Starting /dee2/code/volunteer_pipeline.sh SRR11389795 current disk space = 1545107984384 free memory = 1420852856 SRR11389795 SRAfilesize 2e669fa74fb0e94b0bbf74232c8fe704 SRR11389795.sra SRR11389795.sra file validated SRR11389795 is paired end SRR11389795 is conventional basespace SRR11389795 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389795_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.0885 32.0 32.0 32.0 32.0 32.0 2 30.81275 32.0 32.0 32.0 32.0 32.0 3 30.9425 32.0 32.0 32.0 32.0 32.0 4 30.964 32.0 32.0 32.0 32.0 32.0 5 30.9325 32.0 32.0 32.0 32.0 32.0 6 34.04 36.0 36.0 36.0 32.0 36.0 7 34.056 36.0 36.0 36.0 32.0 36.0 8 33.86775 36.0 36.0 36.0 32.0 36.0 9 34.2205 36.0 36.0 36.0 32.0 36.0 10-11 33.981875 36.0 36.0 36.0 32.0 36.0 12-13 34.05675 36.0 36.0 36.0 32.0 36.0 14-15 33.996875 36.0 36.0 36.0 32.0 36.0 16-17 34.0215 36.0 36.0 36.0 32.0 36.0 18-19 33.986374999999995 36.0 36.0 36.0 32.0 36.0 20-21 33.92475 36.0 36.0 36.0 32.0 36.0 22-23 33.795125 36.0 36.0 36.0 32.0 36.0 24-25 33.689875 36.0 36.0 36.0 32.0 36.0 26-27 33.536500000000004 36.0 36.0 36.0 29.5 36.0 28-29 33.438375 36.0 36.0 36.0 24.0 36.0 30-31 33.468875 36.0 36.0 36.0 27.0 36.0 32-33 33.215875 36.0 36.0 36.0 21.0 36.0 34-35 33.188125 36.0 36.0 36.0 24.0 36.0 36-37 33.43264639356622 36.0 36.0 36.0 24.0 36.0 38-39 33.2485549132948 36.0 36.0 36.0 21.0 36.0 40-41 33.28813772304599 36.0 36.0 36.0 20.5 36.0 42-43 33.20708720784117 36.0 36.0 36.0 17.5 36.0 44-45 33.00263885398341 36.0 36.0 36.0 14.0 36.0 46-47 32.89670771550641 36.0 36.0 36.0 14.0 36.0 48-49 32.84066348328726 36.0 36.0 36.0 14.0 36.0 50-51 32.69288766021614 36.0 36.0 36.0 14.0 36.0 52-53 32.714878110077905 36.0 34.0 36.0 14.0 36.0 54-55 32.29831615983916 36.0 34.0 36.0 14.0 36.0 56-57 32.34870570495099 36.0 32.0 36.0 14.0 36.0 58-59 32.23598894194521 36.0 32.0 36.0 14.0 36.0 60-61 32.01897461673787 36.0 32.0 36.0 14.0 36.0 62-63 31.83086202563458 36.0 32.0 36.0 14.0 36.0 64-65 31.701935159587833 36.0 32.0 36.0 14.0 36.0 66-67 31.6016109461551 36.0 32.0 36.0 14.0 36.0 68-69 31.41968325791855 36.0 32.0 36.0 14.0 36.0 70-71 31.45849081656522 36.0 32.0 36.0 14.0 36.0 72-73 31.339595485678903 36.0 32.0 36.0 14.0 36.0 74-75 30.986152305625268 36.0 32.0 36.0 14.0 36.0 76 30.774632748118954 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 9.0 24 6.0 25 24.0 26 51.0 27 80.0 28 141.0 29 190.0 30 258.0 31 368.0 32 507.0 33 716.0 34 1042.0 35 586.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.336768032168884 11.786881125911034 10.731339532545865 37.14501130937421 2 26.388539834129176 13.345061573259612 34.55642121135964 25.70997738125157 3 23.699421965317917 20.960040211108318 22.44282483035939 32.89771299321437 4 29.077657702940435 25.936164865544107 19.70344307614979 25.282734355365672 5 27.444081427494343 29.530032671525507 21.83965820557929 21.186227695400856 6 23.96881287726358 29.879275653923543 24.421529175050303 21.730382293762577 7 19.10027645136969 21.990449861774312 36.61724051269163 22.292033174164363 8 21.135963810002515 22.19150540336768 28.273435536566975 28.399095250062828 9 20.6333249560191 20.884644383010805 31.842171399849207 26.639859261120886 10-11 24.214626790650918 