Starting /dee2/code/volunteer_pipeline.sh SRR11389797 current disk space = 1545091256320 free memory = 1603279360 SRR11389797 SRAfilesize 3def033ab91a2b0410703a12115236f4 SRR11389797.sra SRR11389797.sra file validated SRR11389797 is paired end SRR11389797 is conventional basespace SRR11389797 read1 length is 70-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389797_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.034 32.0 32.0 32.0 32.0 32.0 2 31.1525 32.0 32.0 32.0 32.0 32.0 3 31.046 32.0 32.0 32.0 32.0 32.0 4 31.17975 32.0 32.0 32.0 32.0 32.0 5 31.243 32.0 32.0 32.0 32.0 32.0 6 34.142 36.0 36.0 36.0 32.0 36.0 7 34.14775 36.0 36.0 36.0 32.0 36.0 8 34.15925 36.0 36.0 36.0 32.0 36.0 9 34.31625 36.0 36.0 36.0 32.0 36.0 10-11 34.205625 36.0 36.0 36.0 32.0 36.0 12-13 34.246375 36.0 36.0 36.0 32.0 36.0 14-15 34.184 36.0 36.0 36.0 32.0 36.0 16-17 34.201625 36.0 36.0 36.0 32.0 36.0 18-19 34.088499999999996 36.0 36.0 36.0 32.0 36.0 20-21 33.987875 36.0 36.0 36.0 32.0 36.0 22-23 33.90375 36.0 36.0 36.0 32.0 36.0 24-25 33.85525 36.0 36.0 36.0 32.0 36.0 26-27 33.60975 36.0 36.0 36.0 26.5 36.0 28-29 33.616875 36.0 36.0 36.0 29.5 36.0 30-31 33.3715 36.0 36.0 36.0 21.0 36.0 32-33 33.335625 36.0 36.0 36.0 24.0 36.0 34-35 33.347 36.0 36.0 36.0 24.0 36.0 36-37 33.371875 36.0 36.0 36.0 21.0 36.0 38-39 33.20625 36.0 36.0 36.0 17.5 36.0 40-41 33.1095 36.0 36.0 36.0 17.5 36.0 42-43 33.124624999999995 36.0 36.0 36.0 17.5 36.0 44-45 33.08 36.0 36.0 36.0 14.0 36.0 46-47 32.6755 36.0 36.0 36.0 14.0 36.0 48-49 32.696875 36.0 36.0 36.0 14.0 36.0 50-51 32.69225 36.0 36.0 36.0 14.0 36.0 52-53 32.51925 36.0 32.0 36.0 14.0 36.0 54-55 32.337625 36.0 32.0 36.0 14.0 36.0 56-57 32.274874999999994 36.0 34.0 36.0 14.0 36.0 58-59 32.102000000000004 36.0 32.0 36.0 14.0 36.0 60-61 31.745875 36.0 32.0 36.0 14.0 36.0 62-63 31.789 36.0 32.0 36.0 14.0 36.0 64-65 31.644875 36.0 32.0 36.0 14.0 36.0 66-67 31.474875 36.0 32.0 36.0 14.0 36.0 68-69 31.228625 36.0 32.0 36.0 14.0 36.0 70-71 31.17475850212553 36.0 32.0 36.0 14.0 36.0 72-73 30.9766794246068 36.0 32.0 36.0 14.0 36.0 74-75 31.10722545437735 36.0 32.0 36.0 14.0 36.0 76 30.308619430241052 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 0.0 22 2.0 23 8.0 24 15.0 25 25.0 26 44.0 27 101.0 28 142.0 29 169.0 30 292.0 31 381.0 32 521.0 33 723.0 34 1003.0 35 572.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.0 10.65 11.85 34.5 2 25.75 13.05 33.050000000000004 28.15 3 26.150000000000002 18.775 20.849999999999998 34.225 4 30.525000000000002 26.375 18.4 24.7 5 26.950000000000003 29.599999999999998 20.575 22.875 6 23.14235676757568 29.54716037027771 23.44258193645234 23.867900925694272 7 18.675 22.1 36.025 23.200000000000003 8 21.05 22.5 28.825 27.625 9 23.200000000000003 19.775000000000002 29.275000000000002 27.750000000000004 10-11 24.525 29.049999999999997 21.025 25.4 12-13 24.55 22.225 25.45 27.775 14-15 24.1875 23.95 25.775 26.087500000000002 16-17 24.8625 24.7 24.3625 26.075 18-19 24.95 23.9375 24.0625 27.05 20-21 24.9 24.1875 24.55 26.3625 22-23 24.762500000000003 24.099999999999998 24.2875 26.85 24-25 24.4375 23.7125 24.9375 26.9125 26-27 24.9375 24.087500000000002 24.65 26.325 28-29 24.7875 24.075 23.9 27.237499999999997 30-31 24.55 24.1125 24.425 26.9125 32-33 24.587500000000002 24.4125 24.0375 26.9625 34-35 24.725 23.8625 24.65 26.7625 36-37 26.3625 23.9125 23.4375 26.2875 38-39 24.55 24.3125 24.5375 26.6 