Starting /dee2/code/volunteer_pipeline.sh SRR11389793 current disk space = 1545182642176 free memory = 1598611600 SRR11389793 SRAfilesize 322b194c67c6d2b63fb7a6b324e5d458 SRR11389793.sra SRR11389793.sra file validated SRR11389793 is paired end SRR11389793 is conventional basespace SRR11389793 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389793_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.91175 32.0 32.0 32.0 32.0 32.0 2 30.81675 32.0 32.0 32.0 32.0 32.0 3 30.96375 32.0 32.0 32.0 32.0 32.0 4 30.99475 32.0 32.0 32.0 32.0 32.0 5 31.02425 32.0 32.0 32.0 32.0 32.0 6 33.9105 36.0 36.0 36.0 32.0 36.0 7 34.0615 36.0 36.0 36.0 32.0 36.0 8 33.933 36.0 36.0 36.0 32.0 36.0 9 34.10125 36.0 36.0 36.0 32.0 36.0 10-11 34.004 36.0 36.0 36.0 32.0 36.0 12-13 34.08225 36.0 36.0 36.0 32.0 36.0 14-15 33.937625 36.0 36.0 36.0 32.0 36.0 16-17 33.975875 36.0 36.0 36.0 32.0 36.0 18-19 33.881125 36.0 36.0 36.0 32.0 36.0 20-21 33.86425 36.0 36.0 36.0 32.0 36.0 22-23 33.679 36.0 36.0 36.0 29.5 36.0 24-25 33.546625 36.0 36.0 36.0 27.0 36.0 26-27 33.5025 36.0 36.0 36.0 29.5 36.0 28-29 33.406 36.0 36.0 36.0 24.0 36.0 30-31 33.306124999999994 36.0 36.0 36.0 21.0 36.0 32-33 33.249 36.0 36.0 36.0 24.0 36.0 34-35 33.169375 36.0 36.0 36.0 17.5 36.0 36-37 33.33111167002012 36.0 36.0 36.0 24.0 36.0 38-39 33.206754077926675 36.0 36.0 36.0 17.5 36.0 40-41 33.042767295597486 36.0 36.0 36.0 17.5 36.0 42-43 32.912809804610475 36.0 36.0 36.0 14.0 36.0 44-45 32.833794665324604 36.0 36.0 36.0 14.0 36.0 46-47 32.66721187720181 36.0 36.0 36.0 14.0 36.0 48-49 32.7405636638148 36.0 36.0 36.0 14.0 36.0 50-51 32.58115249119275 36.0 36.0 36.0 14.0 36.0 52-53 32.33379466532461 36.0 32.0 36.0 14.0 36.0 54-55 32.3146703573226 36.0 32.0 36.0 14.0 36.0 56-57 31.98012078510317 36.0 32.0 36.0 14.0 36.0 58-59 31.97281834820874 36.0 32.0 36.0 14.0 36.0 60-61 31.67837361530715 36.0 32.0 36.0 14.0 36.0 62-63 31.620821579879824 36.0 32.0 36.0 14.0 36.0 64-65 31.63466868228773 36.0 32.0 36.0 14.0 36.0 66-67 31.25974156751047 36.0 32.0 36.0 14.0 36.0 68-69 31.231288427062854 36.0 32.0 36.0 14.0 36.0 70-71 31.08509649601912 36.0 32.0 36.0 14.0 36.0 72-73 31.030293409575755 36.0 32.0 36.0 14.0 36.0 74-75 31.115591122247785 36.0 32.0 36.0 14.0 36.0 76 30.49926847110461 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 1.0 23 13.0 24 15.0 25 29.0 26 53.0 27 82.0 28 134.0 29 208.0 30 273.0 31 373.0 32 508.0 33 736.0 34 1025.0 35 523.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.07746478873239 11.167002012072434 11.896378269617706 34.859154929577464 2 25.27665995975855 15.29175050301811 32.142857142857146 27.2887323943662 3 24.949698189134807 19.94466800804829 21.906438631790746 33.199195171026155 4 29.62776659959759 25.12575452716298 18.485915492957748 26.76056338028169 5 29.275653923541245 29.250503018108652 20.900402414486923 20.57344064386318 6 25.50352467270896 30.010070493454176 24.018126888217523 20.468277945619334 7 18.033199195171026 25.100603621730382 34.98490945674044 21.88128772635815 8 20.02012072434608 23.8682092555332 28.495975855130784 27.61569416498994 9 24.446680080482896 19.61770623742455 30.432595573440647 25.503018108651908 10-11 24.61016096579477 29.803822937625757 20.96327967806841 24.622736418511064 