Starting /dee2/code/volunteer_pipeline.sh SRR11389796 current disk space = 1545073487872 free memory = 1595882668 SRR11389796 SRAfilesize 1bffba0b8e778c2c6c6546933f693ccb SRR11389796.sra SRR11389796.sra file validated SRR11389796 is paired end SRR11389796 is conventional basespace SRR11389796 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389796_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.41175 32.0 32.0 32.0 21.0 32.0 2 29.52525 32.0 32.0 32.0 21.0 32.0 3 29.48 32.0 32.0 32.0 21.0 32.0 4 29.59175 32.0 32.0 32.0 21.0 32.0 5 29.50675 32.0 32.0 32.0 21.0 32.0 6 32.203 36.0 36.0 36.0 14.0 36.0 7 32.3235 36.0 36.0 36.0 14.0 36.0 8 32.34375 36.0 36.0 36.0 14.0 36.0 9 32.43575 36.0 36.0 36.0 14.0 36.0 10-11 32.31075 36.0 36.0 36.0 14.0 36.0 12-13 32.498625 36.0 36.0 36.0 17.5 36.0 14-15 32.400875 36.0 36.0 36.0 14.0 36.0 16-17 32.315875000000005 36.0 36.0 36.0 14.0 36.0 18-19 32.29174999999999 36.0 36.0 36.0 14.0 36.0 20-21 32.242875 36.0 36.0 36.0 14.0 36.0 22-23 32.122 36.0 36.0 36.0 14.0 36.0 24-25 31.966625 36.0 36.0 36.0 14.0 36.0 26-27 31.817875 36.0 36.0 36.0 14.0 36.0 28-29 31.853749999999998 36.0 36.0 36.0 14.0 36.0 30-31 31.740000000000002 36.0 34.0 36.0 14.0 36.0 32-33 31.533250000000002 36.0 32.0 36.0 14.0 36.0 34-35 31.486 36.0 32.0 36.0 14.0 36.0 36-37 33.39290182020653 36.0 36.0 36.0 24.0 36.0 38-39 33.26215836839052 36.0 36.0 36.0 21.0 36.0 40-41 33.32725860740581 36.0 36.0 36.0 24.0 36.0 42-43 33.19285903902309 36.0 36.0 36.0 17.5 36.0 44-45 33.01168038226706 36.0 36.0 36.0 14.0 36.0 46-47 32.79811521104327 36.0 36.0 36.0 14.0 36.0 48-49 32.87297668894372 36.0 36.0 36.0 17.5 36.0 50-51 32.57941567065073 36.0 34.0 36.0 14.0 36.0 52-53 32.604648074369194 36.0 34.0 36.0 14.0 36.0 54-55 32.27436918990704 36.0 32.0 36.0 14.0 36.0 56-57 32.2933598937583 36.0 34.0 36.0 14.0 36.0 58-59 32.03691899070385 36.0 32.0 36.0 14.0 36.0 60-61 31.993094289508633 36.0 32.0 36.0 14.0 36.0 62-63 31.913545816733066 36.0 32.0 36.0 14.0 36.0 64-65 31.803452855245684 36.0 32.0 36.0 14.0 36.0 66-67 31.515414257576833 36.0 32.0 36.0 14.0 36.0 68-69 31.313978208875895 36.0 32.0 36.0 14.0 36.0 70-71 31.36405959031657 36.0 32.0 36.0 14.0 36.0 72-73 31.148780157903925 36.0 32.0 36.0 14.0 36.0 74-75 31.106683067712893 36.0 32.0 36.0 14.0 36.0 76 30.271852137081247 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 227.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 2.0 23 10.0 24 13.0 25 25.0 26 55.0 27 73.0 28 125.0 29 174.0 30 250.0 31 329.0 32 482.0 33 728.0 34 971.0 35 534.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.95388285184204 12.456930824277764 10.787172011661808 38.80201431221839 2 24.887357540418765 14.60376358335542 35.46249668698648 25.04638218923933 3 23.721176782401272 20.699708454810494 23.03206997084548 32.54704479194275 4 29.021998409753515 25.496952027564273 19.347998939835676 26.133050622846543 5 26.716141001855288 31.221839385104694 21.812880996554465 20.249138616485553 6 22.20748209074025 32.36932873441231 24.22393207747413 21.19925709737331 7 18.923933209647494 23.88020143122184 37.42380068910681 19.772064670023852 8 19.427511264245958 22.422475483699973 