40-41 25.174999999999997 24.3 24.075 26.450000000000003 42-43 25.324999999999996 23.8375 23.625 27.212500000000002 44-45 24.85 24.6625 23.7875 26.700000000000003 46-47 24.9375 24.775 23.075000000000003 27.212500000000002 48-49 25.6 23.3875 23.974999999999998 27.037499999999998 50-51 24.474999999999998 23.75 24.425 27.35 52-53 25.4375 25.474999999999998 23.799999999999997 25.2875 54-55 25.3 24.1625 23.9875 26.55 56-57 24.887500000000003 23.0875 25.087500000000002 26.937499999999996 58-59 24.975 24.45 23.5375 27.037499999999998 60-61 25.275 23.549999999999997 23.375 27.800000000000004 62-63 24.5 23.9875 24.9 26.6125 64-65 25.575 24.474999999999998 24.1875 25.7625 66-67 25.2 24.7 22.8875 27.212500000000002 68-69 25.0375 23.425 23.925 27.6125 70-71 25.14064258032254 24.20302537817227 24.0780097512189 26.578322290286287 72-73 25.426706827309236 23.606927710843372 24.309738955823292 26.656626506024097 74-75 25.631530220870257 20.75122338315038 25.76378785874884 27.853458537230523 76 28.268809349890432 0.0 31.921110299488674 39.81008035062089 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.0 19 1.5 20 0.0 21 0.5 22 3.0 23 4.0 24 3.0 25 2.5 26 2.0 27 4.5 28 9.5 29 13.5 30 17.5 31 21.0 32 27.0 33 35.5 34 38.5 35 52.5 36 74.5 37 87.0 38 108.5 39 139.0 40 163.5 41 172.5 42 175.0 43 189.0 44 205.5 45 213.0 46 215.5 47 199.5 48 180.0 49 168.5 50 158.5 51 156.0 52 152.5 53 141.0 54 124.5 55 114.0 56 109.0 57 114.0 58 113.5 59 110.0 60 104.0 61 96.5 62 99.0 63 95.0 64 88.5 65 89.5 66 86.5 67 85.5 68 82.0 69 78.5 70 75.5 71 66.0 72 65.5 73 59.5 74 44.0 75 34.5 76 32.5 77 26.0 78 22.0 79 24.0 80 20.5 81 13.0 82 6.5 83 4.0 84 6.5 85 6.0 86 2.5 87 2.0 88 2.0 89 1.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 1.0 71 8.0 72 14.0 73 72.0 74 249.0 75 918.0 76 2738.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.025 0.0 0.0 36 0.0 0.0 0.025 0.0 0.0 37 0.0 0.0 0.025 0.0 0.0 38 0.0 0.0 0.025 0.0 0.0 39 0.025 0.0 0.025 0.0 0.0 40 0.025 0.0 0.025 0.0 0.0 41 0.025 0.0 0.025 0.0 0.0 42 0.025 0.0 0.025 0.0 0.0 43 0.025 0.0 0.025 0.0 0.0 44 0.025 0.0 0.025 0.0 0.0 45 0.025 0.0 0.025 0.0 0.0 46 0.025 0.0 0.025 0.0 0.0 47 0.025 0.0 0.025 0.0 0.0 48 0.025 0.0 0.025 0.0 0.0 49 0.025 0.0 0.025 0.0 0.0 50 0.025 0.0 0.025 0.0 0.0 51 0.025 0.0 0.025 0.0 0.0 52 0.025 0.0 0.025 0.0 0.0 53 0.025 0.0 0.025 0.0 0.0 54 0.025 0.0 0.025 0.0 0.0 55 0.025 0.0 0.025 0.0 0.0 56 0.025 0.0 0.025 0.0 0.0 57 0.025 0.0 0.025 0.0 0.0 58 0.025 0.0 0.025 0.0 0.0 59 0.025 0.0 0.025 0.0 0.0 60 0.025 0.0 0.025 0.0 0.0 61 0.025 0.0 0.025 0.0 0.0 62 0.025 0.0 0.025 0.0 0.0 63 0.025 0.0 0.025 0.0 0.0 64 0.025 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389797 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389797_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.868 32.0 32.0 32.0 32.0 32.0 2 30.59125 32.0 32.0 32.0 32.0 32.0 3 30.3815 32.0 32.0 32.0 32.0 32.0 4 30.3355 32.0 32.0 32.0 21.0 32.0 5 30.427 32.0 32.0 32.0 32.0 32.0 6 33.44775 36.0 36.0 36.0 21.0 36.0 7 33.47225 36.0 36.0 36.0 21.0 36.0 8 33.59 36.0 36.0 36.0 32.0 36.0 9 33.7725 36.0 36.0 36.0 32.0 36.0 10-11 33.569375 36.0 36.0 36.0 26.5 36.0 12-13 33.623000000000005 36.0 36.0 36.0 26.5 36.0 14-15 33.403625000000005 36.0 36.0 36.0 21.0 36.0 16-17 33.44499999999999 36.0 36.0 36.0 21.0 36.0 18-19 33.356875 36.0 36.0 36.0 21.0 36.0 20-21 33.221125 36.0 36.0 36.0 21.0 36.0 22-23 33.159 36.0 36.0 36.0 21.0 36.0 