Starting /dee2/code/volunteer_pipeline.sh SRR11389798 current disk space = 1544996974592 free memory = 1600374828 SRR11389798 SRAfilesize 2aae75a8bdabca52fb0054227c5a37b9 SRR11389798.sra SRR11389798.sra file validated SRR11389798 is paired end SRR11389798 is conventional basespace SRR11389798 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389798_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.904 32.0 32.0 32.0 32.0 32.0 2 29.86975 32.0 32.0 32.0 32.0 32.0 3 29.71075 32.0 32.0 32.0 21.0 32.0 4 29.8565 32.0 32.0 32.0 32.0 32.0 5 29.91575 32.0 32.0 32.0 32.0 32.0 6 32.79375 36.0 36.0 36.0 21.0 36.0 7 32.747 36.0 36.0 36.0 21.0 36.0 8 32.642 36.0 36.0 36.0 21.0 36.0 9 32.867 36.0 36.0 36.0 21.0 36.0 10-11 32.762625 36.0 36.0 36.0 21.0 36.0 12-13 32.927375 36.0 36.0 36.0 21.0 36.0 14-15 32.88475 36.0 36.0 36.0 21.0 36.0 16-17 32.81375 36.0 36.0 36.0 21.0 36.0 18-19 32.883750000000006 36.0 36.0 36.0 21.0 36.0 20-21 32.750125 36.0 36.0 36.0 21.0 36.0 22-23 32.6395 36.0 36.0 36.0 17.5 36.0 24-25 32.50275 36.0 36.0 36.0 14.0 36.0 26-27 32.351625 36.0 36.0 36.0 14.0 36.0 28-29 32.369375000000005 36.0 36.0 36.0 14.0 36.0 30-31 32.237625 36.0 36.0 36.0 14.0 36.0 32-33 32.223749999999995 36.0 36.0 36.0 14.0 36.0 34-35 32.179874999999996 36.0 36.0 36.0 14.0 36.0 36-37 33.58042965679853 36.0 36.0 36.0 29.5 36.0 38-39 33.40626766138905 36.0 36.0 36.0 21.0 36.0 40-41 33.26012423375674 36.0 36.0 36.0 21.0 36.0 42-43 33.32742314477736 36.0 36.0 36.0 24.0 36.0 44-45 33.28277399056109 36.0 36.0 36.0 21.0 36.0 46-47 33.113398007341374 36.0 36.0 36.0 17.5 36.0 48-49 32.89446775039329 36.0 36.0 36.0 14.0 36.0 50-51 32.88791295228107 36.0 36.0 36.0 14.0 36.0 52-53 32.837572102779234 36.0 36.0 36.0 14.0 36.0 54-55 32.610120608285264 36.0 36.0 36.0 14.0 36.0 56-57 32.37952281069743 36.0 32.0 36.0 14.0 36.0 58-59 32.40351337178815 36.0 34.0 36.0 14.0 36.0 60-61 32.141714735186156 36.0 32.0 36.0 14.0 36.0 62-63 32.31785995279307 36.0 32.0 36.0 14.0 36.0 64-65 32.02896682657453 36.0 32.0 36.0 14.0 36.0 66-67 31.559433219627394 36.0 32.0 36.0 14.0 36.0 68-69 31.47314903437018 36.0 32.0 36.0 14.0 36.0 70-71 31.498171639657645 36.0 32.0 36.0 14.0 36.0 72-73 31.358579565030126 36.0 32.0 36.0 14.0 36.0 74-75 31.220437628278674 36.0 32.0 36.0 14.0 36.0 76 30.745544178991278 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 183.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 10.0 24 17.0 25 25.0 26 36.0 27 73.0 28 121.0 29 156.0 30 204.0 31 334.0 32 469.0 33 677.0 34 1071.0 35 621.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.76499869007073 12.260937909352895 11.160597327744302 35.81346607283207 2 27.06313859051611 12.2347393240765 33.53418915378569 27.167932931621692 3 24.941053183128112 20.434896515588157 21.7972229499607 32.82682735132303 4 29.709195703432012 25.019648938957296 19.858527639507468 25.41262771810322 5 28.294472098506677 29.578202777050038 21.74482577940791 20.382499345035367 6 24.220183486238533 32.37221494102228 23.25032765399738 20.157273918741808 7 18.470002619858526 22.294996070212207 37.752161383285305 21.482839926643962 8 18.99397432538643 23.369138066544405 30.678543358658633 26.958344249410533 9 20.85407388001048 21.37804558553838 32.40764998690071 25.360230547550433 10-11 22.910662824207492 31.20251506418653 22.66177626408174 23.225045847524235 12-13 24.548074403982184 23.906209064710506 25.80560649724915 25.740110034058162 14-15 23.51323028556458 25.674613570867173 25.753209326696357 25.05894681687189 16-17 23.906209064710506 25.176840450615668 24.993450353680903 25.923500130992927 18-19 23.72281896777574 24.665968037725964 25.281634791721245 26.32957820277705 20-21 23.99790411317789 25.58291852239979 25.242336913806657 25.176840450615668 22-23 24.299187843856433 25.03274823159549 24.993450353680903 25.674613570867173 24-25 24.90175530521352 24.52187581870579 24.15509562483626 26.421273251244433 26-27 24.15509562483626 24.967251768404505 24.443280062876603 26.434372543882628 28-29 25.556719937123397 25.360230547550433 24.40398218496201 24.67906733036416 30-31 24.639769452449567 25.189939743253863 