31.937450304797245 26.212562947256824 9 20.620196130400213 20.99125364431487 32.99761463026769 25.39093559501723 10-11 23.45613570103366 29.088258680095414 22.859793267956533 24.595812350914393 12-13 23.9067055393586 23.45613570103366 25.801749271137027 26.835409488470713 14-15 23.760932944606413 25.960773919957592 24.874105486350384 25.404187649085607 16-17 24.025974025974026 25.98727802809436 24.874105486350384 25.112642459581235 18-19 24.105486350384307 25.510204081632654 25.2716671084018 25.112642459581235 20-21 24.291015107341636 25.748741054863505 25.112642459581235 24.847601378213625 22-23 23.999469917837267 24.688576729393056 26.159554730983302 25.152398621786375 24-25 24.065730188179167 25.576464351974554 24.13199045852107 26.225815001325202 26-27 23.601908295785847 24.98012191889743 26.133050622846543 25.28491916247018 28-29 24.71508083752982 24.75483699973496 24.78134110787172 25.748741054863505 30-31 23.46938775510204 25.70898489265836 25.03313013517095 25.788497217068645 32-33 23.376623376623375 24.95361781076067 26.080042406573018 25.58971640604294 34-35 24.635568513119534 25.2716671084018 24.913861648555528 25.178902729923138 36-37 23.849927084714302 25.98435635688718 24.062044279464402 26.10367227893411 38-39 24.46272220748209 25.60360838418679 24.48925444414964 25.444414964181483 40-41 24.326476443264763 24.525547445255473 24.790975447909755 26.357000663570005 42-43 24.31643217414388 24.595168569153174 24.887178125829575 26.201221130873375 44-45 24.741173347491372 24.303159012476772 24.435890629147863 26.519777010883992 46-47 24.80753915582692 24.674807539155825 24.449163790814975 26.06848951420228 48-49 24.455655868295274 23.698884758364315 25.637280934678703 26.20817843866171 50-51 24.276228419654714 23.58565737051793 25.152722443559096 26.985391766268265 52-53 24.833997343957503 23.98406374501992 23.49269588313413 27.689243027888445 54-55 24.143426294820717 24.701195219123505 24.249667994687915 26.905710491367863 56-57 24.741035856573706 24.51527224435591 24.302788844621514 26.44090305444887 58-59 24.727755644090305 24.196547144754316 25.232403718459494 25.843293492695885 60-61 24.249667994687915 23.784860557768926 24.39575033200531 27.56972111553785 62-63 24.608233731739706 24.714475431606907 25.0199203187251 25.657370517928285 64-65 24.7941567065073 24.077025232403717 24.754316069057104 26.374501992031874 66-67 23.96386822529224 23.472369819341125 24.22954303931987 28.334218916046762 68-69 24.634600053149082 22.668083975551422 24.634600053149082 28.06271591815041 70-71 25.538707102952912 23.53019420058526 24.966746475126364 25.964352221335464 72-73 23.397435897435898 24.586004273504273 24.65277777777778 27.363782051282055 74-75 24.784877979968968 20.426012131471293 25.335026096769642 29.454083791790097 76 29.765113592606856 0.0 33.65421640354255 36.5806700038506 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 234.0 1 117.