29.680824327720533 21.94018597637597 24.164362905252577 12-13 24.88062327217894 23.02085951244031 24.440814274943452 27.657702940437296 14-15 24.08896707715506 24.013571249057552 26.300578034682083 25.5968836391053 16-17 25.49635586830862 24.063835134455893 24.516210103040965 25.923598894194523 18-19 24.390550389545112 24.34028650414677 24.679567730585575 26.589595375722542 20-21 24.88062327217894 25.106810756471475 24.08896707715506 25.923598894194523 22-23 25.14450867052023 24.026137220407136 25.04398089972355 25.785373209349082 24-25 24.541342045740137 25.295300326715253 23.86277959286253 26.300578034682083 26-27 24.85549132947977 24.063835134455893 24.566473988439306 26.514199547625033 28-29 24.968585071626038 24.604171902488062 24.34028650414677 26.08695652173913 30-31 24.780095501382256 24.05126916310631 25.634581553154057 25.534053782357375 32-33 24.71726564463433 24.579039959788894 25.20733852726816 25.49635586830862 34-35 24.616737873837646 24.34028650414677 25.785373209349082 25.257602412666497 36-37 25.031414928373962 24.05126916310631 23.825081678813774 27.09223422970596 38-39 24.76752953003267 24.842925358130184 25.04398089972355 25.345564212113597 40-41 24.993717014325206 24.516210103040965 24.23975873335009 26.25031414928374 42-43 25.559185725056548 23.221915054033676 25.408394068861522 25.81050515204825 44-45 23.322442824830357 24.18949484795175 24.956019100276453 27.532043226941443 46-47 25.094244785121887 23.96330736365921 24.063835134455893 26.878612716763005 48-49 25.70997738125157 23.07112339783865 24.968585071626038 26.25031414928374 50-51 25.219904498617744 24.03870319175672 24.64186981653682 26.099522493088717 52-53 25.785373209349082 23.850213621512943 23.91304347826087 26.4513696908771 54-55 24.528776074390553 24.151796933902993 24.566473988439306 26.752953003267155 56-57 24.403116360894696 24.88062327217894 24.252324704699674 26.46393566222669 58-59 24.541342045740137 24.18949484795175 24.591605931138478 26.677557175169643 60-61 25.483789896959035 23.598894194521236 24.893189243528525 26.024126664991204 62-63 24.842925358130184 24.403116360894696 25.05654687107313 25.69741140990199 64-65 25.14450867052023 23.925609449610455 24.64186981653682 26.288012063332495 66-67 25.54983033806711 23.51388714339575 24.40618323488752 26.530099283649616 68-69 25.01256913021619 23.981900452488688 24.007038712921066 26.998491704374057 70-71 25.547169811320753 24.07547169811321 23.61006289308176 26.767295597484274 72-73 25.341081354219302 23.96412329459323 24.153612935826175 26.54118241536129 74-75 24.6386420899085 20.43495557618353 26.269725500596735 28.656676833311234 76 28.018631314940883 0.0 33.64385524901469 38.33751343604443 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 21.0 1 10.