Starting /dee2/code/volunteer_pipeline.sh SRR11389794 current disk space = 1545162117120 free memory = 1600492688 SRR11389794 SRAfilesize 67852aacc82ab0acf2386cfd3cd132fd SRR11389794.sra SRR11389794.sra file validated SRR11389794 is paired end SRR11389794 is conventional basespace SRR11389794 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389794_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.25875 32.0 32.0 32.0 32.0 32.0 2 30.1475 32.0 32.0 32.0 32.0 32.0 3 30.352 32.0 32.0 32.0 32.0 32.0 4 30.39 32.0 32.0 32.0 32.0 32.0 5 30.32275 32.0 32.0 32.0 32.0 32.0 6 33.10825 36.0 36.0 36.0 21.0 36.0 7 33.17675 36.0 36.0 36.0 21.0 36.0 8 33.18675 36.0 36.0 36.0 21.0 36.0 9 33.311 36.0 36.0 36.0 32.0 36.0 10-11 33.241375 36.0 36.0 36.0 26.5 36.0 12-13 33.382 36.0 36.0 36.0 32.0 36.0 14-15 33.286125 36.0 36.0 36.0 26.5 36.0 16-17 33.4445 36.0 36.0 36.0 32.0 36.0 18-19 33.33225 36.0 36.0 36.0 32.0 36.0 20-21 33.178625 36.0 36.0 36.0 21.0 36.0 22-23 33.054249999999996 36.0 36.0 36.0 21.0 36.0 24-25 32.83225 36.0 36.0 36.0 21.0 36.0 26-27 32.7825 36.0 36.0 36.0 17.5 36.0 28-29 32.911125 36.0 36.0 36.0 21.0 36.0 30-31 32.66075 36.0 36.0 36.0 14.0 36.0 32-33 32.577875000000006 36.0 36.0 36.0 14.0 36.0 34-35 32.486625000000004 36.0 36.0 36.0 14.0 36.0 36-37 33.441420952787595 36.0 36.0 36.0 24.0 36.0 38-39 33.18878600823045 36.0 36.0 36.0 17.5 36.0 40-41 33.15290637860082 36.0 36.0 36.0 17.5 36.0 42-43 33.066743827160494 36.0 36.0 36.0 14.0 36.0 44-45 32.92348251028807 36.0 36.0 36.0 14.0 36.0 46-47 32.85545267489712 36.0 36.0 36.0 14.0 36.0 48-49 32.71656378600823 36.0 36.0 36.0 14.0 36.0 50-51 32.67836934156379 36.0 36.0 36.0 14.0 36.0 52-53 32.59004373552868 36.0 34.0 36.0 14.0 36.0 54-55 32.35695909441729 36.0 32.0 36.0 14.0 36.0 56-57 32.28301588188508 36.0 32.0 36.0 14.0 36.0 58-59 32.158903757076686 36.0 32.0 36.0 14.0 36.0 60-61 31.975160875160874 36.0 32.0 36.0 14.0 36.0 62-63 31.767378990731206 36.0 32.0 36.0 14.0 36.0 64-65 31.72361061300643 36.0 32.0 36.0 14.0 36.0 66-67 31.372414068671784 36.0 32.0 36.0 14.0 36.0 68-69 31.244658218598097 36.0 32.0 36.0 14.0 36.0 70-71 31.167558310110216 36.0 32.0 36.0 14.0 36.0 72-73 30.882170790206025 36.0 32.0 36.0 14.0 36.0 74-75 30.891636982155266 36.0 32.0 36.0 14.0 36.0 76 30.357832219747586 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 111.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 6.0 23 7.0 24 20.0 25 21.0 26 41.0 27 79.0 28 135.0 29 187.0 30 255.0 31 364.0 32 513.0 33 741.0 34 997.0 35 522.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.11313962458215 12.342504499871431 11.365389560298276 36.17896631524813 2 24.659295448701464 15.2224222165081 33.40190280277706 26.716379532013374 3 24.63358189766007 20.956544098740036 22.242221650809977 32.16765235278992 4 27.950629982000514 27.20493700179995 19.233736178966314 25.61069683723322 5 25.61069683723322 31.164823862175368 22.062226793520185 21.162252507071226 6 23.24505014142453 32.193365903831314 24.273592183080485 20.287991771663666 7 17.845204422730777 23.52789920287992 35.97325790691694 22.65363846747236 8 20.262278220622267 22.80791977372075 30.753407045512986 26.176394960143995 9 22.19079454872718 21.93365903831319 30.23913602468501 25.636410388274623 10-11 21.98508614039599 30.894831576240676 22.576497814348162 