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 13.5 19 22.5 20 15.0 21 14.5 22 16.0 23 11.5 24 12.0 25 17.5 26 19.0 27 24.0 28 26.0 29 25.5 30 31.0 31 35.0 32 40.0 33 44.5 34 53.5 35 83.5 36 102.0 37 99.0 38 105.5 39 111.5 40 112.5 41 134.5 42 155.0 43 171.5 44 180.0 45 171.0 46 173.5 47 162.0 48 156.5 49 149.0 50 130.0 51 130.0 52 124.0 53 104.0 54 93.0 55 107.5 56 114.5 57 111.5 58 114.5 59 121.0 60 122.0 61 111.0 62 106.0 63 97.0 64 93.5 65 96.0 66 80.0 67 67.0 68 70.5 69 70.0 70 66.5 71 63.5 72 51.0 73 40.5 74 38.0 75 33.0 76 29.0 77 30.5 78 25.0 79 17.5 80 12.5 81 6.5 82 5.0 83 4.0 84 2.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.675 2 5.675 3 5.675 4 5.675 5 5.675 6 5.775 7 5.675 8 5.675 9 5.675 10-11 5.675 12-13 5.675 14-15 5.675 16-17 5.675 18-19 5.675 20-21 5.675 22-23 5.675 24-25 5.675 26-27 5.675 28-29 5.675 30-31 5.675 32-33 5.675 34-35 5.675 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 227.0 36 3.0 37 0.0 38 2.0 39 0.0 40 1.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 2.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 2.0 67 0.0 68 0.0 69 4.0 70 0.0 71 10.0 72 10.0 73 70.0 74 249.0 75 823.0 76 2597.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.075 #Duplication Level Percentage of deduplicated Percentage of total 1 96.04266067920292 85.55 2 2.862756104406399 5.1 3 0.7016559079427448 1.875 4 0.16839741790625876 0.6 5 0.08419870895312938 0.375 6 0.056132472635419595 0.3 7 0.0 0.0 8 0.028066236317709797 0.2 9 0.0 0.0 >10 0.028066236317709797 0.325 >50 0.0 0.0 >100 0.028066236317709797 5.675 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 227 5.675 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 13 0.325 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 8 0.2 No Hit CCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATTT 6 0.15 No Hit CTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCA 6 0.15 No Hit GAAAAAGGTACATAAAATCGGTGTGACCCGTTCTTGTATTATAAGAAATC 5 0.125 No Hit CAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGG 5 0.125 No Hit GTCGTAGTACCCGGGAGAGTTGCCGTGCTCACGGAAGACGAAACCGACCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.075 0.0 0.0 0.0 0.0 26 0.075 0.0 0.0 0.0 0.0 27 0.075 0.0 0.0 0.0 0.0 28 0.075 0.0 0.0 0.0 0.0 29 0.075 0.0 0.0 0.0 0.0 30 0.075 0.0 0.0 0.0 0.0 31 0.075 0.0 0.0 0.0 0.0 32 0.075 0.0 0.0 0.0 0.0 33 0.075 0.0 0.0 0.0 0.0 34 0.075 0.0 0.0 0.0 0.0 35 0.075 0.0 0.0 0.0 0.0 36 0.075 0.0 0.0 0.0 0.0 37 0.1 0.0 0.0 0.0 0.0 38 0.1 0.0 0.0 0.0 0.0 39 0.1 0.0 0.0 0.0 0.0 40 0.1 0.0 0.0 0.0 0.0 41 0.1 0.0 0.0 0.0 0.0 42 0.1 0.0 0.0 0.0 0.0 43 0.1 0.0 0.0 0.0 0.0 44 0.1 0.0 0.0 0.0 0.0 45 0.1 0.0 0.0 0.0 0.0 46 0.1 0.0 0.0 0.0 0.0 47 0.1 0.0 0.0 0.0 0.0 48 0.1 0.0 0.0 0.0 0.0 49 0.1 0.0 0.0 0.0 0.0 50 0.1 0.0 0.0 0.0 0.0 51 0.1 0.0 0.0 0.0 0.0 52 0.1 0.0 0.0 0.0 0.0 53 0.1 0.0 0.0 0.0 0.0 54 0.1 0.0 0.0 0.0 0.0 55 0.1 0.0 0.0 0.0 0.0 56 0.1 0.0 0.0 0.0 0.0 57 0.1 0.0 0.0 0.0 0.0 58 0.1 0.0 0.0 0.0 0.0 59 0.1 0.0 0.0 0.0 0.0 60 0.1 0.0 0.0 0.0 0.0 61 0.1 0.0 0.0 0.0 0.0 62 0.1 0.0 0.0 0.0 0.0 63 0.1 0.0 0.0 0.0 0.0 64 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389796 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389796_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.24925 32.0 32.0 32.0 14.0 32.0 2 28.82375 32.0 32.0 32.0 14.0 32.0 3 28.837 32.0 32.0 32.0 14.0 32.0 4 28.77325 32.0 32.0 32.0 14.0 32.0 5 28.73425 32.0 32.0 32.0 14.0 32.0 