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 2.0 18 3.5 19 5.5 20 7.0 21 10.0 22 13.0 23 9.5 24 7.0 25 8.5 26 9.0 27 14.5 28 18.0 29 20.5 30 23.0 31 28.5 32 39.5 33 42.5 34 52.0 35 71.0 36 83.5 37 91.5 38 118.5 39 139.0 40 120.0 41 137.0 42 174.0 43 176.0 44 180.5 45 192.0 46 187.0 47 173.0 48 179.0 49 168.0 50 152.0 51 141.5 52 119.5 53 114.0 54 118.5 55 117.5 56 120.0 57 129.0 58 128.5 59 137.5 60 151.5 61 143.5 62 136.0 63 129.0 64 106.0 65 91.5 66 90.5 67 90.0 68 85.0 69 69.0 70 50.5 71 44.0 72 49.0 73 44.0 74 33.0 75 31.0 76 30.5 77 27.0 78 20.0 79 17.5 80 11.5 81 8.0 82 6.5 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.525 3 0.525 4 0.525 5 0.525 6 0.6 7 0.525 8 0.525 9 0.525 10-11 0.525 12-13 0.525 14-15 0.525 16-17 0.525 18-19 0.525 20-21 0.525 22-23 0.525 24-25 0.525 26-27 0.525 28-29 0.525 30-31 0.525 32-33 0.525 34-35 0.525 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 21.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 0.0 68 0.0 69 2.0 70 2.0 71 8.0 72 16.0 73 54.0 74 251.0 75 854.0 76 2791.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.57559958289886 93.575 2 1.6423357664233578 3.15 3 0.5213764337851928 1.5 4 0.07820646506777894 0.3 5 0.07820646506777894 0.375 6 0.0 0.0 7 0.026068821689259645 0.17500000000000002 8 0.05213764337851929 0.4 9 0.0 0.0 >10 0.026068821689259645 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 21 0.525 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 8 0.2 No Hit GAAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAATC 8 0.2 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 7 0.17500000000000002 No Hit GTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCT 5 0.125 No Hit GTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGG 5 0.125 No Hit CTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389795 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389795_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.63775 32.0 32.0 32.0 32.0 32.0 2 30.146 32.0 32.0 32.0 21.0 32.0 3 29.96675 32.0 32.0 32.0 21.0 32.0 4 30.008 32.0 32.0 32.0 21.0 32.0 5 29.869 32.0 32.0 32.0 21.0 32.0 6 33.12225 36.0 36.0 36.0 21.0 36.0 7 33.3305 36.0 36.0 36.0 21.0 36.0 8 33.18975 36.0 36.0 36.0 21.0 36.0 9 33.05625 36.0 36.0 36.0 21.0 36.0 10-11 33.086 36.0 36.0 36.0 17.5 36.0 12-13 33.018874999999994 36.0 36.0 36.0 17.5 36.0 14-15 32.84075 36.0 36.0 36.0 17.5 36.0 16-17 32.897375 36.0 36.0 36.0 17.5 36.0 18-19 32.81525 36.0 36.0 36.0 14.0 36.0 20-21 32.751000000000005 36.0 36.0 36.0 14.0 36.0 22-23 32.552875 36.0 36.0 36.0 14.0 36.0 24-25 32.61525 36.0 36.0 36.0 14.0 36.0 26-27 32.563874999999996 36.0 36.0 36.0 14.0 36.0 28-29 32.4855 36.0 36.0 36.0 14.0 36.0 30-31 32.537625 36.0 36.0 36.0 14.0 36.0 32-33 32.360625 36.0 36.0 36.0 14.0 36.0 34-35 32.257374999999996 36.0 36.0 36.0 14.0 36.0 36-37 32.43951207243461 36.0 34.0 36.0 14.0 36.0 38-39 32.33452206952406 36.0 34.0 36.0 14.0 36.0 40-41 32.15770040510043 36.0 32.0 36.0 14.0 36.0 42-43 32.073892245720046 36.0 32.0 36.0 14.0 36.0 44-45 31.98099194360524 36.0 32.0 36.0 14.0 36.0 46-47 31.860649546827794 36.0 32.0 36.0 14.0 36.0 48-49 31.719033232628398 36.0 32.0 36.0 14.0 36.0 50-51 31.743454179254783 36.0 32.0 36.0 14.0 36.0 52-53 31.54984894259819 36.0 32.0 36.0 14.0 36.0 54-55 31.25591641490433 36.0 32.0 36.0 14.0 36.0 56-57 31.201032225579056 36.0 32.0 36.0 14.0 36.0 58-59 31.00188821752266 36.0 32.0 36.0 14.0 36.0 60-61 30.907099697885194 36.0 32.0 36.0 14.0 36.0 62-63 30.883308157099698 36.0 29.5 36.0 14.0 36.0 64-65 30.5337361530715 36.0 27.0 36.0 14.0 36.0 66-67 30.610271903323266 36.0 27.0 36.0 14.0 36.0 68-69 