24.54358446901517 12-13 24.093597325790693 23.810748264335306 26.0606839804577 26.034970429416305 14-15 22.99087051562299 26.449787835926447 25.87115854442587 24.688183104024688 16-17 23.9650295705837 24.903574183594753 24.235021856518387 26.896374389303162 18-19 23.206479814862433 24.839290305991256 24.903574183594753 27.050655695551555 20-21 23.887888917459502 25.64926716379532 25.044998714322446 25.41784520442273 22-23 25.250707122653637 25.81640524556441 24.865003857032654 24.067883774749294 24-25 24.54358446901517 25.199280020570843 24.042170223707892 26.214965286706093 26-27 23.68218050912831 25.22499357161224 25.147852918488045 25.944973000771405 28-29 25.392131653381334 24.72357932630496 24.890717408074057 24.993571612239652 30-31 24.312162509642583 24.59501157109797 24.94214451015685 26.1506814091026 32-33 23.052198508614037 25.186423245050143 25.50784263306763 26.25353561326819 34-35 24.778192104924777 24.43101453002443 24.276713385624276 26.514079979426512 36-37 24.392439243924393 25.485405683425483 24.675324675324674 25.44683039732545 38-39 24.33127572016461 24.987139917695472 25.411522633744855 25.27006172839506 40-41 23.7011316872428 24.305555555555554 25.75874485596708 26.234567901234566 42-43 24.601337448559672 25.205761316872426 24.434156378600825 25.75874485596708 44-45 23.006687242798353 25.925925925925924 23.984053497942387 27.083333333333332 46-47 24.665637860082303 24.228395061728396 24.421296296296298 26.684670781893004 48-49 23.238168724279834 24.704218106995885 25.424382716049383 26.6332304526749 50-51 23.77829218106996 24.035493827160494 25.87448559670782 26.311728395061728 52-53 23.887316696681246 24.479032673012608 23.848726524311807 27.784924105994342 54-55 24.170311294057115 23.68150244404425 25.66246462567533 26.485721636223307 56-57 23.504438440756463 24.623697414125818 25.318409880355077 26.55345426476264 58-59 23.41739577972208 24.48533196088523 25.20586721564591 26.891405043746786 60-61 24.285714285714285 23.732303732303734 25.34105534105534 26.640926640926644 62-63 24.38208032955716 24.523686920700307 24.884140061791967 26.210092687950564 64-65 24.494526722472635 23.85061171925306 25.42176432710882 26.233097231165488 66-67 24.874404225170682 23.85675640860492 25.27373438103826 25.995104985186142 68-69 24.77431003353108 23.355687387155015 24.864586020118647 27.005416559195254 70-71 24.725487663092625 24.81591525642682 24.492959565947555 25.965637514533007 72-73 24.048824827944422 23.893000908972862 25.568108037917153 26.490066225165563 74-75 25.143325143325146 21.894621894621892 26.057876057876054 26.9041769041769 76 27.95100222717149 0.0 33.89012620638456 38.15887156644395 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 112.0 1 56.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 5.0 19 7.5 20 9.5 21 13.0 22 17.5 23 17.5 24 12.0 25 10.5 26 9.5 27 17.0 28 25.0 29 24.0 30 24.5 31 31.5 32 40.0 33 46.0 34 56.0 35 65.5 36 82.0 37 102.5 38 116.5 39 132.0 40 140.0 41 157.5 42 174.5 43 190.0 44 203.0 45 197.5 46 187.5 47 191.5 48 179.5 49 150.0 50 146.0 51 142.0 52 122.5 53 105.0 54 93.5 55 106.0 56 114.5 57 105.5 58 111.5 59 120.0 60 127.0 61 127.5 62 125.0 63 105.0 64 86.0 65 82.5 66 76.0 67 72.0 68 68.0 69 70.0 70 65.5 71 52.0 72 45.0 73 38.0 74 32.0 75 29.5 76 27.5 77 21.0 78 17.5 79 16.5 80 11.0 81 6.0 82 3.5 83 2.0 84 2.