24-25 33.1355 36.0 36.0 36.0 17.5 36.0 26-27 33.122125 36.0 36.0 36.0 21.0 36.0 28-29 33.005125 36.0 36.0 36.0 14.0 36.0 30-31 32.870000000000005 36.0 36.0 36.0 14.0 36.0 32-33 32.915125 36.0 36.0 36.0 14.0 36.0 34-35 32.767375 36.0 36.0 36.0 14.0 36.0 36-37 32.72167919799499 36.0 36.0 36.0 14.0 36.0 38-39 32.611457227928184 36.0 36.0 36.0 14.0 36.0 40-41 32.55841062923038 36.0 36.0 36.0 14.0 36.0 42-43 32.31286036600652 36.0 36.0 36.0 14.0 36.0 44-45 32.322046651617754 36.0 34.0 36.0 14.0 36.0 46-47 32.31050915475295 36.0 34.0 36.0 14.0 36.0 48-49 32.112239779282675 36.0 32.0 36.0 14.0 36.0 50-51 32.047780285929264 36.0 32.0 36.0 14.0 36.0 52-53 31.790067720090292 36.0 32.0 36.0 14.0 36.0 54-55 31.751442187108104 36.0 32.0 36.0 14.0 36.0 56-57 31.61632093692358 36.0 32.0 36.0 14.0 36.0 58-59 31.49435524335173 36.0 32.0 36.0 14.0 36.0 60-61 31.423733065730055 36.0 32.0 36.0 14.0 36.0 62-63 31.244731560461616 36.0 32.0 36.0 14.0 36.0 64-65 31.15918213748118 36.0 32.0 36.0 14.0 36.0 66-67 31.101981936778728 36.0 32.0 36.0 14.0 36.0 68-69 30.85311088810838 36.0 29.5 36.0 14.0 36.0 70-71 30.763946154757047 36.0 27.0 36.0 14.0 36.0 72-73 30.57526975607299 36.0 29.5 36.0 14.0 36.0 74-75 30.619287948591385 36.0 27.0 36.0 14.0 36.0 76 29.203176948651645 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 1.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 3.0 16 4.0 17 5.0 18 4.0 19 6.0 20 11.0 21 13.0 22 22.0 23 31.0 24 45.0 25 60.0 26 93.0 27 121.0 28 146.0 29 205.0 30 241.0 31 355.0 32 483.0 33 618.0 34 968.0 35 550.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.03785409877162 17.523188769115066 11.531712208573577 29.907244923539732 2 30.08272750062672 21.96039107545751 26.698420656806217 21.25846076710955 3 27.06766917293233 26.691729323308273 20.626566416040102 25.6140350877193 4 29.74937343358396 32.10526315789474 16.99248120300752 21.152882205513784 5 29.273182957393484 30.6516290726817 19.49874686716792 20.576441102756892 6 23.583959899749374 32.78195488721805 20.401002506265662 23.233082706766915 7 23.032581453634084 16.641604010025063 34.48621553884712 25.839598997493734 8 23.684210526315788 21.152882205513784 24.837092731829575 30.32581453634085 9 25.31962897969416 21.484081223364253 25.169215342191027 28.02707445475057 10-11 27.50752256770311 26.930792377131397 19.420762286860583 26.140922768304915 12-13 27.417534177850243 20.870437727329737 22.87721058572683 28.83481750909319 14-15 26.487572181772535 24.240522219432588 24.14009540547326 25.13181019332162 16-17 27.005649717514125 23.86691776522285 22.38543628374137 26.741996233521657 18-19 26.901832789354756 24.102435350238512 22.784333417022346 26.211398443384383 20-21 26.21529958547921 24.230624293430473 22.82376585856048 26.730310262529834 22-23 27.317256970610398 23.39864355689525 23.08465209746295 26.199447375031397 24-25 26.28076343545957 23.982923154193873 23.216976393771972 26.519337016574585 26-27 26.664991203820055 25.270168384016085 22.631314400603166 25.43352601156069 28-29 27.089084065244666 24.79297365119197 22.785445420326223 25.332496863237143 30-31 26.515246580499436 23.679257121345213 23.252603839879534 26.552892458275817 32-33 27.054837495294265 23.7796461287489 23.177312084326765 25.98820429163007 34-35 27.20532797185222 24.05126916310631 22.19150540336768 26.551897461673786 36-37 26.19077541787106 24.154832223199698 23.24996858112354 26.404423777805707 