30.458207452165155 36.0 27.0 36.0 14.0 36.0 70-71 30.251882702546247 36.0 27.0 36.0 14.0 36.0 72-73 30.330656552246474 36.0 27.0 36.0 14.0 36.0 74-75 29.84259475068162 36.0 27.0 36.0 14.0 36.0 76 28.873580065958226 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 0.0 4 2.0 5 3.0 6 0.0 7 0.0 8 0.0 9 2.0 10 1.0 11 0.0 12 0.0 13 1.0 14 1.0 15 4.0 16 11.0 17 3.0 18 9.0 19 6.0 20 9.0 21 18.0 22 28.0 23 23.0 24 47.0 25 66.0 26 132.0 27 133.0 28 191.0 29 244.0 30 289.0 31 345.0 32 478.0 33 679.0 34 818.0 35 433.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.179074446680076 19.61770623742455 9.909456740442655 32.29376257545272 2 30.357142857142854 22.535211267605636 27.94265593561368 19.164989939637827 3 26.609657947686117 26.685110663983902 20.095573440643864 26.609657947686117 4 30.533199195171022 30.709255533199197 17.077464788732392 21.680080482897385 5 28.722334004024148 31.866197183098592 18.435613682092555 20.97585513078471 6 24.14486921529175 33.601609657947684 20.04527162977867 22.208249496981892 7 24.14486921529175 16.57444668008048 33.37525150905433 25.90543259557344 8 25.660377358490567 20.80503144654088 23.044025157232703 30.49056603773585 9 25.918470055359837 20.709612481127326 25.13839959738299 28.233517866129844 10-11 27.786874921274716 27.660914472855524 19.070411890666332 25.481798715203425 12-13 29.18346774193548 20.551915322580644 21.748991935483872 28.515625 14-15 26.285930408472012 24.621785173978818 23.411497730711044 25.680786686838125 16-17 26.94829760403531 23.30390920554855 22.69861286254729 27.049180327868854 18-19 27.099621689785625 23.593947036569986 22.686002522068097 26.62042875157629 20-21 26.506935687263557 24.060529634300128 23.3921815889029 26.04035308953342 22-23 27.377049180327866 24.211853720050442 21.57629255989912 26.834804539722573 24-25 27.22915878420986 24.391474334720645 21.679909194097615 26.69945768697188 26-27 26.504352213952316 24.32193768134225 23.085656616626718 26.088053488078717 28-29 26.884295437358208 24.514746659944542 22.788001008318627 25.812956894378626 30-31 26.727181038830057 24.546142208774587 21.608673726676752 27.118003025718608 32-33 26.579245996721724 24.612280922960533 23.036187113857018 25.77228596646072 34-35 28.18216223035196 24.03179008452126 22.013372019679576 25.772675665447203 36-37 26.866801210898082 23.789101917255298 22.363773965691223 26.980322906155397 38-39 26.30517023959647 24.80453972257251 23.266078184110974 25.624211853720052 40-41 27.136375094529868 23.80892361986388 21.641038568187547 27.413662717418703 42-43 26.847414880201764 23.98486759142497 22.559899117276167 26.6078184110971 44-45 27.5031525851198 24.24968474148802 22.3203026481715 25.926860025220684 46-47 27.32543483740862 24.098815225611293 22.334257625409627 26.241492311570457 48-49 26.652371342078705 23.549445005045406 23.29717457114026 26.50100908173562 50-51 26.847414880201764 24.955863808322825 22.383354350567465 25.813366960907945 52-53 26.73479687105728 23.492303810244763 22.886701993439313 26.886197325258642 54-55 27.137452711223204 25.09457755359395 21.866330390920556 25.901639344262296 56-57 27.957124842370746 23.228247162673394 22.976040353089534 25.83858764186633 58-59 28.29212916246216 