Starting /dee2/code/volunteer_pipeline.sh SRR11389792 current disk space = 1545291206656 free memory = 1599561964 SRR11389792 SRAfilesize f1e7f9dda8acc3d9a8527e6fd636ab42 SRR11389792.sra SRR11389792.sra file validated SRR11389792 is paired end SRR11389792 is conventional basespace SRR11389792 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389792_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.061 32.0 32.0 32.0 32.0 32.0 2 31.018 32.0 32.0 32.0 32.0 32.0 3 30.93725 32.0 32.0 32.0 32.0 32.0 4 31.097 32.0 32.0 32.0 32.0 32.0 5 31.17725 32.0 32.0 32.0 32.0 32.0 6 33.952 36.0 36.0 36.0 32.0 36.0 7 34.22625 36.0 36.0 36.0 32.0 36.0 8 34.03875 36.0 36.0 36.0 32.0 36.0 9 34.20175 36.0 36.0 36.0 32.0 36.0 10-11 34.061 36.0 36.0 36.0 32.0 36.0 12-13 34.18 36.0 36.0 36.0 32.0 36.0 14-15 34.179625 36.0 36.0 36.0 32.0 36.0 16-17 34.187625 36.0 36.0 36.0 32.0 36.0 18-19 34.120125 36.0 36.0 36.0 32.0 36.0 20-21 34.128375 36.0 36.0 36.0 32.0 36.0 22-23 33.805375 36.0 36.0 36.0 32.0 36.0 24-25 33.72825 36.0 36.0 36.0 32.0 36.0 26-27 33.591125000000005 36.0 36.0 36.0 27.0 36.0 28-29 33.616125 36.0 36.0 36.0 29.5 36.0 30-31 33.587374999999994 36.0 36.0 36.0 27.0 36.0 32-33 33.464 36.0 36.0 36.0 27.0 36.0 34-35 33.486375 36.0 36.0 36.0 27.0 36.0 36-37 33.564889336016094 36.0 36.0 36.0 27.0 36.0 38-39 33.47539836503296 36.0 36.0 36.0 24.0 36.0 40-41 33.35650264454805 36.0 36.0 36.0 20.5 36.0 42-43 33.02239557121288 36.0 36.0 36.0 17.5 36.0 44-45 32.93860090588827 36.0 36.0 36.0 14.0 36.0 46-47 33.04806240563664 36.0 36.0 36.0 14.0 36.0 48-49 32.944893506761986 36.0 36.0 36.0 14.0 36.0 50-51 32.87566070979109 36.0 36.0 36.0 14.0 36.0 52-53 32.73294739491568 36.0 36.0 36.0 14.0 36.0 54-55 32.6824424317821 36.0 36.0 36.0 14.0 36.0 56-57 32.5 36.0 36.0 36.0 14.0 36.0 58-59 32.0491060186351 36.0 32.0 36.0 14.0 36.0 60-61 32.17667440797635 36.0 32.0 36.0 14.0 36.0 62-63 31.99042668889539 36.0 32.0 36.0 14.0 36.0 64-65 31.954889112903228 36.0 32.0 36.0 14.0 36.0 66-67 31.699989646047364 36.0 32.0 36.0 14.0 36.0 68-69 31.54579007776536 36.0 32.0 36.0 14.0 36.0 70-71 31.491797072185765 36.0 32.0 36.0 14.0 36.0 72-73 31.409271926657055 36.0 32.0 36.0 14.0 36.0 74-75 31.198644194913065 36.0 32.0 36.0 14.0 36.0 76 30.452049642722827 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 7.0 23 3.0 24 20.0 25 19.0 26 48.0 27 85.0 28 112.0 29 152.0 30 222.0 31 360.0 32 509.0 33 707.0 34 1037.0 35 693.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.62474849094567 11.443661971830986 10.211267605633804 36.72032193158954 2 24.87424547283702 16.222334004024145 33.37525150905433 25.528169014084508 3 22.585513078470825 19.59255533199195 24.823943661971832 32.99798792756539 4 28.319919517102615 25.980885311871226 18.259557344064387 27.43963782696177 5 30.005030181086518 28.772635814889334 21.32796780684105 19.8943661971831 6 26.643162931251574 29.866532359607152 23.64643666582725 19.84386804331403 7 17.20321931589537 26.458752515090545 35.26156941649899 21.07645875251509 8 19.61770623742455 25.503018108651908 28.747484909456738 26.131790744466798 9 23.843058350100605 19.76861167002012 30.784708249496983 25.603621730382294 10-11 24.258048289738433 30.596076458752513 21.730382293762577 23.41549295774648 12-13 23.45321931589537 24.4341046277666 24.735915492957748 27.37676056338028 14-15 22.195674044265594 25.5658953722334 