12-13 25.088028169014088 22.748993963782695 24.35865191146881 27.804325955734406 14-15 23.8682092555332 24.245472837022135 25.0 26.886317907444667 16-17 25.352112676056336 23.91851106639839 23.516096579476862 27.213279678068407 18-19 24.107142857142858 25.012575452716295 24.59758551307847 26.282696177062377 20-21 26.282696177062377 23.57897384305835 24.13229376257545 26.006036217303823 22-23 24.71076458752515 25.23893360160966 24.572434607645878 25.47786720321932 24-25 24.258048289738433 23.8556338028169 24.647887323943664 27.238430583501007 26-27 24.220321931589535 23.75503018108652 23.277162977867203 28.747484909456738 28-29 25.38983903420523 25.0 23.138832997987926 26.47132796780684 30-31 25.176056338028168 24.09456740442656 24.08199195171026 26.647384305835008 32-33 23.440643863179076 24.09456740442656 24.811368209255534 27.653420523138834 34-35 24.220321931589535 25.5658953722334 23.616700201207244 26.597082494969822 36-37 24.585010060362173 25.314386317907445 25.075452716297786 25.025150905432596 38-39 25.933844799396304 23.53163124135329 23.519054207017987 27.015469752232423 40-41 24.67924528301887 24.540880503144656 24.47798742138365 26.301886792452827 42-43 25.047175745376776 24.279783620581206 24.040759844005535 26.632280790036482 44-45 24.20734776044288 23.4398590840463 24.69803724207348 27.65475591343734 46-47 24.949672873678914 23.326623049823855 24.157020634121793 27.56668344237544 48-49 24.874182184197284 24.14443885254152 25.0880724710619 25.893306492199297 50-51 25.591343734272776 23.024660291897334 24.031202818319073 27.352793155510817 52-53 24.5093105183694 23.477604428787117 23.112732762959233 28.900352289884246 54-55 25.616507297433316 23.037242073477604 24.660291897332662 26.685958731756415 56-57 24.484146955208857 22.861097131353798 24.73578258681429 27.918973326623046 58-59 23.769976091606896 23.669309173272936 25.15414621869888 27.40656851642129 60-61 25.969284994964752 23.376132930513595 24.93705941591138 25.71752265861027 62-63 25.362045082483313 22.516055912353607 24.367208160181335 27.754690844981738 64-65 25.724363819601916 23.6079617031998 24.401612496850593 26.266061980347693 66-67 24.7761946791073 25.431849703694365 23.389232127096204 26.402723490102133 68-69 26.03206665825022 24.0247443504608 23.21676555990405 26.726423431384926 70-71 25.41066464493303 25.347485468789486 23.085670962850642 26.156178923426836 72-73 24.752851711026615 24.638783269961976 23.637515842839036 26.97084917617237 74-75 25.904019357440518 21.911547250974593 25.0436886678317 27.14074472375319 76 29.00512070226774 0.0 32.88222384784199 38.11265544989027 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 25.0 1 12.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 4.5 19 7.5 20 6.0 21 6.0 22 7.5 23 8.5 24 10.0 25 9.5 26 7.5 27 12.0 28 15.5 29 15.0 30 20.5 31 27.0 32 33.0 33 38.0 34 46.0 35 61.5 36 69.5 37 78.5 38 103.5 39 129.5 40 138.5 41 141.0 42 152.0 43 173.0 44 201.5 45 221.5 46 221.5 47 191.5 48 164.5 49 157.0 50 152.5 51 146.0 52 129.0 53 119.5 54 122.0 55 114.5 56 107.5 57 111.5 58 114.0 59 122.0 60 136.0 61 135.0 62 128.0 63 124.0 64 110.5 65 96.5 66 86.5 67 80.0 68 78.0 69 78.0 70 70.0 71 63.0 72 52.5 73 44.0 74 45.5 75 45.5 76 43.0 77 31.5 78 22.0 79 17.5 80 13.0 81 10.0 82 6.0 83 3.0 84 4.0 85 3.5 86 1.