6 31.73825 36.0 36.0 36.0 14.0 36.0 7 31.9165 36.0 36.0 36.0 14.0 36.0 8 31.819 36.0 36.0 36.0 14.0 36.0 9 31.83475 36.0 36.0 36.0 14.0 36.0 10-11 31.66075 36.0 36.0 36.0 14.0 36.0 12-13 31.73625 36.0 36.0 36.0 14.0 36.0 14-15 31.52375 36.0 34.0 36.0 14.0 36.0 16-17 31.558500000000002 36.0 36.0 36.0 14.0 36.0 18-19 31.565625 36.0 36.0 36.0 14.0 36.0 20-21 31.43925 36.0 34.0 36.0 14.0 36.0 22-23 31.317124999999997 36.0 32.0 36.0 14.0 36.0 24-25 31.236375 36.0 32.0 36.0 14.0 36.0 26-27 31.156750000000002 36.0 32.0 36.0 14.0 36.0 28-29 31.225625 36.0 32.0 36.0 14.0 36.0 30-31 31.1475 36.0 32.0 36.0 14.0 36.0 32-33 31.0315 36.0 32.0 36.0 14.0 36.0 34-35 31.1465 36.0 32.0 36.0 14.0 36.0 36-37 32.509086858202295 36.0 36.0 36.0 14.0 36.0 38-39 32.37423058623863 36.0 34.0 36.0 14.0 36.0 40-41 32.4865334815984 36.0 36.0 36.0 14.0 36.0 42-43 32.30175159235669 36.0 36.0 36.0 14.0 36.0 44-45 32.11292462845011 36.0 32.0 36.0 14.0 36.0 46-47 32.089702760084926 36.0 32.0 36.0 14.0 36.0 48-49 31.90867677286887 36.0 32.0 36.0 14.0 36.0 50-51 31.880010618529333 36.0 32.0 36.0 14.0 36.0 52-53 31.687417042739582 36.0 32.0 36.0 14.0 36.0 54-55 31.44146535704805 36.0 32.0 36.0 14.0 36.0 56-57 31.496018051499867 36.0 32.0 36.0 14.0 36.0 58-59 31.2070613220069 36.0 32.0 36.0 14.0 36.0 60-61 31.19219538093974 36.0 32.0 36.0 14.0 36.0 62-63 31.14812848420494 36.0 32.0 36.0 14.0 36.0 64-65 30.818688611627287 36.0 32.0 36.0 14.0 36.0 66-67 30.773127056793765 36.0 29.5 36.0 14.0 36.0 68-69 30.657727031332982 36.0 27.0 36.0 14.0 36.0 70-71 30.537105119252637 36.0 27.0 36.0 14.0 36.0 72-73 30.175080949830388 36.0 27.0 36.0 14.0 36.0 74-75 30.10361847869021 36.0 27.0 36.0 14.0 36.0 76 29.1797583081571 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 225.0 3 0.0 4 2.0 5 2.0 6 3.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 3.0 15 0.0 16 5.0 17 3.0 18 5.0 19 10.0 20 9.0 21 15.0 22 15.0 23 22.0 24 51.0 25 76.0 26 90.0 27 117.0 28 161.0 29 196.0 30 275.0 31 352.0 32 420.0 33 600.0 34 895.0 35 447.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.90066225165563 19.894039735099337 10.410596026490067 32.794701986754966 2 29.456953642384104 22.596026490066226 29.324503311258276 18.62251655629139 3 25.721854304635762 27.655629139072847 20.95364238410596 25.66887417218543 4 29.907284768211923 30.119205298013245 18.19867549668874 21.774834437086092 5 28.503311258278146 32.87417218543046 19.019867549668874 19.602649006622517 6 24.370860927152318 34.41059602649006 20.132450331125828 21.08609271523179 7 24.60927152317881 17.801324503311257 33.05960264900663 24.52980132450331 8 23.111582295255765 20.752716671084016 25.39093559501723 30.74476543864299 9 24.469777306468718 22.242841993637327 26.00742311770944 27.279957582184515 10-11 27.10875331564987 27.74535809018568 19.880636604774534 25.26525198938992 12-13 27.176220806794056 21.297770700636942 23.88535031847134 27.640658174097666 14-15 26.55959649588532 24.396071144146536 23.666047252455535 25.37828510751261 16-17 28.277327666356754 23.123920839420904 22.44654004515872 26.15221144906362 18-19 27.445507708665602 23.89686337054758 23.59117490696438 25.066454013822437 20-21 