26.169517102615693 26.068913480885314 16-17 24.962273641851105 23.56639839034205 24.49698189134809 26.974346076458755 18-19 24.019114688128774 24.044265593561367 25.0 26.936619718309856 20-21 25.729376257545272 24.522132796780685 25.930583501006037 23.81790744466801 22-23 22.83702213279678 27.87977867203219 24.107142857142858 25.176056338028168 24-25 23.390342052313883 23.81790744466801 24.823943661971832 27.96780684104628 26-27 23.2897384305835 24.647887323943664 24.107142857142858 27.95523138832998 28-29 25.880281690140844 25.176056338028168 24.220321931589535 24.72334004024145 30-31 23.616700201207244 23.943661971830984 25.892857142857146 26.546780684104625 32-33 23.151408450704224 26.395875251509054 24.08199195171026 26.370724346076457 34-35 23.591549295774648 24.49698189134809 25.691649899396378 26.219818913480886 36-37 25.414989939637827 25.553319919517104 23.46579476861167 25.5658953722334 38-39 25.242107910954598 25.958998868066914 24.47490881650107 24.323984404477425 40-41 23.449490501949928 23.361429110579948 26.091332243049443 27.09774814442068 42-43 23.754403623553095 25.037745344740813 25.918470055359837 25.289380976346248 44-45 23.691494715651736 23.238550578761952 25.817815802717664 27.252138902868644 46-47 25.251635631605435 23.666331152491193 23.905385002516354 27.17664821338702 48-49 23.014974204102177 25.50648043286775 26.185982131621994 25.292563231408078 50-51 25.106972061414552 23.68487289202114 25.937578655927513 25.2705763906368 52-53 23.49609866599547 23.82330732443997 23.28215454316637 29.398439466398184 54-55 25.613593455003148 24.027690371302707 24.443045940843298 25.91567023285085 56-57 24.055891238670696 23.476837865055387 26.01963746223565 26.44763343403827 58-59 22.95391589020398 23.923444976076556 25.384034248300175 27.73860488541929 60-61 26.007556675062972 23.249370277078086 25.163727959697734 25.579345088161208 62-63 23.95111503086809 23.774725966990047 25.639410356557896 26.634748645583972 64-65 24.722782258064516 23.210685483870968 25.83165322580645 26.234879032258064 66-67 23.39594100592462 25.992688768435652 23.736291440816842 26.875078784822893 68-69 23.12058526740666 26.81634712411705 23.92785065590313 26.13521695257316 70-71 24.1670873296315 26.501766784452297 23.700151438667337 25.630994447248863 72-73 24.14797922209553 26.365133662739137 23.501837070822248 25.98505004434309 74-75 24.17522985397512 23.512709572742022 25.25689561925365 27.055164954029205 76 28.506957502820608 0.0 33.884919142534784 37.608123354644604 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 25.0 1 12.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 7.0 19 12.5 20 13.5 21 15.5 22 17.0 23 14.0 24 8.0 25 6.0 26 11.5 27 20.0 28 22.0 29 24.0 30 22.0 31 27.5 32 39.0 33 43.0 34 48.5 35 59.5 36 75.0 37 89.5 38 110.0 39 132.0 40 136.5 41 148.5 42 162.5 43 171.0 44 206.0 45 258.5 46 284.0 47 233.5 48 182.0 49 171.5 50 165.5 51 148.0 52 127.5 53 127.5 54 129.5 55 123.5 56 115.5 57 114.5 58 117.5 59 118.0 60 117.0 61 114.0 62 111.0 63 106.0 64 82.0 65 73.0 66 75.0 67 67.0 68 66.5 69 60.5 70 59.0 71 62.0 72 50.5 73 44.5 74 38.0 75 27.5 76 29.0 77 24.0 78 14.5 79 13.0 80 11.5 81 7.0 82 4.5 83 3.5 84 3.5 85 3.0 86 1.