38-39 26.771356783919597 24.35929648241206 22.248743718592966 26.62060301507538 40-41 27.40963855421687 24.460341365461847 22.23895582329317 25.891064257028113 42-43 26.72695302687767 23.78799296659131 23.762873649836724 25.722180356694295 44-45 26.06456475317171 23.904032156764227 23.27597035548298 26.75543273458108 46-47 26.989706251569167 24.579462716545315 21.930705498368063 26.500125533517448 48-49 25.41158728163881 24.4313183360563 23.677265300992836 26.47982908131205 50-51 27.414291096320483 23.998493030264974 22.07710661810875 26.510109255305792 52-53 26.6934774412467 23.853211009174313 23.212265929370364 26.24104562020862 54-55 27.51130085384229 24.04570567553993 21.98643897538925 26.45655449522853 56-57 26.37790332705587 24.48210922787194 23.540489642184557 25.599497802887633 58-59 28.18193240356829 23.55823595929137 22.36461867068727 25.895212966453073 60-61 26.730310262529834 23.954277100866726 22.57254113804798 26.74287149855546 62-63 27.68921802435045 23.634994351700765 23.082716204342915 25.593071419605874 64-65 26.883475640381715 23.669010547463586 22.689603214465095 26.757910597689605 66-67 26.49347389558233 24.585843373493976 22.778614457831324 26.142068273092367 68-69 25.800376647834273 24.005021971123668 22.937853107344633 27.25674827369743 70-71 27.17227523857358 23.53088900050226 22.476142641888497 26.82069311903566 72-73 26.78593927176515 23.056570492629458 23.45974549577926 26.697744739826128 74-75 27.294525109897428 20.540828560010656 24.12415079259358 28.040495537498334 76 28.20702402957486 0.0 32.45841035120148 39.33456561922366 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 12.0 1 6.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.5 7 2.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 2.0 15 1.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 3.5 24 6.5 25 7.5 26 6.5 27 7.5 28 8.5 29 10.5 30 19.5 31 22.5 32 23.0 33 30.0 34 34.0 35 52.5 36 78.5 37 90.0 38 93.0 39 110.0 40 124.5 41 143.0 42 166.5 43 180.0 44 183.0 45 167.0 46 169.5 47 181.0 48 180.5 49 172.5 50 158.5 51 146.0 52 130.5 53 123.0 54 118.0 55 125.5 56 137.5 57 126.5 58 117.0 59 117.5 60 117.5 61 114.0 62 117.0 63 113.0 64 102.0 65 101.5 66 110.5 67 117.0 68 108.0 69 91.0 70 90.0 71 91.0 72 76.0 73 62.5 74 51.0 75 48.0 76 46.0 77 35.0 78 22.0 79 15.5 80 15.5 81 14.5 82 13.5 83 11.0 84 7.5 85 3.0 86 1.0 87 1.0 88 1.0 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.27499999999999997 3 0.25 4 0.25 5 0.25 6 0.25 7 0.25 8 0.25 9 0.27499999999999997 10-11 0.3 12-13 0.3375 14-15 0.42500000000000004 16-17 0.43750000000000006 18-19 0.42500000000000004 20-21 0.4875 22-23 0.475 24-25 0.44999999999999996 26-27 0.525 28-29 0.375 30-31 0.3875 32-33 0.3875 34-35 0.525 36-37 0.2882205513784461 38-39 0.23812507833061788 40-41 0.12534469791927802 42-43 0.2005515166708448 44-45 0.16302984700275897 46-47 0.1003260596940055 48-49 0.2131928768497617 50-51 0.13794833207925758 52-53 0.2131928768497617 54-55 0.1254075746175069 56-57 0.10033864291985452 58-59 0.1630707476166583 60-61 0.13798294029101857 62-63 0.06271951831409935 64-65 0.10035122930255895 66-67 0.050175614651279475 68-69 0.08780732563973909 70-71 0.06274312962730581 72-73 0.05037148973680896 74-75 0.06656017039403621 76 0.07388252678241596 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 10.0 36 0.0 37 0.0 38 1.0 39 0.0 40 0.0 41 0.0 42 0.0 43 2.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 1.