27.963849016480598 24.375332270069112 23.431685273790535 24.229133439659755 22-23 26.521392505979275 24.820621844273187 23.292585702896627 25.36539994685092 24-25 26.50106269925611 23.96386822529224 23.047290116896917 26.48777895855473 26-27 26.28639808536099 24.877011035766518 23.680361654035366 25.156229224837123 28-29 25.8732899455439 23.734891751892683 23.21689467392748 27.174923628635938 30-31 26.693227091633464 25.258964143426294 22.921646746347943 25.126162018592296 32-33 26.7933049946865 24.58820403825717 22.90116896918172 25.717321997874603 34-35 26.572682537571485 23.06157733741189 23.101476260140977 27.264263864875648 36-37 26.496408619313648 24.780526735834 22.745411013567438 25.977653631284912 38-39 27.7977378576181 24.058549567531603 23.060545575515633 25.083166999334665 40-41 27.744510978043913 23.845642049234865 21.929474384564205 26.48037258815702 42-43 27.824351297405194 24.018629407850963 22.994011976047904 25.16300731869594 44-45 26.959414504324684 24.49767132401863 22.44843646041251 26.09447771124418 46-47 26.97736351531292 24.620505992010653 22.503328894806923 25.898801597869507 48-49 27.644551025845992 23.67439381827871 22.422062350119905 26.258992805755394 50-51 26.724367509986685 24.354194407456724 22.75632490013316 26.165113182423433 52-53 27.523302263648468 23.821571238348866 23.355525965379496 25.299600532623167 54-55 27.22429408630794 24.493873201917953 22.65583377730421 25.6259989344699 56-57 27.229172211871173 23.755656108597282 23.40963534735161 25.60553633217993 58-59 27.451763140385893 23.845642049234865 23.339986693280107 25.362608117099132 60-61 27.73858645015307 23.99840276853454 23.026753627046453 25.23625715426594 62-63 26.740316784240648 25.329428989751097 23.133235724743777 24.797018501264475 64-65 26.879574184963406 23.872255489021956 23.00731869594145 26.240851630073188 66-67 26.35009310986965 24.261771747805266 23.703112529928173 25.685022612396914 68-69 26.13092070250133 24.268227780734435 23.69611495476317 25.904736562001062 70-71 26.555629580279817 23.011325782811458 23.664223850766156 26.768820786142573 72-73 27.114327838091405 23.267658490818924 23.173837287226913 26.444176383862754 74-75 27.57160999012276 21.40539015098067 23.86058981233244 27.162410046564133 76 29.155622870124954 0.0 31.57894736842105 39.265429761453994 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 234.0 1 117.5 2 1.0 3 1.5 4 2.0 5 2.0 6 1.0 7 0.0 8 0.0 9 0.5 10 2.0 11 2.0 12 1.0 13 2.5 14 2.0 15 0.5 16 2.0 17 4.0 18 7.0 19 8.0 20 7.5 21 11.0 22 13.5 23 11.0 24 9.0 25 10.5 26 12.5 27 14.0 28 18.5 29 21.5 30 25.5 31 32.5 32 35.0 33 32.0 34 36.0 35 48.5 36 55.0 37 61.5 38 85.0 39 96.5 40 100.5 41 129.0 42 143.0 43 141.0 44 145.0 45 143.5 46 143.0 47 139.5 48 135.0 49 139.5 50 143.5 51 139.0 52 125.0 53 111.0 54 112.0 55 123.0 56 131.0 57 126.0 58 120.0 59 146.5 60 168.0 61 149.5 62 124.5 63 111.5 64 109.5 65 102.0 66 91.0 67 87.0 68 77.5 69 72.5 70 79.5 71 83.0 72 72.5 73 60.0 74 53.5 75 48.5 76 39.0 77 31.0 78 22.5 79 14.5 80 13.0 81 8.5 82 5.0 83 5.0 84 6.0 85 4.5 86 1.0 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.5 98 0.5 99 1.0 100 2.