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.6 3 0.6 4 0.6 5 0.6 6 0.7000000000000001 7 0.6 8 0.6 9 0.6 10-11 0.6 12-13 0.6 14-15 0.6 16-17 0.6 18-19 0.6 20-21 0.6 22-23 0.6 24-25 0.6 26-27 0.6 28-29 0.6 30-31 0.6 32-33 0.6 34-35 0.6 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 24.0 36 0.0 37 0.0 38 1.0 39 0.0 40 0.0 41 0.0 42 1.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 1.0 60 0.0 61 1.0 62 1.0 63 1.0 64 0.0 65 3.0 66 1.0 67 4.0 68 1.0 69 2.0 70 2.0 71 5.0 72 12.0 73 67.0 74 305.0 75 833.0 76 2734.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.0 #Duplication Level Percentage of deduplicated Percentage of total 1 98.125 94.19999999999999 2 1.40625 2.7 3 0.2864583333333333 0.8250000000000001 4 0.0 0.0 5 0.052083333333333336 0.25 6 0.052083333333333336 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.078125 1.725 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 34 0.8500000000000001 TruSeq Adapter, Index 3 (97% over 36bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 24 0.6 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 11 0.27499999999999997 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 6 0.15 TruSeq Adapter, Index 3 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCAGCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 6 0.15 TruSeq Adapter, Index 3 (97% over 36bp) CCGGGTTGTTGGGAGAGATCACATGCATAAATACAACATGAAACAAACGT 5 0.125 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389793 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389793_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.54925 32.0 32.0 32.0 32.0 32.0 2 29.98025 32.0 32.0 32.0 21.0 32.0 3 29.813 32.0 32.0 32.0 21.0 32.0 4 29.8555 32.0 32.0 32.0 21.0 32.0 5 29.88625 32.0 32.0 32.0 21.0 32.0 6 32.96075 36.0 36.0 36.0 21.0 36.0 7 32.81375 36.0 36.0 36.0 21.0 36.0 8 32.752 36.0 36.0 36.0 14.0 36.0 9 32.676 36.0 36.0 36.0 14.0 36.0 10-11 32.54375 36.0 36.0 36.0 14.0 36.0 12-13 32.678125 36.0 36.0 36.0 14.0 36.0 14-15 32.466499999999996 36.0 36.0 36.0 14.0 36.0 16-17 32.750875 36.0 36.0 36.0 14.0 36.0 18-19 32.55775 36.0 36.0 36.0 14.0 36.0 20-21 32.32925 36.0 36.0 36.0 14.0 36.0 22-23 32.372375 36.0 36.0 36.0 14.0 36.0 24-25 32.263625000000005 36.0 36.0 36.0 14.0 36.0 26-27 32.050875 36.0 32.0 36.0 14.0 36.0 28-29 32.088499999999996 36.0 36.0 36.0 14.0 36.0 30-31 31.89125 36.0 32.0 36.0 14.0 36.0 32-33 31.9125 36.0 34.0 36.0 14.0 36.0 34-35 31.889000000000003 36.0 32.0 36.0 14.0 36.0 36-37 31.952177196073492 36.0 32.0 36.0 14.0 36.0 38-39 31.966593221190912 36.0 32.0 36.0 14.0 36.0 40-41 31.7875849911861 36.0 32.0 36.0 14.0 36.0 42-43 31.691857465364446 36.0 32.0 36.0 14.0 36.0 44-45 31.65419501133787 36.0 32.0 36.0 14.0 36.0 46-47 31.635928445452254 36.0 32.0 36.0 14.0 36.0 48-49 31.480599647266317 36.0 32.0 36.0 14.0 36.0 50-51 31.219828672209623 36.0 32.0 36.0 14.0 36.0 52-53 31.110355253212397 36.0 32.0 36.0 14.0 36.0 54-55 30.975182665658856 36.0 32.0 36.0 14.0 36.0 56-57 30.81489882019116 36.0 32.0 36.0 14.0 36.0 58-59 30.695765233285492 36.0 32.0 36.0 14.0 36.0 60-61 30.54765506807867 36.0 29.5 36.0 14.0 36.0 62-63 30.337081622369293 36.0 29.5 36.0 14.0 36.0 64-65 30.232584553255933 