.5 53 119.0 54 123.5 55 119.5 56 118.0 57 118.0 58 118.5 59 125.5 60 133.5 61 122.5 62 100.5 63 104.0 64 111.5 65 103.0 66 96.0 67 100.0 68 103.0 69 91.0 70 70.5 71 60.5 72 53.5 73 44.0 74 37.0 75 37.0 76 36.5 77 28.0 78 21.0 79 19.5 80 16.5 81 12.0 82 9.0 83 7.0 84 7.0 85 4.0 86 0.5 87 1.0 88 1.0 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.6 3 0.6 4 0.6 5 0.6 6 0.65 7 0.6 8 0.6 9 0.6 10-11 0.6 12-13 0.6 14-15 0.6 16-17 0.6 18-19 0.6 20-21 0.6 22-23 0.6 24-25 0.6 26-27 0.6 28-29 0.6 30-31 0.6 32-33 0.6 34-35 0.6 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 24.0 36 0.0 37 0.0 38 1.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 0.0 65 0.0 66 1.0 67 1.0 68 0.0 69 1.0 70 1.0 71 3.0 72 11.0 73 62.0 74 246.0 75 904.0 76 2744.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.30595482546201 95.75 2 1.4117043121149897 2.75 3 0.1540041067761807 0.44999999999999996 4 0.051334702258726904 0.2 5 0.051334702258726904 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025667351129363452 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 24 0.6 No Hit GTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGG 5 0.125 No Hit GCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389790 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389790_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.51675 32.0 32.0 32.0 32.0 32.0 2 30.24825 32.0 32.0 32.0 21.0 32.0 3 30.2415 32.0 32.0 32.0 21.0 32.0 4 30.20375 32.0 32.0 32.0 21.0 32.0 5 30.02575 32.0 32.0 32.0 21.0 32.0 6 33.0875 36.0 36.0 36.0 21.0 36.0 7 33.49925 36.0 36.0 36.0 21.0 36.0 8 33.30625 36.0 36.0 36.0 21.0 36.0 9 33.1355 36.0 36.0 36.0 21.0 36.0 10-11 33.074375 36.0 36.0 36.0 17.5 36.0 12-13 33.1825 36.0 36.0 36.0 21.0 36.0 14-15 32.911125 36.0 36.0 36.0 17.5 36.0 16-17 33.13249999999999 36.0 36.0 36.0 17.5 36.0 18-19 32.9905 36.0 36.0 36.0 14.0 36.0 20-21 32.7845 36.0 36.0 36.0 14.0 36.0 22-23 32.836124999999996 36.0 36.0 36.0 14.0 36.0 24-25 32.698750000000004 36.0 36.0 36.0 14.0 36.0 26-27 32.66925 36.0 36.0 36.0 14.0 36.0 28-29 32.805375 36.0 36.0 36.0 14.0 36.0 30-31 32.527125 36.0 36.0 36.0 14.0 36.0 32-33 32.40112499999999 36.0 36.0 36.0 14.0 36.0 34-35 32.370125 36.0 36.0 36.0 14.0 36.0 36-37 32.53322426378052 36.0 34.0 36.0 14.0 36.0 38-39 32.61634933712935 36.0 36.0 36.0 14.0 36.0 40-41 32.35825338236218 36.0 36.0 36.0 14.0 36.0 42-43 32.25314861460957 36.0 36.0 36.0 14.0 36.0 44-45 32.157132056451616 36.0 32.0 36.0 14.0 36.0 46-47 32.08606350806451 36.0 32.0 36.0 14.0 36.0 48-49 32.01701108870968 36.0 32.0 36.0 14.0 36.0 50-51 31.892641129032256 36.0 32.0 36.0 14.0 36.0 52-53 31.594884072580648 36.0 32.0 36.0 14.0 36.0 54-55 31.460559475806452 36.0 32.0 36.0 14.0 36.0 56-57 31.404233870967744 36.0 32.0 36.0 14.0 36.0 58-59 31.207535282258064 36.0 32.0 36.0 14.0 36.0 60-61 30.998613911290324 36.0 32.0 36.0 14.0 36.0 62-63 30.972404233870968 36.0 32.0 36.0 14.0 36.0 64-65 30.812830854550036 36.0 29.5 36.0 14.0 36.0 66-67 30.718122347236616 36.0 29.5 36.0 14.0 36.0 68-69 30.58108448928121 36.0 29.5 36.0 14.0 36.0 70-71 30.46117163266595 36.0 27.0 36.0 14.0 36.0 72-73 30.25376143646534 36.0 27.0 36.0 14.0 36.0 74-75 30.29677035767965 36.0 27.0 36.0 14.0 36.0 76 29.120131052056788 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 0.0 4 1.0 5 4.0 6 1.0 7 0.0 8 1.0 9 1.0 10 2.0 11 0.0 12 0.0 13 1.0 14 1.0 15 2.0 16 10.0 17 9.0 18 7.0 19 11.0 20 9.0 21 17.0 22 18.0 23 35.0 24 48.0 25 70.0 26 93.0 27 123.0 28 161.0 29 214.0 30 273.0 31 355.0 32 464.0 33 684.0 34 876.0 35 482.