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.6 3 0.6 4 0.6 5 0.6 6 0.7250000000000001 7 0.6 8 0.6 9 0.6 10-11 0.6 12-13 0.6 14-15 0.6 16-17 0.6 18-19 0.6 20-21 0.6 22-23 0.6 24-25 0.6 26-27 0.6 28-29 0.6 30-31 0.6 32-33 0.6 34-35 0.6 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 24.0 36 0.0 37 0.0 38 1.0 39 0.0 40 1.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 1.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 1.0 55 0.0 56 0.0 57 1.0 58 0.0 59 0.0 60 2.0 61 0.0 62 1.0 63 0.0 64 0.0 65 1.0 66 1.0 67 1.0 68 2.0 69 1.0 70 0.0 71 10.0 72 11.0 73 56.0 74 374.0 75 852.0 76 2659.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.5 #Duplication Level Percentage of deduplicated Percentage of total 1 97.45989304812835 91.125 2 1.9251336898395723 3.5999999999999996 3 0.32085561497326204 0.8999999999999999 4 0.10695187165775401 0.4 5 0.0 0.0 6 0.026737967914438502 0.15 7 0.0 0.0 8 0.0 0.0 9 0.053475935828877004 0.44999999999999996 >10 0.08021390374331551 1.175 >50 0.026737967914438502 2.1999999999999997 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 88 2.1999999999999997 TruSeq Adapter, Index 19 (97% over 38bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 24 0.6 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTAGCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 12 0.3 TruSeq Adapter, Index 19 (97% over 38bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTAT 11 0.27499999999999997 TruSeq Adapter, Index 19 (97% over 38bp) GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 9 0.22499999999999998 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 9 0.22499999999999998 No Hit GTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389792 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389792_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.52425 32.0 32.0 32.0 32.0 32.0 2 29.92825 32.0 32.0 32.0 21.0 32.0 3 29.505 32.0 32.0 32.0 14.0 32.0 4 29.49575 32.0 32.0 32.0 14.0 32.0 5 29.64275 32.0 32.0 32.0 21.0 32.0 6 32.88375 36.0 36.0 36.0 21.0 36.0 7 32.7155 36.0 36.0 36.0 21.0 36.0 8 32.4105 36.0 36.0 36.0 14.0 36.0 9 32.52875 36.0 36.0 36.0 14.0 36.0 10-11 32.289375 36.0 36.0 36.0 14.0 36.0 12-13 32.458124999999995 36.0 36.0 36.0 14.0 36.0 14-15 32.16674999999999 36.0 36.0 36.0 14.0 36.0 16-17 32.249750000000006 36.0 36.0 36.0 14.0 36.0 18-19 32.330124999999995 36.0 36.0 36.0 14.0 36.0 20-21 32.119625 36.0 36.0 36.0 14.0 36.0 22-23 32.10825 36.0 34.0 36.0 14.0 36.0 24-25 31.896375 36.0 32.0 36.0 14.0 36.0 26-27 31.87275 36.0 32.0 36.0 14.0 36.0 28-29 31.751125000000002 36.0 34.0 36.0 14.0 36.0 30-31 31.74875 36.0 32.0 36.0 14.0 36.0 32-33 31.602375000000002 36.0 32.0 36.0 14.0 36.0 34-35 31.79325 36.0 32.0 36.0 14.0 36.0 36-37 31.785137522079232 36.0 32.0 36.0 14.0 36.0 38-39 31.939818319454957 36.0 34.0 36.0 14.0 36.0 40-41 31.688541140837962 36.0 32.0 36.0 14.0 36.0 42-43 31.593639575971732 36.0 32.0 36.0 14.0 36.0 44-45 31.421863165867208 36.0 32.0 36.0 14.0 36.0 46-47 31.22607927291088 36.0 32.0 36.0 14.0 36.0 48-49 31.26398056556476 36.0 32.0 36.0 14.0 36.0 50-51 31.23989898989899 36.0 32.0 36.0 14.0 36.0 52-53 31.108459595959594 36.0 32.0 36.0 14.0 36.0 54-55 30.920194142740872 36.0 32.0 36.0 14.0 36.0 56-57 30.986612781005306 36.0 32.0 36.0 14.0 36.0 58-59 30.687594744820615 36.0 32.0 36.0 14.0 36.0 60-61 30.592726854929232 36.0 29.5 36.0 14.0 36.0 62-63 30.443031053344054 36.0 29.5 36.0 14.0 36.0 64-65 30.238053097345134 36.0 27.0 36.0 14.0 36.0 66-67 30.20020822560892 36.0 27.0 36.0 14.0 36.0 68-69 30.151205542458875 36.0 27.0 36.0 14.0 36.0 70-71 29.843439285913426 36.0 27.0 36.0 14.0 36.0 72-73 29.94825843012189 36.0 27.0 36.0 14.0 36.0 74-75 29.929444098415978 36.0 27.0 36.0 14.0 36.0 76 29.15821812596006 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 37.0 3 0.0 4 3.0 5 4.