36.0 27.0 36.0 14.0 36.0 66-67 30.210225773777175 36.0 27.0 36.0 14.0 36.0 68-69 30.18950944713766 36.0 27.0 36.0 14.0 36.0 70-71 29.820487640843698 36.0 27.0 36.0 14.0 36.0 72-73 29.857085680905357 36.0 27.0 36.0 14.0 36.0 74-75 29.792221934145708 36.0 27.0 36.0 14.0 36.0 76 28.590671641791044 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 0.0 4 1.0 5 7.0 6 4.0 7 0.0 8 0.0 9 1.0 10 1.0 11 1.0 12 0.0 13 1.0 14 3.0 15 46.0 16 27.0 17 22.0 18 13.0 19 13.0 20 16.0 21 21.0 22 23.0 23 25.0 24 52.0 25 62.0 26 107.0 27 136.0 28 170.0 29 216.0 30 273.0 31 364.0 32 436.0 33 629.0 34 860.0 35 443.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.893252769385704 16.36455186304129 10.045317220543806 31.696878147029206 2 32.35146022155085 20.01510574018127 26.560926485397786 21.07250755287009 3 26.9066196828593 25.49710546186761 20.76516486282406 26.831109992449033 4 33.19909388371507 29.171910395167377 16.335263025421597 21.293732695695947 5 32.01610873395419 30.002516989680345 19.12912157060156 18.852252705763906 6 25.698464636294993 32.066448527561036 19.557009816259754 22.678077019884217 7 26.151522778756608 16.259753335011325 30.35489554492827 27.233828341303802 8 25.6797583081571 22.406847935548843 21.87814702920443 30.035246727089625 9 27.1536523929471 21.612090680100756 24.584382871536523 26.64987405541562 10-11 30.157728706624603 26.700315457413247 18.29652996845426 24.845425867507885 12-13 29.103535353535353 20.454545454545457 21.906565656565657 28.535353535353536 14-15 27.26468730259002 23.537586860391663 23.145925457991158 26.051800379027164 16-17 29.37310414560162 22.800808897876642 21.625379170879675 26.200707785642063 18-19 28.493808440737933 22.946676775334847 21.784179934293658 26.77533484963356 20-21 28.078381795195956 23.324905183312264 23.008849557522122 25.587863463969658 22-23 28.874841972187106 23.31226295828066 21.302149178255373 26.510745891276866 24-25 28.311425682507586 23.98887765419616 22.762891809909 24.936804853387258 26-27 26.80581910183428 25.806451612903224 22.226438962681847 25.161290322580644 28-29 26.92599141197272 24.917908562768375 21.69739833291235 26.458701692346555 30-31 28.39459391183529 22.697991663508905 22.609574333712263 26.29784009094354 32-33 27.87113076437145 23.99241945672773 22.842703727100442 25.29374605180038 34-35 28.48109270266852 23.611989376501835 22.473757430125204 25.433160490704438 36-37 28.388973191704604 23.128477491148207 22.293879615579158 26.188669701568035 38-39 27.509481668773706 25.0063211125158 22.51580278128951 24.968394437420987 40-41 29.06771096513391 23.76200101061142 21.235472460838807 25.934815563415864 42-43 28.36009609305854 24.33936022253129 22.278416993298773 25.02212669111139 44-45 27.884615384615387 23.975202429149796 22.583502024291498 25.55668016194332 46-47 27.74266936299292 24.317492416582407 21.72649140546006 26.21334681496461 48-49 27.125506072874494 23.114878542510123 23.114878542510123 26.644736842105267 50-51 27.523399949405515 24.082974955729824 22.552491778396156 25.841133316468508 52-53 28.253164556962023 23.151898734177216 22.151898734177212 26.44303797468354 54-55 28.0763880106235 23.852282787403567 21.740230175793602 26.331099026179334 56-57 28.136064744562468 23.21699544764795 