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.1507676818525 17.694437452806444 10.646866347847974 34.50792851749308 2 30.581424616159076 22.250188774226025 26.780770198842184 20.387616410772715 3 26.65492071482507 26.32771205638057 20.463126101182986 26.554241127611377 4 30.078026680090613 30.103196576894035 16.737981374276366 23.080795368738986 5 29.700478228039266 31.487540901082305 18.273345079285175 20.538635791593254 6 22.77875660709791 35.615403976843695 18.90259249937075 22.703246916687643 7 24.163100931286184 15.932544676566826 34.40724893027939 25.49710546186761 8 24.647532729103727 22.356495468277945 23.690835850956695 29.305135951661633 9 24.729287333165452 21.707378494082093 25.56031226391337 28.00302190883908 10-11 28.085213664439685 26.975923358124295 18.908357494012353 26.03050548342367 12-13 27.311719439888986 21.37000126151129 22.12690803582692 29.191371262772805 14-15 26.344357485483467 24.413027013380457 23.138096440292856 26.104519060843224 16-17 28.22875899507638 22.724403484408533 22.535033455371796 26.51180406514329 18-19 27.918717657452984 23.690521267196768 22.56720939038243 25.823551684967818 20-21 27.138344914718886 23.99241945672773 22.880606443461783 25.9886291850916 22-23 27.05912076806468 24.34310257705912 22.587165234967156 26.010611419909047 24-25 25.846387064173825 23.509348155634157 22.86508337544214 27.779181404749874 26-27 27.24168458328064 24.168458328063743 21.82875932717845 26.76109776147717 28-29 27.612317011610298 23.87682988389702 22.425542655224636 26.085310449268047 30-31 27.107521453811206 24.54568399798082 22.236244321049973 26.110550227158 32-33 26.829883897021706 24.886420999495204 21.88288743059061 26.40080767289248 34-35 26.681841173495197 24.241274658573598 23.002023267577137 26.074860900354075 36-37 27.701251105775306 23.821559459117907 22.835839757361303 25.641349677745485 38-39 27.213031948478346 24.295996969314306 22.98269983583786 25.50827124636949 40-41 26.24337288563494 23.908104014137844 23.251704115122443 26.59681898510477 42-43 27.042040146446155 23.822749652821614 22.686529478601187 26.448680722131044 44-45 26.07048124289504 24.150562081596565 22.824302134646963 26.95465454086144 46-47 27.30371118404443 25.09467306235799 21.93890431709164 25.66271143650593 48-49 27.473777328446857 23.92265891570833 22.254517881966386 26.34904587387843 50-51 27.043071870658075 24.07477579891373 22.609574333712263 26.272577996715928 52-53 27.247439625742825 24.149702870147934 22.79681375647996 25.806043747629282 54-55 27.00416614063881 24.390859739931827 23.014770862264868 25.5902032571645 56-57 26.95366746622901 23.936371670243656 22.522408786769347 26.587552076757987 58-59 27.315224257738468 24.64939987365761 22.79216677195199 25.243209096651924 60-61 26.711290729982316 24.21065925738823 22.77090174286436 26.30714826976509 62-63 26.268619035597073 