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.625 2 5.625 3 5.625 4 5.625 5 5.625 6 5.625 7 5.625 8 5.675 9 5.7 10-11 5.75 12-13 5.800000000000001 14-15 5.825 16-17 5.887499999999999 18-19 5.949999999999999 20-21 5.949999999999999 22-23 5.925 24-25 5.8999999999999995 26-27 5.9875 28-29 5.887499999999999 30-31 5.875 32-33 5.8999999999999995 34-35 6.0125 36-37 0.3842586458195309 38-39 0.34478185916987136 40-41 0.2918933262571315 42-43 0.2786624203821656 44-45 0.2786624203821656 46-47 0.3450106157112527 48-49 0.384870603848706 50-51 0.3185558800106185 52-53 0.3185558800106185 54-55 0.34510220334483677 56-57 0.2654632333421821 58-59 0.252190071675073 60-61 0.2787363950092912 62-63 0.2787363950092912 64-65 0.252190071675073 66-67 0.1991238550378335 68-69 0.21242697822623471 70-71 0.19946808510638298 72-73 0.30732228754676644 74-75 0.28141269171239625 76 0.26435045317220546 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 225.0 36 3.0 37 0.0 38 3.0 39 0.0 40 1.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 1.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 0.0 68 0.0 69 3.0 70 6.0 71 7.0 72 16.0 73 60.0 74 241.0 75 785.0 76 2648.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.85 #Duplication Level Percentage of deduplicated Percentage of total 1 96.43850862548692 86.65 2 2.6432943795214245 4.75 3 0.5843071786310517 1.575 4 0.1669449081803005 0.6 5 0.0 0.0 6 0.08347245409015025 0.44999999999999996 7 0.05564830272676684 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.02782415136338342 5.625 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 225 5.625 No Hit CTCGTAACGAAGGGCGCGATCTTGCTCGTGAAGGTAATGAAATTATCCGA 7 0.17500000000000002 No Hit AAATTATCCGAGCAGCTTGCAAATGGAGTCCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCG 7 0.17500000000000002 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 6 0.15 No Hit GGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTG 6 0.15 No Hit GGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.1 0.0 0.0 0.0 0.0 28 0.1 0.0 0.0 0.0 0.0 29 0.125 0.0 0.0 0.0 0.0 30 0.125 0.0 0.0 0.0 0.0 31 0.15 0.0 0.0 0.0 0.0 32 0.15 0.0 0.0 0.0 0.0 33 0.15 0.0 0.0 0.0 0.0 34 0.15 0.0 0.0 0.0 0.0 35 0.15 0.0 0.0 0.0 0.0 36 0.15 0.0 0.0 0.0 0.0 37 0.15 0.0 0.0 0.0 0.0 38 0.15 0.0 0.0 0.0 0.0 39 0.15 0.0 0.0 0.0 0.0 40 0.15 0.0 0.0 0.0 0.0 41 0.15 0.0 0.0 0.0 0.0 42 0.15 0.0 0.0 0.0 0.0 43 0.15 0.0 0.0 0.0 0.0 44 0.15 0.0 0.0 0.0 0.0 45 0.15 0.0 0.0 0.0 0.0 46 0.15 0.0 0.0 0.0 0.0 47 0.15 0.0 0.0 0.0 0.0 48 0.15 0.0 0.0 0.0 0.0 49 0.15 0.0 0.0 0.0 0.0 50 0.15 0.0 0.0 0.0 0.0 51 0.15 0.0 0.0 0.0 0.0 52 0.15 0.0 0.0 0.0 0.0 53 0.15 0.0 0.0 0.0 0.0 54 0.15 0.0 0.0 0.0 0.0 55 0.15 0.0 0.0 0.0 0.0 56 0.15 0.0 0.0 0.0 0.0 57 0.15 0.0 0.0 0.0 0.0 58 0.15 0.0 0.0 0.0 0.0 59 0.15 0.0 0.0 0.0 0.0 60 0.15 0.0 0.0 0.0 0.0 61 0.15 0.0 0.0 0.0 0.0 62 0.15 0.0 0.0 0.0 0.0 63 0.15 0.0 0.0 0.0 0.0 64 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 555456 spots for SRR11389796.sra Written 555456 spots for SRR11389796.sra Read 555456 spots for SRR11389796.sra Written 555456 spots for SRR11389796.sra Read 555456 spots for SRR11389796.sra Written 555456 spots for SRR11389796.sra Read 555456 spots