22.98937784522003 25.65756196256955 58-59 28.925724408452485 22.915348601796786 21.53612552195369 26.622801467797043 60-61 27.752467729688686 23.917995444191344 21.64009111617312 26.689445709946845 62-63 29.583702391496903 23.282297861571553 21.966341895482728 25.167657851448816 64-65 28.350646060298963 23.030149480618192 22.384089181656954 26.23511527742589 66-67 27.40628166160081 23.961499493414387 22.137791286727456 26.494427558257343 68-69 26.795229637147933 24.30855112915504 22.443542248160362 26.452676985536666 70-71 26.96557855963419 24.60307379651975 23.29480502984885 25.136542613997204 72-73 25.53544110147884 24.46455889852116 23.291687914329422 26.708312085670578 74-75 27.37775389575497 21.896829661472328 22.89091886082751 27.83449758194519 76 30.498313975271635 0.0 30.460846759085804 39.04083926564256 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 28.0 1 14.0 2 0.0 3 0.5 4 1.0 5 2.5 6 4.0 7 3.0 8 1.5 9 1.5 10 1.5 11 1.5 12 1.5 13 0.5 14 0.0 15 0.0 16 0.5 17 2.0 18 4.0 19 4.0 20 3.0 21 4.0 22 4.5 23 5.0 24 7.0 25 9.0 26 8.5 27 7.0 28 11.5 29 17.0 30 18.5 31 23.5 32 30.5 33 32.0 34 34.0 35 45.0 36 64.5 37 79.5 38 86.0 39 105.0 40 124.5 41 130.5 42 131.0 43 140.0 44 148.0 45 152.0 46 155.0 47 151.5 48 154.5 49 138.5 50 124.5 51 132.5 52 139.5 53 142.0 54 144.5 55 134.5 56 123.5 57 144.0 58 155.0 59 151.5 60 146.5 61 132.0 62 123.5 63 113.5 64 111.5 65 120.5 66 122.5 67 116.5 68 106.0 69 92.0 70 89.0 71 93.0 72 84.0 73 72.0 74 66.0 75 61.5 76 52.0 77 36.5 78 23.5 79 18.5 80 16.5 81 14.0 82 10.5 83 7.0 84 5.5 85 6.0 86 4.0 87 1.5 88 2.5 89 3.0 90 1.5 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.5 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.7000000000000001 3 0.675 4 0.675 5 0.675 6 0.675 7 0.675 8 0.7000000000000001 9 0.75 10-11 0.9375 12-13 1.0 14-15 1.0625 16-17 1.0999999999999999 18-19 1.075 20-21 1.125 22-23 1.125 24-25 1.0999999999999999 26-27 1.1875 28-29 1.0250000000000001 30-31 1.0375 32-33 1.0625 34-35 1.1625 36-37 0.47822803926503904 38-39 0.42799597180261834 40-41 0.32737345756736336 42-43 0.4029719178944717 44-45 0.4283194759385236 46-47 0.327538422776518 48-49 0.4283194759385236 50-51 0.40312421264802223 52-53 0.47871000251952633 54-55 0.3905265810027715 56-57 0.36537734660451054 58-59 0.40327662255828606 60-61 0.37821482602118006 62-63 0.32791020305208723 64-65 0.37859666834931854 66-67 0.29044071221113776 68-69 0.3413832342900493 70-71 0.3165358318561661 72-73 0.2796847190439868 74-75 0.3080219633052096 76 0.4104477611940298 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 27.0 36 0.0 37 0.0 38 2.0 39 0.0 40 0.0 41 0.0 42 1.0 43 1.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 1.0 57 0.0 58 1.0 59 1.0 60 0.0 61 1.0 62 1.0 63 2.0 64 0.0 65 2.0 66 1.0 67 4.0 68 1.0 69 2.0 70 6.0 71 8.0 72 10.0 73 71.0 74 247.0 75 930.0 76 2680.