24.072203988891694 23.466296389800554 26.192880585710682 64-65 27.144120247568527 23.54427182013389 22.811671087533156 26.49993684476443 66-67 26.574927408155535 24.857972478222447 23.317762908723648 25.24933720489837 68-69 27.021222839818087 23.951490651844367 22.536634663971704 26.490651844365843 70-71 26.309132304578803 23.91854287882621 22.65368074879838 27.11864406779661 72-73 27.74742726464236 22.894168466522675 22.551137085503747 26.80726718333122 74-75 27.158345602998256 20.586266898674875 23.798688261276936 28.456699237049925 76 28.967530098504195 0.0 31.265961327982488 39.76650857351331 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 27.0 1 14.0 2 2.0 3 2.0 4 0.5 5 0.5 6 1.0 7 1.5 8 2.0 9 1.5 10 0.5 11 0.5 12 1.5 13 2.5 14 2.5 15 1.5 16 1.5 17 1.5 18 5.0 19 5.5 20 3.0 21 5.0 22 6.5 23 7.0 24 8.5 25 11.5 26 11.5 27 13.5 28 16.0 29 14.0 30 20.5 31 24.5 32 28.0 33 40.0 34 48.0 35 56.5 36 68.5 37 77.0 38 91.5 39 108.5 40 124.0 41 138.5 42 153.5 43 168.5 44 171.5 45 159.5 46 145.5 47 147.0 48 145.5 49 142.0 50 139.5 51 132.5 52 129.0 53 128.0 54 127.5 55 125.0 56 119.5 57 115.5 58 117.0 59 131.0 60 144.5 61 141.5 62 130.5 63 122.0 64 116.0 65 116.0 66 112.0 67 105.0 68 111.5 69 101.5 70 87.0 71 84.0 72 75.0 73 66.5 74 56.5 75 47.0 76 44.0 77 37.0 78 22.0 79 12.5 80 12.5 81 13.0 82 10.0 83 6.0 84 4.0 85 2.5 86 1.5 87 2.0 88 1.5 89 1.0 90 1.5 91 2.0 92 2.0 93 1.0 94 0.5 95 1.0 96 1.0 97 0.5 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.675 2 0.675 3 0.675 4 0.675 5 0.675 6 0.675 7 0.675 8 0.7000000000000001 9 0.7250000000000001 10-11 0.8375 12-13 0.9125 14-15 0.975 16-17 0.9875 18-19 0.9625 20-21 1.0625 22-23 1.05 24-25 1.05 26-27 1.1625 28-29 0.95 30-31 0.95 32-33 0.95 34-35 1.15 36-37 0.41530329725648124 38-39 0.32724984266834484 40-41 0.2392645762498426 42-43 0.23929471032745595 44-45 0.23941532258064516 46-47 0.17641129032258063 48-49 0.28981854838709675 50-51 0.23941532258064516 52-53 0.3402217741935484 54-55 0.18901209677419356 56-57 0.18901209677419356 58-59 0.26461693548387094 60-61 0.22681451612903228 62-63 0.17641129032258063 64-65 0.2142677085959163 66-67 0.15126685995209882 68-69 0.17654476670870115 70-71 0.16416214168455615 72-73 0.17755231452124287 74-75 0.173703901656868 76 0.2184200946487077 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 27.0 36 0.0 37 0.0 38 1.0 39 1.0 40 1.0 41 0.0 42 0.0 43 2.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 0.0 65 0.0 66 1.0 67 1.0 68 0.0 69 0.0 70 11.0 71 5.0 72 13.0 73 62.0 74 264.0 75 863.0 76 2747.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.32904884318766 95.625 2 1.3110539845758356 2.55 3 0.17994858611825193 0.525 4 0.12853470437017994 0.5 5 0.025706940874035987 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025706940874035987 0.675 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 27 0.675 No Hit GGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1220676 spots for SRR11389790.sra Written 1220676 spots for SRR11389790.sra Read 1220676 spots for SRR11389790.sra Written 1220676 spots for SRR11389790.sra Read 1220676 spots for SRR11389790.sra Written 1220676 spots for SRR11389790.sra Read 1220676 spots for