22.830474268415742 23.43592330978809 25.441473259334007 60-61 28.007566204287514 24.539722572509458 22.194199243379572 25.258511979823457 62-63 27.067574382249116 25.22692889561271 22.239031770045386 25.46646495209279 64-65 27.389659520807065 24.37578814627995 21.916771752837327 26.317780580075663 66-67 27.21199899168137 24.363498865641542 22.094781951096547 26.32972019158054 68-69 26.449823499747854 24.470499243570348 22.76853252647504 26.31114473020676 70-71 27.13961120929058 24.413027013380457 22.30497349154254 26.142388285786417 72-73 27.055098163394554 24.103863204559847 22.54591513616213 26.29512349588347 74-75 27.13809206137425 21.267511674449633 23.61574382921948 27.978652434956636 76 29.662261380323052 0.0 30.653450807635828 39.68428781204111 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 25.0 1 12.5 2 0.0 3 0.5 4 1.0 5 1.5 6 2.0 7 1.5 8 1.0 9 1.0 10 0.5 11 0.0 12 0.5 13 1.0 14 1.0 15 1.0 16 1.5 17 2.0 18 4.0 19 5.0 20 3.0 21 3.5 22 3.0 23 4.5 24 7.0 25 4.5 26 5.0 27 9.5 28 12.5 29 13.5 30 16.0 31 25.5 32 32.5 33 34.0 34 42.5 35 53.5 36 66.5 37 86.0 38 93.5 39 102.5 40 116.5 41 114.5 42 117.5 43 159.0 44 185.0 45 171.0 46 167.5 47 160.5 48 142.5 49 133.0 50 133.0 51 129.0 52 128.5 53 130.5 54 136.5 55 138.5 56 139.0 57 145.0 58 145.5 59 151.0 60 158.5 61 154.0 62 144.5 63 127.5 64 111.5 65 103.5 66 99.0 67 101.5 68 98.5 69 92.0 70 80.5 71 70.0 72 66.5 73 62.5 74 57.0 75 49.5 76 39.0 77 32.0 78 26.5 79 21.5 80 15.0 81 11.0 82 9.5 83 6.0 84 5.0 85 3.0 86 1.5 87 1.0 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 1.0 95 1.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.6 3 0.6 4 0.6 5 0.6 6 0.6 7 0.6 8 0.625 9 0.65 10-11 0.7625 12-13 0.8 14-15 0.8500000000000001 16-17 0.8750000000000001 18-19 0.8750000000000001 20-21 0.8750000000000001 22-23 0.8750000000000001 24-25 0.8875 26-27 0.9125 28-29 0.8250000000000001 30-31 0.8500000000000001 32-33 0.8625 34-35 0.9125 36-37 0.30181086519114686 38-39 0.26411772104137843 40-41 0.15101938082053865 42-43 0.17623363544813697 44-45 0.17623363544813697 46-47 0.12588116817724068 48-49 0.2014098690835851 50-51 0.17623363544813697 52-53 0.22658610271903326 54-55 0.17623363544813697 56-57 0.17623363544813697 58-59 0.2014098690835851 60-61 0.17623363544813697 62-63 0.1510574018126888 64-65 0.17623363544813697 66-67 0.12588116817724068 68-69 0.1510574018126888 70-71 0.15124779430299976 72-73 0.1265022137887413 74-75 0.13324450366422386 76 0.18321729571271528 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 24.0 36 0.0 37 0.0 38 1.0 39 1.0 40 2.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 3.0 70 4.0 71 4.0 72 17.0 73 61.0 74 261.0 75 893.0 76 2729.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.53630705394191 94.025 2 1.841286307053942 3.55 3 0.4927385892116182 1.425 4 0.1037344398340249 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025933609958506226 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 24 0.6 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 883258 spots for SRR11389795.sra Written 883258 spots for SRR11389795.sra Read 883258 spots for SRR11389795.sra Written 883258 spots for SRR11389795.sra Read 883258 spots for