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.04727646454265 95.39999999999999 2 1.7985611510791366 3.5000000000000004 3 0.07708119218910585 0.22499999999999998 4 0.051387461459403906 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025693730729701953 0.675 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 27 0.675 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1074057 spots for SRR11389793.sra Written 1074057 spots for SRR11389793.sra Read 1074057 spots for SRR11389793.sra Written 1074057 spots for SRR11389793.sra Read 1074057 spots for SRR11389793.sra Written 1074057 spots for SRR11389793.sra Read 1074057 spots for SRR11389793.sra Written 1074057 spots for SRR11389793.sra Read 1074057 spots for SRR11389793.sra Written 1074057 spots for SRR11389793.sra Read 1074057 spots for SRR11389793.sra Written 1074057 spots for SRR11389793.sra Read 1074057 spots for SRR11389793.sra Written 1074057 spots for SRR11389793.sra Read 1074057 spots for SRR11389793.sra Written 1074057 spots for SRR11389793.sra Read 1074057 spots for SRR11389793.sra Written 1074057 spots for SRR11389793.sra Read 1074057 spots for SRR11389793.sra Written 1074057 spots for SRR11389793.sra Read 1074057 spots for SRR11389793.sra Written 1074057 spots for SRR11389793.sra Read 1074057 spots for SRR11389793.sra Written 1074057 spots for SRR11389793.sra Read 1074057 spots for SRR11389793.sra Written 1074057 spots for SRR11389793.sra Read 1074057 spots for SRR11389793.sra Written 1074057 spots for SRR11389793.sra Read 1074057 spots for SRR11389793.sra Written 1074057 spots for SRR11389793.sra Read 1074057 spots for SRR11389793.sra Written 1074057 spots for SRR11389793.sra Read 1074057 spots for SRR11389793.sra Written 1074057 spots for SRR11389793.sra Read 1074062 spots for SRR11389793.sra Written 1074062 spots for SRR11389793.sra Read 1074057 spots for SRR11389793.sra Written 1074057 spots for SRR11389793.sra Read 1074057 spots for SRR11389793.sra Written 1074057 spots for SRR11389793.sra SRR ids: ['SRR11389793.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_41qv1ozz SRR11389793.sra spots: 21481145 blocks: [[1, 1074057], [1074058, 2148114], [2148115, 3222171], [3222172, 4296228], [4296229, 5370285], [5370286, 6444342], [6444343, 7518399], [7518400, 8592456], [8592457, 9666513], [9666514, 10740570], [10740571, 11814627], [11814628, 12888684], [12888685, 13962741], [13962742, 15036798], [15036799, 16110855], [16110856, 17184912], [17184913, 18258969], [18258970, 19333026], [19333027, 20407083], [20407084, 21481145]] SRR11389793 file size 4078831 SRR11389793 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389793 SRR11389793_1.fastq SRR11389793_2.fastq Input file: SRR11389793_1.fastq Paired file: SRR11389793_2.fastq trimmed: SRR11389793-trimmed-pair1.fastq, SRR11389793-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:37:20 2024 >> started Sat Dec 7 06:37:38 2024 >> done (17.807s) 21481145 read pairs processed; of these: 921 ( 0.00%) short read pairs filtered out after trimming by size control 532419 ( 2.48%) empty read pairs filtered out after trimming by size control 20947805 (97.52%) read pairs available; of these: 15548 ( 0.07%) trimmed read pairs available after processing 20932257 (99.