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 1.0 70 1.0 71 5.0 72 17.0 73 61.0 74 290.0 75 904.0 76 2707.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72347913524385 99.175 2 0.20110608345902461 0.4 3 0.025138260432378077 0.075 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025138260432378077 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 10 0.25 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 954980 spots for SRR11389797.sra Written 954980 spots for SRR11389797.sra Read 954980 spots for SRR11389797.sra Written 954980 spots for SRR11389797.sra Read 954980 spots for SRR11389797.sra Written 954980 spots for SRR11389797.sra Read 954980 spots for SRR11389797.sra Written 954980 spots for SRR11389797.sra Read 954986 spots for SRR11389797.sra Written 954986 spots for SRR11389797.sra Read 954980 spots for SRR11389797.sra Written 954980 spots for SRR11389797.sra Read 954980 spots for SRR11389797.sra Written 954980 spots for SRR11389797.sra Read 954980 spots for SRR11389797.sra Written 954980 spots for SRR11389797.sra Read 954980 spots for SRR11389797.sra Written 954980 spots for SRR11389797.sra Read 954980 spots for SRR11389797.sra Written 954980 spots for SRR11389797.sra Read 954980 spots for SRR11389797.sra Written 954980 spots for SRR11389797.sra Read 954980 spots for SRR11389797.sra Written 954980 spots for SRR11389797.sra Read 954980 spots for SRR11389797.sra Written 954980 spots for SRR11389797.sra Read 954980 spots for SRR11389797.sra Written 954980 spots for SRR11389797.sra Read 954980 spots for SRR11389797.sra Written 954980 spots for SRR11389797.sra Read 954980 spots for SRR11389797.sra Written 954980 spots for SRR11389797.sra Read 954980 spots for SRR11389797.sra Written 954980 spots for SRR11389797.sra Read 954980 spots for SRR11389797.sra Written 954980 spots for SRR11389797.sra Read 954980 spots for SRR11389797.sra Written 954980 spots for SRR11389797.sra Read 954980 spots for SRR11389797.sra Written 954980 spots for SRR11389797.sra SRR ids: ['SRR11389797.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pq12eg3g SRR11389797.sra spots: 19099606 blocks: [[1, 954980], [954981, 1909960], [1909961, 2864940], [2864941, 3819920], [3819921, 4774900], [4774901, 5729880], [5729881, 6684860], [6684861, 7639840], [7639841, 8594820], [8594821, 9549800], [9549801, 10504780], [10504781, 11459760], [11459761, 12414740], [12414741, 13369720], [13369721, 14324700], [14324701, 15279680], [15279681, 16234660], [16234661, 17189640], [17189641, 18144620], [18144621, 19099606]] SRR11389797 file size 3636180 SRR11389797 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389797 SRR11389797_1.fastq SRR11389797_2.fastq Input file: SRR11389797_1.fastq Paired file: SRR11389797_2.fastq trimmed: SRR11389797-trimmed-pair1.fastq, SRR11389797-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:44:36 2024 >> started Sat Dec 7 06:44:51 2024 >> done (14.683s) 19099606 read pairs processed; of these: 666 ( 0.00%) short read pairs filtered out after trimming by size control 7931 ( 0.04%) empty read pairs filtered out after trimming by size control 19091009 (99.95%) read pairs available; of these: 9729 ( 0.05%) trimmed read pairs available after processing 19081280 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 7 0.00% 20 8 0.00% 21 8 0.00% 22 13 0.00% 23 5 0.00% 24 10 0.00% 25 8 0.00% 26 13 0.00% 27 4 