SRR11389790.sra Written 1220676 spots for SRR11389790.sra Read 1220676 spots for SRR11389790.sra Written 1220676 spots for SRR11389790.sra Read 1220676 spots for SRR11389790.sra Written 1220676 spots for SRR11389790.sra Read 1220676 spots for SRR11389790.sra Written 1220676 spots for SRR11389790.sra Read 1220692 spots for SRR11389790.sra Written 1220692 spots for SRR11389790.sra Read 1220676 spots for SRR11389790.sra Written 1220676 spots for SRR11389790.sra Read 1220676 spots for SRR11389790.sra Written 1220676 spots for SRR11389790.sra Read 1220676 spots for SRR11389790.sra Written 1220676 spots for SRR11389790.sra Read 1220676 spots for SRR11389790.sra Written 1220676 spots for SRR11389790.sra Read 1220676 spots for SRR11389790.sra Written 1220676 spots for SRR11389790.sra Read 1220676 spots for SRR11389790.sra Written 1220676 spots for SRR11389790.sra Read 1220676 spots for SRR11389790.sra Written 1220676 spots for SRR11389790.sra Read 1220676 spots for SRR11389790.sra Written 1220676 spots for SRR11389790.sra Read 1220676 spots for SRR11389790.sra Written 1220676 spots for SRR11389790.sra Read 1220676 spots for SRR11389790.sra Written 1220676 spots for SRR11389790.sra Read 1220676 spots for SRR11389790.sra Written 1220676 spots for SRR11389790.sra Read 1220676 spots for SRR11389790.sra Written 1220676 spots for SRR11389790.sra SRR ids: ['SRR11389790.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fsdq_w5k SRR11389790.sra spots: 24413536 blocks: [[1, 1220676], [1220677, 2441352], [2441353, 3662028], [3662029, 4882704], [4882705, 6103380], [6103381, 7324056], [7324057, 8544732], [8544733, 9765408], [9765409, 10986084], [10986085, 12206760], [12206761, 13427436], [13427437, 14648112], [14648113, 15868788], [15868789, 17089464], [17089465, 18310140], [18310141, 19530816], [19530817, 20751492], [20751493, 21972168], [21972169, 23192844], [23192845, 24413536]] SRR11389790 file size 4637430 SRR11389790 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389790 SRR11389790_1.fastq SRR11389790_2.fastq Input file: SRR11389790_1.fastq Paired file: SRR11389790_2.fastq trimmed: SRR11389790-trimmed-pair1.fastq, SRR11389790-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:32:24 2024 >> started Sat Dec 7 06:32:45 2024 >> done (20.976s) 24413536 read pairs processed; of these: 1100 ( 0.00%) short read pairs filtered out after trimming by size control 243677 ( 1.00%) empty read pairs filtered out after trimming by size control 24168759 (99.00%) read pairs available; of these: 21299 ( 0.09%) trimmed read pairs available after processing 24147460 (99.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 881 0.00% 19 29 0.00% 20 1286 0.01% 21 29 0.00% 22 1285 0.01% 23 41 0.00% 24 1503 0.01% 25 34 0.00% 26 1510 0.01% 27 34 0.00% 28 1368 0.01% 29 57 0.00% 30 1075 0.00% 31 28 0.00% 32 904 0.00% 33 34 0.00% 34 838 0.00% 35 156 0.00% 36 2095 0.01% 37 157 0.00% 38 1238 0.01% 39 196 0.00% 40 740 0.00% 41 178 0.00% 42 457 0.00% 43 220 0.00% 44 384 0.00% 45 214 0.00% 46 263 0.00% 47 265 0.00% 48 340 0.00% 49 301 0.00% 50 331 0.00% 51 343 0.00% 52 392 0.00% 53 346 0.00% 54 488 0.00% 55 615 0.00% 56 1362 0.01% 57 1151 0.00% 58 977 0.00% 59 976 0.00% 