SRR11389795.sra Written 883258 spots for SRR11389795.sra Read 883258 spots for SRR11389795.sra Written 883258 spots for SRR11389795.sra Read 883258 spots for SRR11389795.sra Written 883258 spots for SRR11389795.sra Read 883258 spots for SRR11389795.sra Written 883258 spots for SRR11389795.sra Read 883258 spots for SRR11389795.sra Written 883258 spots for SRR11389795.sra Read 883258 spots for SRR11389795.sra Written 883258 spots for SRR11389795.sra Read 883258 spots for SRR11389795.sra Written 883258 spots for SRR11389795.sra Read 883258 spots for SRR11389795.sra Written 883258 spots for SRR11389795.sra Read 883258 spots for SRR11389795.sra Written 883258 spots for SRR11389795.sra Read 883258 spots for SRR11389795.sra Written 883258 spots for SRR11389795.sra Read 883258 spots for SRR11389795.sra Written 883258 spots for SRR11389795.sra Read 883258 spots for SRR11389795.sra Written 883258 spots for SRR11389795.sra Read 883258 spots for SRR11389795.sra Written 883258 spots for SRR11389795.sra Read 883258 spots for SRR11389795.sra Written 883258 spots for SRR11389795.sra Read 883258 spots for SRR11389795.sra Written 883258 spots for SRR11389795.sra Read 883258 spots for SRR11389795.sra Written 883258 spots for SRR11389795.sra Read 883258 spots for SRR11389795.sra Written 883258 spots for SRR11389795.sra Read 883274 spots for SRR11389795.sra Written 883274 spots for SRR11389795.sra SRR ids: ['SRR11389795.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7wxycm3k SRR11389795.sra spots: 17665176 blocks: [[1, 883258], [883259, 1766516], [1766517, 2649774], [2649775, 3533032], [3533033, 4416290], [4416291, 5299548], [5299549, 6182806], [6182807, 7066064], [7066065, 7949322], [7949323, 8832580], [8832581, 9715838], [9715839, 10599096], [10599097, 11482354], [11482355, 12365612], [12365613, 13248870], [13248871, 14132128], [14132129, 15015386], [15015387, 15898644], [15898645, 16781902], [16781903, 17665176]] SRR11389795 file size 3350099 SRR11389795 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389795 SRR11389795_1.fastq SRR11389795_2.fastq Input file: SRR11389795_1.fastq Paired file: SRR11389795_2.fastq trimmed: SRR11389795-trimmed-pair1.fastq, SRR11389795-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:40:16 2024 >> started Sat Dec 7 06:40:29 2024 >> done (13.283s) 17665176 read pairs processed; of these: 742 ( 0.00%) short read pairs filtered out after trimming by size control 201412 ( 1.14%) empty read pairs filtered out after trimming by size control 17463022 (98.86%) read pairs available; of these: 10816 ( 0.06%) trimmed read pairs available after processing 17452206 (99.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 174 0.00% 19 7 0.00% 20 304 0.00% 21 7 0.00% 22 374 0.00% 23 3 0.00% 24 470 0.00% 25 9 0.00% 26 415 0.00% 27 10 0.00% 28 389 0.00% 29 9 0.00% 30 361 0.00% 31 12 0.00% 32 314 0.00% 33 10 0.00% 34 292 0.00% 35 83 0.00% 36 1098 0.01% 37 93 0.00% 38 641 0.00% 39 105 0.00% 40 335 0.00% 41 107 0.00% 42 236 0.00% 43 151 0.00% 44 238 0.00% 45 163 0.00% 46 140 0.00% 47 161 0.00% 48 228 0.00% 49 212 0.00% 50 194 0.00% 51 237 0.00% 52 268 0.00% 53 301 0.00% 54 255 0.00% 55 652 0.00% 56 1000 0.01% 57 730 0.00% 58 767 