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.775 2 2.775 3 2.775 4 2.775 5 2.775 6 2.775 7 2.775 8 2.775 9 2.775 10-11 2.775 12-13 2.775 14-15 2.7875 16-17 2.775 18-19 2.775 20-21 2.775 22-23 2.775 24-25 2.775 26-27 2.775 28-29 2.775 30-31 2.775 32-33 2.775 34-35 2.7875 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 111.0 36 1.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 1.0 52 0.0 53 0.0 54 0.0 55 0.0 56 1.0 57 0.0 58 0.0 59 1.0 60 0.0 61 1.0 62 0.0 63 1.0 64 1.0 65 0.0 66 1.0 67 3.0 68 2.0 69 3.0 70 5.0 71 8.0 72 19.0 73 49.0 74 258.0 75 840.0 76 2694.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.45 #Duplication Level Percentage of deduplicated Percentage of total 1 97.43178170144462 91.05 2 1.8191546281433921 3.4000000000000004 3 0.4280363830925628 1.2 4 0.16051364365971107 0.6 5 0.08025682182985554 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05350454788657035 0.6 >50 0.0 0.0 >100 0.026752273943285176 2.775 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 111 2.775 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 13 0.325 TruSeq Adapter, Index 7 (97% over 36bp) GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 11 0.27499999999999997 No Hit TATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTC 5 0.125 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 5 0.125 No Hit CTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 57 0.05 0.0 0.0 0.0 0.0 58 0.05 0.0 0.0 0.0 0.0 59 0.05 0.0 0.0 0.0 0.0 60 0.05 0.0 0.0 0.0 0.0 61 0.05 0.0 0.0 0.0 0.0 62 0.05 0.0 0.0 0.0 0.0 63 0.05 0.0 0.0 0.0 0.0 64 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389794 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389794_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.975 32.0 32.0 32.0 21.0 32.0 2 29.64825 32.0 32.0 32.0 14.0 32.0 3 29.50075 32.0 32.0 32.0 14.0 32.0 4 29.34825 32.0 32.0 32.0 14.0 32.0 5 29.55675 32.0 32.0 32.0 21.0 32.0 6 32.42075 36.0 36.0 36.0 14.0 36.0 7 32.51625 36.0 36.0 36.0 21.0 36.0 8 32.43475 36.0 36.0 36.0 14.0 36.0 9 32.379 36.0 36.0 36.0 14.0 36.0 10-11 32.25775 36.0 36.0 36.0 14.0 36.0 12-13 32.447625 36.0 36.0 36.0 14.0 36.0 14-15 32.193124999999995 36.0 36.0 36.0 14.0 36.0 16-17 32.242125 36.0 36.0 36.0 14.0 36.0 18-19 32.11225 36.0 36.0 36.0 14.0 36.0 20-21 32.064125000000004 36.0 36.0 36.0 14.0 36.0 22-23 32.069125 36.0 36.0 36.0 14.0 36.0 24-25 31.902250000000002 36.0 34.0 36.0 14.0 36.0 26-27 31.774625 36.0 32.0 36.0 14.0 36.0 28-29 31.9065 36.0 36.0 36.0 14.0 36.0 30-31 31.725499999999997 36.0 34.0 36.0 14.0 36.0 32-33 31.636875 36.0 32.0 36.0 14.0 36.0 34-35 31.601999999999997 36.0 32.0 36.0 14.0 36.0 36-37 32.3650494245138 36.0 32.0 36.0 14.0 36.0 38-39 32.237011316872426 36.0 34.0 36.0 14.0 36.0 40-41 32.23012606122974 36.0 34.0 36.0 14.0 36.0 42-43 32.07293542577823 36.0 34.0 36.0 14.0 36.0 44-45 31.815748841996914 36.0 32.0 36.0 14.0 36.0 46-47 31.856664951106538 36.0 32.0 36.0 14.0 36.0 48-49 31.680519814719506 36.0 32.0 36.0 14.0 36.0 50-51 31.569994853319606 36.0 32.0 36.0 14.0 36.0 52-53 31.408236808236808 36.0 32.0 36.0 14.0 36.0 54-55 31.24723294723295 36.0 32.0 36.0 14.0 36.0 56-57 31.25667106712421 36.0 32.0 36.0 14.0 36.0 58-59 31.050334706488158 36.0 32.0 36.0 14.0 36.0 60-61 30.833290422245106 36.0 32.0 36.0 14.0 36.0 62-63 30.827453000257535 36.0 29.5 36.0 14.0 36.0 64-65 30.521442891238454 36.0 27.0 36.0 14.0 36.0 66-67 30.673874937907918 36.0 27.0 36.0 14.0 36.0 68-69 30.31229372805554 36.0 27.0 36.0 14.0 36.0 70-71 30.14723544028947 36.0 27.0 36.0 14.0 36.0 72-73 30.001313353612506 36.0 27.0 36.0 14.0 36.0 74-75 30.084313068591626 36.0 27.0 36.0 14.0 36.0 76 28.906119346256176 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 111.0 3 0.0 4 0.0 5 3.0 6 1.0 7 1.0 8 2.