for SRR11389796.sra Written 555456 spots for SRR11389796.sra Read 555456 spots for SRR11389796.sra Written 555456 spots for SRR11389796.sra Read 555456 spots for SRR11389796.sra Written 555456 spots for SRR11389796.sra Read 555456 spots for SRR11389796.sra Written 555456 spots for SRR11389796.sra Read 555462 spots for SRR11389796.sra Written 555462 spots for SRR11389796.sra Read 555456 spots for SRR11389796.sra Written 555456 spots for SRR11389796.sra Read 555456 spots for SRR11389796.sra Written 555456 spots for SRR11389796.sra Read 555456 spots for SRR11389796.sra Written 555456 spots for SRR11389796.sra Read 555456 spots for SRR11389796.sra Written 555456 spots for SRR11389796.sra Read 555456 spots for SRR11389796.sra Written 555456 spots for SRR11389796.sra Read 555456 spots for SRR11389796.sra Written 555456 spots for SRR11389796.sra Read 555456 spots for SRR11389796.sra Written 555456 spots for SRR11389796.sra Read 555456 spots for SRR11389796.sra Written 555456 spots for SRR11389796.sra Read 555456 spots for SRR11389796.sra Written 555456 spots for SRR11389796.sra Read 555456 spots for SRR11389796.sra Written 555456 spots for SRR11389796.sra Read 555456 spots for SRR11389796.sra Written 555456 spots for SRR11389796.sra Read 555456 spots for SRR11389796.sra Written 555456 spots for SRR11389796.sra SRR ids: ['SRR11389796.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_we3ontcd SRR11389796.sra spots: 11109126 blocks: [[1, 555456], [555457, 1110912], [1110913, 1666368], [1666369, 2221824], [2221825, 2777280], [2777281, 3332736], [3332737, 3888192], [3888193, 4443648], [4443649, 4999104], [4999105, 5554560], [5554561, 6110016], [6110017, 6665472], [6665473, 7220928], [7220929, 7776384], [7776385, 8331840], [8331841, 8887296], [8887297, 9442752], [9442753, 9998208], [9998209, 10553664], [10553665, 11109126]] SRR11389796 file size 2045035 SRR11389796 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389796 SRR11389796_1.fastq SRR11389796_2.fastq Input file: SRR11389796_1.fastq Paired file: SRR11389796_2.fastq trimmed: SRR11389796-trimmed-pair1.fastq, SRR11389796-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:39:26 2024 >> started Sat Dec 7 06:40:14 2024 >> done (48.106s) 11109126 read pairs processed; of these: 945 ( 0.01%) short read pairs filtered out after trimming by size control 820116 ( 7.38%) empty read pairs filtered out after trimming by size control 10288065 (92.61%) read pairs available; of these: 28183 ( 0.27%) trimmed read pairs available after processing 10259882 (99.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 891 0.01% 19 10 0.00% 20 1318 0.01% 21 16 0.00% 22 1730 0.02% 23 12 0.00% 24 2150 0.02% 25 13 0.00% 26 2289 0.02% 27 16 0.00% 28 2399 0.02% 29 12 0.00% 30 2038 0.02% 31 12 0.00% 32 2052 0.02% 33 19 0.00% 34 1937 0.02% 35 102 0.00% 36 7228 0.07% 37 71 0.00% 38 4639 0.05% 39 79 0.00% 40 2474 0.02% 41 92 0.00% 42 1293 0.01% 43 106 0.00% 44 967 0.01% 45 114 0.00% 46 337 0.00% 47 146 0.00% 48 406 0.00% 49 176 0.00% 50 387 0.00% 51 238 0.00% 52 389 0.00% 53 287 0.00% 54 378 0.00% 55 2199 0.02% 56 4584 0.04% 57 2621 0.03% 58 2219 0.02% 59 1612 0.02% 60 1413 0.01% 