60 975 0.00% 61 919 0.00% 62 989 0.00% 63 1215 0.01% 64 1266 0.01% 65 1472 0.01% 66 1738 0.01% 67 2091 0.01% 68 1910 0.01% 69 2281 0.01% 70 3318 0.01% 71 5498 0.02% 72 26143 0.11% 73 199358 0.82% 74 1582986 6.55% 75 10426472 43.14% 76 11885007 49.18% 24168759 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=34 prefix-density=0.38 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.09 sequence-density-rank=31 fanout-score=15.34 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=6.2 sequence=CTTCTTCTCCGGGTCC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=34 prefix-density=0.29 prefix-fanout=2.0 sequence=GACGCCTATGTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCC criterion=fanout-score sequence-density=0.17 sequence-density-rank=12 fanout-score=101.49 fanout-score-rank=1 prefix-density=1.11 prefix-fanout=15.9 sequence=GCCGCCGCCGCCTCC SRR11389790 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:33:28 Started mapping on | Dec 07 06:33:28 Finished on | Dec 07 06:35:54 Mapping speed, Million of reads per hour | 595.94 Number of input reads | 24168759 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 20410411 Uniquely mapped reads % | 84.45% Average mapped length | 149.88 Number of splices: Total | 7861988 Number of splices: Annotated (sjdb) | 7492791 Number of splices: GT/AG | 7759227 Number of splices: GC/AG | 88207 Number of splices: AT/AC | 2287 Number of splices: Non-canonical | 12267 Mismatch rate per base, % | 1.33% Deletion rate per base | 0.01% Deletion average length | 1.71 Insertion rate per base | 0.01% Insertion average length | 1.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2331258 % of reads mapped to multiple loci | 9.65% Number of reads mapped to too many loci | 48733 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.84% % of reads unmapped: other | 0.86% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1427092 1427092 1427092 N_multimapping 2331258 2331258 2331258 N_noFeature 679171 19784300 904605 N_ambiguous 571879 2900 184007 UnstrandedReadsAssigned:19159361 PositiveStrandReadsAssigned:623211 NegativeStrandReadsAssigned:19321799 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389790 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389790-trimmed-pair1.fastq SRR11389790-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,168,759 reads, 21,545,180 reads pseudoaligned [quant] estimated average fragment length: 202.504 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52973 SRR11389790.ke.tsv 35125 SRR11389790.se.tsv 88098 total ==> SRR11389790.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 734.658 0 0 PNS24247 1044 842.496 42.9285 3.08842 PNS24249 1928 1726.5 219.673 7.71204 PNS24246 1044 842.496 42.9285 3.08842 PNS24248 1044 842.496 42.9285 3.08842 PNS24244 1471 1269.5 72.5419 3.46351 PNS24243 293 107.392 0 0 KQK14069 1603 1401.5 6958.41 300.938 KQK14071 474 274.55 556.651 122.891 ==> SRR11389790.se.tsv <== BRADI_1g14170v3 8057 BRADI_1g53295v3 22 BRADI_1g59795v3 507 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 140 BRADI_1g74790v3 121 BRADI_1g09890v3 0 BRADI_1g77505v3 289 BRADI_1g48960v3 0 SRR11389790 completed mapping pipeline successfully