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 169 0.00% 19 7 0.00% 20 199 0.00% 21 15 0.00% 22 259 0.00% 23 20 0.00% 24 253 0.00% 25 9 0.00% 26 286 0.00% 27 13 0.00% 28 205 0.00% 29 18 0.00% 30 184 0.00% 31 11 0.00% 32 133 0.00% 33 10 0.00% 34 105 0.00% 35 229 0.00% 36 606 0.00% 37 261 0.00% 38 393 0.00% 39 367 0.00% 40 473 0.00% 41 450 0.00% 42 583 0.00% 43 638 0.00% 44 693 0.00% 45 820 0.00% 46 969 0.00% 47 1010 0.00% 48 1128 0.01% 49 1208 0.01% 50 1465 0.01% 51 1565 0.01% 52 1785 0.01% 53 1911 0.01% 54 2136 0.01% 55 2615 0.01% 56 2947 0.01% 57 3207 0.02% 58 3512 0.02% 59 3789 0.02% 60 4067 0.02% 61 4291 0.02% 62 4848 0.02% 63 5610 0.03% 64 6245 0.03% 65 6532 0.03% 66 7540 0.04% 67 8313 0.04% 68 8102 0.04% 69 9123 0.04% 70 10629 0.05% 71 14079 0.07% 72 31157 0.15% 73 181332 0.87% 74 1382009 6.60% 75 9025741 43.09% 76 10201531 48.70% 20947805 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=16 prefix-density=0.86 prefix-fanout=2.0 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=20 fanout-score=59.31 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=11.6 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=14 prefix-density=0.69 prefix-fanout=2.4 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=11.48 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.3 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC SRR11389793 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:38:27 Started mapping on | Dec 07 06:38:28 Finished on | Dec 07 06:40:28 Mapping speed, Million of reads per hour | 628.43 Number of input reads | 20947805 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 17975189 Uniquely mapped reads % | 85.81% Average mapped length | 149.74 Number of splices: Total | 7010643 Number of splices: Annotated (sjdb) | 6711193 Number of splices: GT/AG | 6915649 Number of splices: GC/AG | 83640 Number of splices: AT/AC | 2015 Number of splices: Non-canonical | 9339 Mismatch rate per base, % | 1.36% Deletion rate per base | 0.01% Deletion average length | 1.74 Insertion rate per base | 0.00% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1638109 % of reads mapped to multiple loci | 7.82% Number of reads mapped to too many loci | 50203 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.98% % of reads unmapped: other | 1.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1334511 1334511 1334511 N_multimapping 1638109 1638109 1638109 N_noFeature 551455 17440247 746594 N_ambiguous 458592 2402 125712 UnstrandedReadsAssigned:16965142 PositiveStrandReadsAssigned:532540 NegativeStrandReadsAssigned:17102883 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389793 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389793-trimmed-pair1.fastq SRR11389793-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,947,805 reads, 18,670,597 reads pseudoaligned [quant] estimated average fragment length: 185.331 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,136 rounds 52973 SRR11389793.ke.tsv 35125 SRR11389793.se.tsv 88098 total ==> SRR11389793.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 751.734 0 0 PNS24247 1044 859.669 15.4071 1.26113 PNS24249 1928 1743.67 82.5316 3.33061 PNS24246 1044 859.669 15.4071 1.26113 PNS24248 1044 859.669 15.4071 1.26113 PNS24244 1471 1286.67 38.247 2.0917 PNS24243 293 120.973 0 0 KQK14069 1603 1418.67 16 0.793609 KQK14071 474 291.231 0 0 ==> SRR11389793.se.tsv <== BRADI_1g14170v3 16 BRADI_1g53295v3 6 BRADI_1g59795v3 257 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 184 BRADI_1g74790v3 229 BRADI_1g09890v3 0 BRADI_1g77505v3 242 BRADI_1g48960v3 0 SRR11389793 completed mapping pipeline successfully