0.00% 59 709 0.00% 60 733 0.00% 61 683 0.00% 62 773 0.00% 63 931 0.01% 64 983 0.01% 65 1116 0.01% 66 1305 0.01% 67 1622 0.01% 68 1471 0.01% 69 1831 0.01% 70 2461 0.01% 71 3800 0.02% 72 19932 0.11% 73 149580 0.86% 74 1156275 6.62% 75 7629944 43.69% 76 8477318 48.54% 17463022 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=23 prefix-density=0.81 prefix-fanout=2.0 sequence=TTAGGCCTTGCCGGACTCCTC criterion=fanout-score sequence-density=0.30 sequence-density-rank=13 fanout-score=4.15 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=1.3 sequence=TCCAGCTCCTTTAGCACCTGCGTGGCGTCGGTGCACCCGAACATGGG criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=12 prefix-density=0.81 prefix-fanout=2.4 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=10.44 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.1 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC SRR11389795 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:41:08 Started mapping on | Dec 07 06:41:08 Finished on | Dec 07 06:44:40 Mapping speed, Million of reads per hour | 296.54 Number of input reads | 17463022 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 14814196 Uniquely mapped reads % | 84.83% Average mapped length | 149.83 Number of splices: Total | 6035223 Number of splices: Annotated (sjdb) | 5778626 Number of splices: GT/AG | 5955373 Number of splices: GC/AG | 70747 Number of splices: AT/AC | 1569 Number of splices: Non-canonical | 7534 Mismatch rate per base, % | 1.40% Deletion rate per base | 0.01% Deletion average length | 1.70 Insertion rate per base | 0.00% Insertion average length | 1.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1755560 % of reads mapped to multiple loci | 10.05% Number of reads mapped to too many loci | 30773 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.13% % of reads unmapped: other | 0.81% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 893272 893272 893272 N_multimapping 1755560 1755560 1755560 N_noFeature 436791 14411029 560088 N_ambiguous 439096 2495 172413 UnstrandedReadsAssigned:13938309 PositiveStrandReadsAssigned:400672 NegativeStrandReadsAssigned:14081695 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389795 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389795-trimmed-pair1.fastq SRR11389795-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,463,022 reads, 15,835,085 reads pseudoaligned [quant] estimated average fragment length: 199.423 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52973 SRR11389795.ke.tsv 35125 SRR11389795.se.tsv 88098 total ==> SRR11389795.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 737.705 0 0 PNS24247 1044 845.577 7.62696 0.751656 PNS24249 1928 1729.58 53.4411 2.57488 PNS24246 1044 845.577 7.62696 0.751656 PNS24248 1044 845.577 7.62696 0.751656 PNS24244 1471 1272.58 50.678 3.31861 PNS24243 293 108.944 1 0.764921 KQK14069 1603 1404.58 135.828 8.05869 KQK14071 474 277.273 0 0 ==> SRR11389795.se.tsv <== BRADI_1g14170v3 140 BRADI_1g53295v3 11 BRADI_1g59795v3 156 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 220 BRADI_1g74790v3 300 BRADI_1g09890v3 0 BRADI_1g77505v3 154 BRADI_1g48960v3 0 SRR11389795 completed mapping pipeline successfully