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 4.0 15 11.0 16 8.0 17 16.0 18 6.0 19 11.0 20 9.0 21 16.0 22 17.0 23 34.0 24 55.0 25 68.0 26 97.0 27 131.0 28 151.0 29 224.0 30 280.0 31 363.0 32 515.0 33 641.0 34 814.0 35 410.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.85699588477366 19.161522633744855 9.953703703703704 34.02777777777778 2 31.815843621399175 22.659465020576132 25.925925925925924 19.598765432098766 3 25.430701979943432 27.64206736950373 19.77372075083569 27.15350989971715 4 30.393417330933403 30.856261249678578 16.12239650295706 22.62792491643096 5 29.879146310105426 31.216250964258162 19.619439444587297 19.285163281049115 6 24.016456672666493 35.22756492671638 19.876574955001285 20.87940344561584 7 23.579326304962716 16.30239136024685 34.19902288506043 25.91925944973001 8 25.584983286191825 21.419388017485215 23.862175366418104 29.133453329904864 9 25.790691694523016 21.26510671123682 25.456415530984827 27.48778606325534 10-11 27.225939269171384 28.049408131755015 19.99485331960885 24.729799279464746 12-13 28.54383932020085 20.432599459250675 23.677095403630748 27.346465816917732 14-15 26.353092783505154 24.79381443298969 23.75 25.103092783505154 16-17 28.306264501160094 23.485434390306782 22.82804846609951 25.380252642433614 18-19 27.33599690681789 24.22992653692486 22.812218069338833 25.62185848691842 20-21 27.302037657982975 24.29713696156822 23.445963373742586 24.954862006706215 22-23 28.403816400206296 24.703455389375968 22.550283651366684 24.342444559051057 24-25 26.089198246970867 24.967775199793763 22.789378705852023 26.15364784738335 26-27 27.018313128707767 25.109620840856334 22.942997162754708 24.9290688676812 28-29 27.193095452788867 24.5781270127528 22.169264459616127 26.0595130748422 30-31 26.346302499355833 24.813192476165938 23.125483122906466 25.71502190157176 32-33 26.99742268041237 25.064432989690722 23.079896907216497 24.858247422680414 34-35 26.944408616019604 25.177350702953692 22.649297046304657 25.228943634722047 36-37 27.86737195200619 24.203328602760934 22.577731905560572 25.3515675396723 38-39 27.99638756289511 24.280737969294286 22.745452199716166 24.97742226809444 40-41 27.544447307395004 24.207678433393458 23.26719917547024 24.980675083741303 42-43 27.289141088470465 23.445963373742586 23.110652566417333 26.15424297136962 44-45 26.06396698478205 24.43899922620583 24.10368841888058 25.39334537013154 46-47 27.38754994200284 24.01082613738884 23.314860162392062 25.286763758216264 48-49 26.302889576883388 24.23890608875129 23.929308565531475 25.52889576883385 50-51 25.286911669890394 25.325596389426174 23.107672469374595 26.279819471308834 52-53 27.513227513227513 24.89353464963221 21.538263001677635 26.05497483546264 54-55 27.195357833655702 24.60348162475822 22.308188265635074 25.892972275951 