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 2.0 12 0.0 13 0.0 14 7.0 15 62.0 16 72.0 17 29.0 18 16.0 19 15.0 20 19.0 21 15.0 22 13.0 23 25.0 24 43.0 25 77.0 26 70.0 27 110.0 28 135.0 29 222.0 30 263.0 31 345.0 32 473.0 33 581.0 34 857.0 35 503.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.232517041151226 18.126735672809897 9.820752335268871 32.81999495077001 2 35.27777777777778 20.707070707070706 26.338383838383837 17.67676767676768 3 28.513752207923293 26.167045167802172 20.085793590714104 25.233409033560434 4 32.3996971990916 28.942720161493817 17.234418369921777 21.42316426949281 5 31.74362856421903 30.683825384809488 17.511985869290942 20.060560181680547 6 26.368912440070652 32.980065606863484 19.454958364875093 21.196063588190764 7 24.653040625788545 15.871814282109515 33.38380015140046 26.09134494070149 8 24.91166077738516 22.185764765270065 23.775870772337203 29.12670368500757 9 27.038626609442062 21.20676596818985 25.725826811411263 26.02878061095683 10-11 29.87111448066717 27.5587566338135 18.99166034874905 23.57846853677028 12-13 30.87621696801113 20.027816411682892 21.91174611202428 27.184220508281705 14-15 28.5406910517656 24.300721427667384 22.75661308695102 24.401974433615997 16-17 29.982273993416054 21.651050898961763 22.081539630286148 26.285135477336034 18-19 29.71638389465687 22.739934160546973 22.33476829577108 25.20891364902507 20-21 27.755257157334682 24.220927286546747 23.904231061565746 24.119584494552825 22-23 29.993666877770742 23.128562381253957 21.887270424319187 24.99050031665611 24-25 28.24214792299899 23.505572441742654 22.78368794326241 25.468591691995947 26-27 27.448992523127615 25.51007476872386 22.696743125079205 24.34418958306932 28-29 26.61606578115117 25.819101834282097 22.251739405439594 25.313092979127134 30-31 27.44874715261959 23.867375348013162 23.158694001518604 25.525183497848648 32-33 28.439438045816985 23.718516643462852 22.971775724591822 24.870269586128337 34-35 29.152413530976816 22.703661472190547 23.653870518180668 24.49005447865197 36-37 28.162230671736378 23.94169835234474 22.332065906210392 25.56400506970849 38-39 28.267477203647417 24.404761904761905 23.556231003039514 23.771529888551164 40-41 29.832995951417 24.430668016194332 20.559210526315788 25.177125506072873 42-43 28.953032029370807 24.154956323585264 22.59779718951766 24.29421445752627 44-45 28.11194124351019 23.629226288463972 23.287324300367228 24.971508167658605 46-47 27.862836897380745 24.87662912817917 23.256991016069847 24.00354295837024 48-49 26.70382569039777 25.24702305548518 23.954902457562703 24.094248796554346 50-51 27.359088030398986 25.028499050031666 23.141228625712476 24.471184293856872 52-53 29.03512108533029 23.01255230125523 22.378597692405226 25.573728921009252 54-55 28.984038510260955 23.828223967570306 22.09272865467444 25.0950088674943 56-57 29.276940610358366 24.41433455742687 22.552868177789033 23.75585665442573 58-59 30.33451596553472 22.503801317790167 21.743537759756716 25.418144956918397 60-61 29.420712384332614 23.564456838636076 