61 881 0.01% 62 902 0.01% 63 975 0.01% 64 1161 0.01% 65 1259 0.01% 66 1493 0.01% 67 1702 0.02% 68 1516 0.01% 69 1901 0.02% 70 2341 0.02% 71 3768 0.04% 72 13389 0.13% 73 92603 0.90% 74 677653 6.59% 75 4512254 43.86% 76 4922796 47.85% 10288065 reads passed initial QC criterion=sequence-density sequence-density=1.27 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=21 prefix-density=1.22 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=11.38 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=1.2 sequence=ATAAAACCCCTCAATGTAACACAAATACAGAGTCTTGATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAG criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=14 prefix-density=0.93 prefix-fanout=2.5 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=10.27 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.3 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC SRR11389796 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:40:44 Started mapping on | Dec 07 06:40:44 Finished on | Dec 07 06:42:25 Mapping speed, Million of reads per hour | 366.70 Number of input reads | 10288065 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 8208390 Uniquely mapped reads % | 79.79% Average mapped length | 149.83 Number of splices: Total | 2538967 Number of splices: Annotated (sjdb) | 2414646 Number of splices: GT/AG | 2506259 Number of splices: GC/AG | 27915 Number of splices: AT/AC | 494 Number of splices: Non-canonical | 4299 Mismatch rate per base, % | 1.39% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.01% Insertion average length | 1.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1231191 % of reads mapped to multiple loci | 11.97% Number of reads mapped to too many loci | 51993 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.21% % of reads unmapped: other | 2.53% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 848485 848485 848485 N_multimapping 1231191 1231191 1231191 N_noFeature 305924 7965400 378508 N_ambiguous 260843 1479 99354 UnstrandedReadsAssigned:7641623 PositiveStrandReadsAssigned:241511 NegativeStrandReadsAssigned:7730528 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389796 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389796-trimmed-pair1.fastq SRR11389796-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,288,065 reads, 8,784,183 reads pseudoaligned [quant] estimated average fragment length: 187.177 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52973 SRR11389796.ke.tsv 35125 SRR11389796.se.tsv 88098 total ==> SRR11389796.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 749.927 0 0 PNS24247 1044 857.823 4.83801 0.800198 PNS24249 1928 1741.82 22.1371 1.8032 PNS24246 1044 857.823 4.83801 0.800198 PNS24248 1044 857.823 4.83801 0.800198 PNS24244 1471 1284.82 22.3489 2.46798 PNS24243 293 117.131 0 0 KQK14069 1603 1416.82 275.759 27.6148 KQK14071 474 289.031 2.90704 1.42703 ==> SRR11389796.se.tsv <== BRADI_1g14170v3 294 BRADI_1g53295v3 5 BRADI_1g59795v3 356 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 56 BRADI_1g74790v3 99 BRADI_1g09890v3 0 BRADI_1g77505v3 87 BRADI_1g48960v3 0 SRR11389796 completed mapping pipeline successfully