56-57 27.559969048233167 24.38741294815579 23.510446221305134 24.542171782305907 58-59 26.748387096774195 24.0258064516129 23.200000000000003 26.025806451612905 60-61 27.974193548387095 24.593548387096774 23.070967741935483 24.361290322580643 62-63 27.834386689023603 24.300270862891786 22.67509351218883 25.19024893589578 64-65 27.791403123789856 24.331999483671098 22.357041435394347 25.519555957144703 66-67 27.39354838709677 23.90967741935484 22.87741935483871 25.81935483870968 68-69 26.44702842377261 25.051679586563306 23.34625322997416 25.155038759689923 70-71 27.260965196015007 24.052270668909305 23.909949540690906 24.776814594384785 72-73 26.399896063401325 24.399116538911265 23.541639599844093 25.659347797843317 74-75 26.964139063783193 21.995620038324663 24.514098001642488 26.52614289624966 76 30.236100533130234 0.0 32.1020563594821 37.66184310738766 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 112.0 1 56.0 2 0.0 3 0.5 4 1.0 5 0.5 6 1.5 7 3.0 8 3.0 9 2.5 10 1.5 11 2.0 12 2.5 13 1.5 14 0.5 15 0.0 16 0.5 17 2.0 18 4.5 19 6.0 20 7.5 21 9.5 22 10.0 23 9.5 24 9.0 25 10.0 26 9.0 27 9.5 28 16.5 29 21.5 30 19.0 31 25.0 32 31.0 33 29.5 34 30.5 35 51.0 36 71.0 37 71.5 38 81.0 39 99.0 40 111.5 41 136.5 42 155.5 43 174.0 44 172.5 45 151.0 46 162.0 47 168.5 48 157.0 49 155.5 50 155.5 51 144.5 52 134.0 53 122.0 54 115.5 55 117.5 56 134.5 57 140.0 58 134.5 59 142.0 60 154.5 61 148.5 62 132.0 63 111.5 64 98.5 65 96.0 66 86.5 67 85.5 68 92.0 69 85.0 70 72.0 71 71.5 72 68.5 73 57.5 74 51.0 75 47.5 76 36.0 77 30.0 78 23.5 79 15.0 80 11.5 81 8.0 82 4.0 83 1.0 84 1.5 85 2.0 86 2.0 87 2.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.8000000000000003 2 2.8000000000000003 3 2.775 4 2.775 5 2.775 6 2.775 7 2.775 8 2.775 9 2.775 10-11 2.85 12-13 2.9125 14-15 3.0 16-17 3.025 18-19 3.0124999999999997 20-21 3.075 22-23 3.05 24-25 3.025 26-27 3.075 28-29 2.9625 30-31 2.9749999999999996 32-33 3.0 34-35 3.0875 36-37 0.3343191462003343 38-39 0.32150205761316875 40-41 0.15436068947774634 42-43 0.25726781579624386 44-45 0.23160061760164694 46-47 0.16726711271230058 48-49 0.2573340195573855 50-51 0.21873391662377764 52-53 0.2702702702702703 54-55 0.19305019305019305 56-57 0.19307504183292573 58-59 0.23171987641606592 60-61 0.23171987641606592 62-63 0.1673963430337368 64-65 0.20610588689939455 66-67 0.14173431258858393 68-69 0.1805519731751354 70-71 0.1550187314300478 72-73 0.1297521733489036 74-75 0.16397922929762232 76 0.19004180919802355 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 111.0 36 1.0 37 0.0 38 0.0 39 1.0 40 0.0 41 0.0 42 0.0 43 1.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 1.0 52 0.0 53 0.0 54 0.0 55 0.0 56 1.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 1.0 64 1.0 65 0.0 66 1.0 67 2.0 68 2.0 69 2.0 70 7.0 71 5.0 72 17.0 73 60.0 74 252.0 75 902.0 76 2631.