22.829255925972873 24.185574851058437 62-63 30.008870865543024 23.55848434925865 22.126473197313395 24.306171587884933 64-65 28.937357342125285 23.80167385239665 22.064417955871164 25.196550849606897 66-67 27.622909275215406 25.30410542321338 21.895590471363406 25.177394830207806 68-69 27.36615072316671 25.55189038315148 23.21745749809693 23.864501395584877 70-71 26.30509335704306 25.28896227613362 23.142385367712436 25.263558999110884 72-73 24.709339465951192 26.600229973169796 23.763894212341892 24.926536348537116 74-75 26.79580306698951 23.45977939198278 23.930589184826474 25.813828356201235 76 30.073161340007704 0.0 33.07662687716596 36.850211782826335 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 37.0 1 18.5 2 0.5 3 1.5 4 2.0 5 1.5 6 2.5 7 3.5 8 2.5 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 2.0 17 1.0 18 2.5 19 5.0 20 6.0 21 8.0 22 9.5 23 9.5 24 9.5 25 11.5 26 10.0 27 8.0 28 11.0 29 14.5 30 23.0 31 26.5 32 24.0 33 25.5 34 38.5 35 55.5 36 65.5 37 72.5 38 85.5 39 99.0 40 110.5 41 135.0 42 157.5 43 177.0 44 170.0 45 149.5 46 155.5 47 155.5 48 147.5 49 157.5 50 160.0 51 140.0 52 117.0 53 132.5 54 152.0 55 139.5 56 128.5 57 132.0 58 137.0 59 139.5 60 161.0 61 158.5 62 141.5 63 124.5 64 107.5 65 100.5 66 92.0 67 87.0 68 81.0 69 82.5 70 84.5 71 83.0 72 65.5 73 56.5 74 59.5 75 52.5 76 46.0 77 33.5 78 21.5 79 17.0 80 17.5 81 12.5 82 7.5 83 8.5 84 8.0 85 7.5 86 7.0 87 5.0 88 3.0 89 2.5 90 3.0 91 1.5 92 0.0 93 0.5 94 1.0 95 1.0 96 1.0 97 1.0 98 1.0 99 2.5 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.975 2 1.0 3 0.9249999999999999 4 0.9249999999999999 5 0.9249999999999999 6 0.9249999999999999 7 0.9249999999999999 8 0.95 9 0.975 10-11 1.075 12-13 1.1375 14-15 1.2375 16-17 1.275 18-19 1.275 20-21 1.325 22-23 1.3125 24-25 1.3 26-27 1.3625 28-29 1.1875 30-31 1.225 32-33 1.2375 34-35 1.3375 36-37 0.45420136260408783 38-39 0.3785011355034065 40-41 0.2523977788995457 42-43 0.3154972236244321 44-45 0.3155768745266347 46-47 0.23983842464024235 48-49 0.34086605226612804 50-51 0.31565656565656564 52-53 0.4166666666666667 54-55 0.3156964263164541 56-57 0.26521848951755495 58-59 0.30318342597271347 60-61 0.31589588071771546 62-63 0.2528125395019593 64-65 0.3034134007585335 66-67 0.1897053243961047 68-69 0.2531004808909137 70-71 0.22810797110632366 72-73 0.21672616012238655 74-75 0.22815729432290968 76 0.2688172043010753 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 37.0 36 0.0 37 0.0 38 0.0 39 1.0 40 0.0 41 0.0 42 0.0 43 1.0 44 0.0 45 0.0 46 0.0 47 0.0 48 1.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 1.0 55 0.0 56 0.0 57 1.0 58 0.0 59 0.0 60 2.0 61 0.0 62 1.0 63 0.0 64 0.0 65 1.0 66 1.0 67 1.0 68 2.0 69 2.0 70 5.0 71 11.0 72 20.0 73 55.0 74 263.0 75 990.0 76 2604.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.1 #Duplication Level Percentage of deduplicated Percentage of total 1 97.39854318418314 93.60000000000001 2 2.18522372528616 4.2 3 0.2861602497398543 0.8250000000000001 4 0.052029136316337155 0.2 5 0.052029136316337155 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026014568158168577 0.9249999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 37 0.9249999999999999 No Hit GGCAGGTACTGGACAATGTGGAAGCTGCCCATGTTCGGGTGCACCGACGC 5 0.125 No Hit GTGGAAGCTGCCCATGTTCGGGTGCACCGACGCCACACAGGTGCTCAAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1088103 