0.00% 28 13 0.00% 29 7 0.00% 30 11 0.00% 31 15 0.00% 32 10 0.00% 33 9 0.00% 34 14 0.00% 35 239 0.00% 36 201 0.00% 37 214 0.00% 38 244 0.00% 39 226 0.00% 40 248 0.00% 41 277 0.00% 42 262 0.00% 43 313 0.00% 44 304 0.00% 45 327 0.00% 46 330 0.00% 47 356 0.00% 48 345 0.00% 49 363 0.00% 50 405 0.00% 51 428 0.00% 52 443 0.00% 53 465 0.00% 54 464 0.00% 55 598 0.00% 56 674 0.00% 57 731 0.00% 58 739 0.00% 59 862 0.00% 60 879 0.00% 61 868 0.00% 62 989 0.01% 63 1099 0.01% 64 1090 0.01% 65 1232 0.01% 66 1339 0.01% 67 1580 0.01% 68 1449 0.01% 69 1665 0.01% 70 2488 0.01% 71 3607 0.02% 72 14855 0.08% 73 151360 0.79% 74 1328898 6.96% 75 8352445 43.75% 76 9214950 48.27% 19091009 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=6.30 fanout-score-rank=11 prefix-density=0.24 prefix-fanout=3.9 sequence=CTTCACCTCCTCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=185.75 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=21.8 sequence=CCGCCGCCGCCA criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=5.37 fanout-score-rank=15 prefix-density=0.23 prefix-fanout=4.0 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=246.30 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=24.7 sequence=CCGCCGCCGCCA SRR11389797 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:45:47 Started mapping on | Dec 07 06:45:47 Finished on | Dec 07 06:47:20 Mapping speed, Million of reads per hour | 739.01 Number of input reads | 19091009 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 17042499 Uniquely mapped reads % | 89.27% Average mapped length | 149.93 Number of splices: Total | 7417962 Number of splices: Annotated (sjdb) | 7100092 Number of splices: GT/AG | 7320309 Number of splices: GC/AG | 87201 Number of splices: AT/AC | 3810 Number of splices: Non-canonical | 6642 Mismatch rate per base, % | 1.25% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 659249 % of reads mapped to multiple loci | 3.45% Number of reads mapped to too many loci | 43777 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.03% % of reads unmapped: other | 1.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1389267 1389267 1389267 N_multimapping 659249 659249 659249 N_noFeature 587728 16576978 751225 N_ambiguous 383486 2353 85024 UnstrandedReadsAssigned:16071285 PositiveStrandReadsAssigned:463168 NegativeStrandReadsAssigned:16206250 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389797 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389797-trimmed-pair1.fastq SRR11389797-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,091,009 reads, 16,865,552 reads pseudoaligned [quant] estimated average fragment length: 223.261 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52973 SRR11389797.ke.tsv 35125 SRR11389797.se.tsv 88098 total ==> SRR11389797.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 713.938 0 0 PNS24247 1044 821.739 31.1407 3.11731 PNS24249 1928 1705.74 201.091 9.69762 PNS24246 1044 821.739 31.1407 3.11731 PNS24248 1044 821.739 31.1407 3.11731 PNS24244 1471 1248.74 54.4869 3.58927 PNS24243 293 90.9452 0 0 KQK14069 1603 1380.74 3264.03 194.459 KQK14071 474 254.319 299.88 96.9959 ==> SRR11389797.se.tsv <== BRADI_1g14170v3 3899 BRADI_1g53295v3 669 BRADI_1g59795v3 409 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 804 BRADI_1g74790v3 353 BRADI_1g09890v3 1 BRADI_1g77505v3 361 BRADI_1g48960v3 0 SRR11389797 completed mapping pipeline successfully