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.99525191242417 92.875 2 1.5563175943022949 2.9499999999999997 3 0.2374043787918755 0.675 4 0.1582695858612503 0.6 5 0.026378264310208392 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.026378264310208392 2.775 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 111 2.775 No Hit CGCGAAATCACTTTAGGTTTTGTTGATTTATTGCGCGACGATTTTATTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 836710 spots for SRR11389794.sra Written 836710 spots for SRR11389794.sra Read 836710 spots for SRR11389794.sra Written 836710 spots for SRR11389794.sra Read 836710 spots for SRR11389794.sra Written 836710 spots for SRR11389794.sra Read 836710 spots for SRR11389794.sra Written 836710 spots for SRR11389794.sra Read 836710 spots for SRR11389794.sra Written 836710 spots for SRR11389794.sra Read 836710 spots for SRR11389794.sra Written 836710 spots for SRR11389794.sra Read 836729 spots for SRR11389794.sra Written 836729 spots for SRR11389794.sra Read 836710 spots for SRR11389794.sra Written 836710 spots for SRR11389794.sra Read 836710 spots for SRR11389794.sra Written 836710 spots for SRR11389794.sra Read 836710 spots for SRR11389794.sra Written 836710 spots for SRR11389794.sra Read 836710 spots for SRR11389794.sra Written 836710 spots for SRR11389794.sra Read 836710 spots for SRR11389794.sra Written 836710 spots for SRR11389794.sra Read 836710 spots for SRR11389794.sra Written 836710 spots for SRR11389794.sra Read 836710 spots for SRR11389794.sra Written 836710 spots for SRR11389794.sra Read 836710 spots for SRR11389794.sra Written 836710 spots for SRR11389794.sra Read 836710 spots for SRR11389794.sra Written 836710 spots for SRR11389794.sra Read 836710 spots for SRR11389794.sra Written 836710 spots for SRR11389794.sra Read 836710 spots for SRR11389794.sra Written 836710 spots for SRR11389794.sra Read 836710 spots for SRR11389794.sra Written 836710 spots for SRR11389794.sra Read 836710 spots for SRR11389794.sra Written 836710 spots for SRR11389794.sra SRR ids: ['SRR11389794.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g8ujdx4z SRR11389794.sra spots: 16734219 blocks: [[1, 836710], [836711, 1673420], [1673421, 2510130], [2510131, 3346840], [3346841, 4183550], [4183551, 5020260], [5020261, 5856970], [5856971, 6693680], [6693681, 7530390], [7530391, 8367100], [8367101, 9203810], [9203811, 10040520], [10040521, 10877230], [10877231, 11713940], [11713941, 12550650], [12550651, 13387360], [13387361, 14224070], [14224071, 15060780], [15060781, 15897490], [15897491, 16734219]] SRR11389794 file size 3134073 SRR11389794 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389794 SRR11389794_1.fastq SRR11389794_2.fastq Input file: SRR11389794_1.fastq Paired file: SRR11389794_2.fastq trimmed: SRR11389794-trimmed-pair1.fastq, SRR11389794-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:37:19 2024 >> started Sat Dec 7 06:37:35 2024 >> done (15.906s) 16734219 read pairs processed; of these: 1068 ( 0.01%) short read pairs filtered out after trimming by size control 725812 ( 4.34%) empty read pairs filtered out after trimming by size control 16007339 (95.66%) read pairs available; of these: 21530 ( 0.13%) trimmed read pairs available after processing 15985809 (99.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 792 0.00% 19 18 0.00% 20 1202 0.01% 21 18 0.00% 22 1471 0.01% 23 17 0.00% 24 1709 0.01% 25 17 0.00% 26 1707 0.01% 27 14 0.00% 28 1540 0.01% 29 23 0.00% 30 1273 0.01% 31 18 0.00% 32 1011 0.01% 33 16 0.00% 34 814 0.01% 35 169 0.00% 36 2974 0.02% 37 160 0.00% 38 1352 0.01% 39 149 0.00% 40 710 0.00% 41 212 0.00% 42 458 0.00% 43 281 0.00% 44 432 0.00% 45 392 0.00% 46 415 0.00% 47 450 0.00% 48 565 0.00% 49 556 0.00% 50 662 0.00% 51 719 0.00% 52 748 0.00% 53 