spots for SRR11389792.sra Written 1088103 spots for SRR11389792.sra Read 1088103 spots for SRR11389792.sra Written 1088103 spots for SRR11389792.sra Read 1088103 spots for SRR11389792.sra Written 1088103 spots for SRR11389792.sra Read 1088103 spots for SRR11389792.sra Written 1088103 spots for SRR11389792.sra Read 1088103 spots for SRR11389792.sra Written 1088103 spots for SRR11389792.sra Read 1088103 spots for SRR11389792.sra Written 1088103 spots for SRR11389792.sra Read 1088103 spots for SRR11389792.sra Written 1088103 spots for SRR11389792.sra Read 1088103 spots for SRR11389792.sra Written 1088103 spots for SRR11389792.sra Read 1088103 spots for SRR11389792.sra Written 1088103 spots for SRR11389792.sra Read 1088103 spots for SRR11389792.sra Written 1088103 spots for SRR11389792.sra Read 1088103 spots for SRR11389792.sra Written 1088103 spots for SRR11389792.sra Read 1088103 spots for SRR11389792.sra Written 1088103 spots for SRR11389792.sra Read 1088103 spots for SRR11389792.sra Written 1088103 spots for SRR11389792.sra Read 1088114 spots for SRR11389792.sra Written 1088114 spots for SRR11389792.sra Read 1088103 spots for SRR11389792.sra Written 1088103 spots for SRR11389792.sra Read 1088103 spots for SRR11389792.sra Written 1088103 spots for SRR11389792.sra Read 1088103 spots for SRR11389792.sra Written 1088103 spots for SRR11389792.sra Read 1088103 spots for SRR11389792.sra Written 1088103 spots for SRR11389792.sra Read 1088103 spots for SRR11389792.sra Written 1088103 spots for SRR11389792.sra Read 1088103 spots for SRR11389792.sra Written 1088103 spots for SRR11389792.sra SRR ids: ['SRR11389792.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f28cws64 SRR11389792.sra spots: 21762071 blocks: [[1, 1088103], [1088104, 2176206], [2176207, 3264309], [3264310, 4352412], [4352413, 5440515], [5440516, 6528618], [6528619, 7616721], [7616722, 8704824], [8704825, 9792927], [9792928, 10881030], [10881031, 11969133], [11969134, 13057236], [13057237, 14145339], [14145340, 15233442], [15233443, 16321545], [16321546, 17409648], [17409649, 18497751], [18497752, 19585854], [19585855, 20673957], [20673958, 21762071]] SRR11389792 file size 4126096 SRR11389792 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389792 SRR11389792_1.fastq SRR11389792_2.fastq Input file: SRR11389792_1.fastq Paired file: SRR11389792_2.fastq trimmed: SRR11389792-trimmed-pair1.fastq, SRR11389792-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:34:07 2024 >> started Sat Dec 7 06:34:27 2024 >> done (20.383s) 21762071 read pairs processed; of these: 907 ( 0.00%) short read pairs filtered out after trimming by size control 1179623 ( 5.42%) empty read pairs filtered out after trimming by size control 20581541 (94.58%) read pairs available; of these: 14507 ( 0.07%) trimmed read pairs available after processing 20567034 (99.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 284 0.00% 19 12 0.00% 20 262 0.00% 21 11 0.00% 22 327 0.00% 23 11 0.00% 24 381 0.00% 25 12 0.00% 26 467 0.00% 27 14 0.00% 28 385 0.00% 29 15 0.00% 30 315 0.00% 31 25 0.00% 32 204 0.00% 33 11 0.00% 34 169 0.00% 35 198 0.00% 36 829 0.00% 37 270 0.00% 38 544 0.00% 39 262 0.00% 40 419 0.00% 41 346 0.00% 42 449 0.00% 43 451 0.00% 44 559 0.00% 45 604 0.00% 46 558 0.00% 47 677 0.00% 48 764 0.00% 49 827 0.00% 50 918 0.00% 51 1037 0.01% 52 1228 0.01% 53 1341 0.01% 54 1425 0.01% 55 2028 0.01% 56 2207 0.01% 57 2262 0.01% 58 2439 0.01% 59 2628 0.01% 60 2859 0.01% 61 2983 0.01% 62 3444 0.02% 63 3925 0.02% 64 4298 0.02% 65 4657 0.02% 66 5503 0.03% 67 6198 0.03% 68 5855 0.03% 69 6812 0.03% 70 7898 0.04% 71 10628 0.05% 72 28274 0.14% 73 181758 0.88% 74 1375805 6.68% 75 8951560 43.49% 76 9950909 48.35% 20581541 reads passed initial QC criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=27 prefix-density=0.89 prefix-fanout=2.0 sequence=TTAGGCCTTGCCGGACTCCTCGCAGCCTGGAGGCTTGAAGGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=8.83 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.8 sequence=CCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCTTGCCGCCGCTGCAGACGACGGCGAAGTTGGAGCCCCGCCGCGACAGCGACGGCAGGCTCGTCGGCGC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=17 prefix-density=0.89 prefix-fanout=2.4 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=7.77 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.6 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC SRR11389792 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:35:02 Started mapping on | Dec 07 06:35:02 Finished on | Dec 07 06:37:37 Mapping speed, Million of reads per hour | 478.02 Number of input reads | 20581541 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 17668855 Uniquely mapped reads % | 85.85% Average mapped length | 149.84 Number of splices: Total | 6914302 Number of splices: Annotated (sjdb) | 6606463 Number of splices: GT/AG | 6824612 Number of splices: GC/AG | 79159 Number of splices: AT/AC | 1634 Number of splices: Non-canonical | 8897 Mismatch rate per base, % | 1.30% Deletion rate per base | 0.01% Deletion average length | 1.69 Insertion rate per base | 0.00% Insertion average length | 1.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1817415 % of reads mapped to multiple loci | 8.83% Number of reads mapped to too many loci | 39215 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.25% % of reads unmapped: other | 0.88% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1095277 1095277 1095277 N_multimapping 1817415 1817415 1817415 N_noFeature 535141 17165045 699554 N_ambiguous 497140 2590 172768 UnstrandedReadsAssigned:16636574 PositiveStrandReadsAssigned:501220 NegativeStrandReadsAssigned:16796533 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389792 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389792-trimmed-pair1.fastq SRR11389792-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,581,541 reads, 18,576,966 reads pseudoaligned [quant] estimated average fragment length: 190.048 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52973 SRR11389792.ke.tsv 35125 SRR11389792.se.tsv 88098 total ==> SRR11389792.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 747.029 0 0 PNS24247 1044 854.952 13.6086 1.12199 PNS24249 1928 1738.95 103.505 4.19556 PNS24246 1044 854.952 13.6086 1.12199 PNS24248 1044 854.952 13.6086 1.12199 PNS24244 1471 1281.95 33.6695 1.85132 PNS24243 293 118.444 0 0 KQK14069 1603 1413.95 229.62 11.447 KQK14071 474 286.672 3.14718 0.773845 ==> SRR11389792.se.tsv <== BRADI_1g14170v3 236 BRADI_1g53295v3 6 BRADI_1g59795v3 188 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 223 BRADI_1g74790v3 362 BRADI_1g09890v3 0 BRADI_1g77505v3 231 BRADI_1g48960v3 0 SRR11389792 completed mapping pipeline successfully