870 0.01% 54 863 0.01% 55 2083 0.01% 56 2330 0.01% 57 1855 0.01% 58 1964 0.01% 59 1777 0.01% 60 1922 0.01% 61 2000 0.01% 62 2253 0.01% 63 2526 0.02% 64 2852 0.02% 65 3042 0.02% 66 3495 0.02% 67 4166 0.03% 68 3778 0.02% 69 4307 0.03% 70 5271 0.03% 71 7248 0.05% 72 22121 0.14% 73 144534 0.90% 74 1076365 6.72% 75 7014996 43.82% 76 7671657 47.93% 16007339 reads passed initial QC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=28 prefix-density=0.87 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=7.30 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.4 sequence=CCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCTTGCCGCCGCTGCAGACGACGGCGAAGTTGGAGCCCCGCCGCGACAGCGACGGCAGGCTCGTCGGCGC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=14 prefix-density=0.85 prefix-fanout=2.4 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=6.70 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=2.5 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC SRR11389794 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:38:22 Started mapping on | Dec 07 06:38:22 Finished on | Dec 07 06:40:20 Mapping speed, Million of reads per hour | 488.36 Number of input reads | 16007339 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 13414818 Uniquely mapped reads % | 83.80% Average mapped length | 149.78 Number of splices: Total | 5293271 Number of splices: Annotated (sjdb) | 5059222 Number of splices: GT/AG | 5223776 Number of splices: GC/AG | 61222 Number of splices: AT/AC | 1281 Number of splices: Non-canonical | 6992 Mismatch rate per base, % | 1.38% Deletion rate per base | 0.01% Deletion average length | 1.70 Insertion rate per base | 0.01% Insertion average length | 1.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1633795 % of reads mapped to multiple loci | 10.21% Number of reads mapped to too many loci | 39220 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.45% % of reads unmapped: other | 1.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 958729 958729 958729 N_multimapping 1633795 1633795 1633795 N_noFeature 418502 13030052 538677 N_ambiguous 410875 2214 161626 UnstrandedReadsAssigned:12585441 PositiveStrandReadsAssigned:382552 NegativeStrandReadsAssigned:12714515 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389794 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389794-trimmed-pair1.fastq SRR11389794-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,007,339 reads, 14,297,583 reads pseudoaligned [quant] estimated average fragment length: 193.518 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52973 SRR11389794.ke.tsv 35125 SRR11389794.se.tsv 88098 total ==> SRR11389794.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 743.529 27.9447 3.43639 PNS24247 1044 851.482 10.5167 1.12929 PNS24249 1928 1735.48 37.8977 1.99661 PNS24246 1044 851.482 10.5167 1.12929 PNS24248 1044 851.482 10.5167 1.12929 PNS24244 1471 1278.48 48.6075 3.47623 PNS24243 293 113.382 0 0 KQK14069 1603 1410.48 258.313 16.7448 KQK14071 474 282.886 10.6558 3.44408 ==> SRR11389794.se.tsv <== BRADI_1g14170v3 288 BRADI_1g53295v3 3 BRADI_1g59795v3 183 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 290 BRADI_1g74790v3 368 BRADI_1g09890v3 0 BRADI_1g77505v3 123 BRADI_1g48960v3 0 SRR11389794 completed mapping pipeline successfully