24.84935813466073 25.320932669635837 32-33 23.72281896777574 25.425727010741422 24.77076237883154 26.0806916426513 34-35 24.4825779407912 25.451925596017816 24.233691380665444 25.831805082525545 36-37 24.639769452449567 25.11134398742468 24.40398218496201 25.84490437516374 38-39 25.53386610769029 24.027250098257564 24.878815668806496 25.560068125245643 40-41 25.226051631503076 24.230114008648933 24.767396147293933 25.776438212554055 42-43 24.734565473849784 23.699043124918077 24.288897627474114 27.277493773758028 44-45 24.54116413214473 24.16098584163608 25.170424750917668 26.12742527530152 46-47 25.353959098059782 24.659150498164657 23.230204509701103 26.75668589407446 48-49 24.252753015207134 23.715259570005244 24.606712113266912 27.425275301520713 50-51 24.619821709491347 23.335081279496592 25.32773990561091 26.717357105401152 52-53 25.48505506030414 23.859465128474042 23.217094913476664 27.43838489774515 54-55 24.43628736234924 24.50183534347142 23.93812270582066 27.12375458835868 56-57 23.833245936025172 24.868904037755637 24.449396958573676 26.848453067645515 58-59 24.646040901940218 24.50183534347142 24.50183534347142 26.35028841111694 60-61 24.200314630309386 23.072889355007867 25.052438384897748 27.674357629785 62-63 25.268817204301076 23.183844741673223 25.635982166273273 25.911355887752425 64-65 25.003279548734092 22.7994227994228 24.872097599370328 27.32520005247278 66-67 25.61007609551299 23.458409866176858 23.917606927315667 27.013907110994488 68-69 25.449534059587876 22.404515028218928 23.9270245439034 28.218926368289804 70-71 24.306924188674287 23.8207857049008 24.96386808566548 26.908422020759424 72-73 25.32347504621072 23.356218642725114 24.75574333245313 26.56456297861104 74-75 25.13494809688581 21.439446366782004 25.494809688581316 27.930795847750865 76 28.289723170269244 0.0 34.73644292756921 36.973833902161545 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 184.0 1 92.5 2 1.0 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 4.5 19 8.0 20 9.5 21 11.5 22 16.5 23 19.0 24 15.0 25 14.0 26 17.5 27 27.5 28 35.0 29 35.0 30 34.0 31 38.0 32 44.0 33 42.0 34 47.0 35 66.5 36 93.5 37 110.0 38 108.0 39 116.0 40 128.5 41 123.0 42 123.0 43 151.5 44 167.5 45 169.5 46 175.5 47 164.0 48 146.5 49 140.0 50 135.0 51 123.5 52 109.5 53 105.0 54 105.5 55 114.0 56 137.0 57 143.0 58 135.5 59 137.0 60 144.0 61 137.0 62 127.5 63 111.5 64 100.5 65 87.5 66 73.0 67 73.5 68 75.5 69 82.0 70 64.5 71 47.0 72 43.0 73 43.0 74 42.0 75 35.0 76 27.0 77 19.5 78 14.0 79 7.5 80 7.0 81 6.5 82 5.0 83 5.0 84 4.0 85 3.5 86 2.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.575 2 4.575 3 4.575 4 4.575 5 4.575 6 4.625 7 4.575 8 4.575 9 4.575 10-11 4.575 12-13 4.575 14-15 4.575 16-17 4.575 18-19 4.575 20-21 4.575 22-23 4.575 24-25 4.575 26-27 4.575 28-29 4.575 30-31 4.575 32-33 4.575 34-35 4.575 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 183.0 36 0.0 37 0.0 38 1.0 39 0.0 40 1.0 41 0.0 42 1.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 1.0 64 1.0 65 0.0 66 0.0 67 1.0 68 1.0 69 2.0 70 3.0 71 7.0 72 20.0 73 50.0 74 229.0 75 861.0 76 2637.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 96.1730449251248 86.7 2 2.7176927343316692 4.9 3 0.6655574043261231 1.7999999999999998 4 0.24958402662229617 0.8999999999999999 5 0.055463117027176934 0.25 6 0.08319467554076539 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027731558513588467 0.42500000000000004 >50 0.0 0.0 >100 0.027731558513588467 4.575 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 183 4.575 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 17 0.42500000000000004 No Hit CGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATTTC 6 0.15 No Hit CCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATTT 6 0.15 No Hit GTCAGGGTTCAAATGTACATATGCTCCTCGAGCCCATGTCGGTACATTCA 6 0.15 No Hit GTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTTCTTCACCT 5 0.125 No Hit CGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.075 0.0 0.0 0.0 0.0 28 0.075 0.0 0.0 0.0 0.0 29 0.075 0.0 0.0 0.0 0.0 30 0.075 0.0 0.0 0.0 0.0 31 0.1 0.0 0.0 0.0 0.0 32 0.1 0.0 0.0 0.0 0.0 33 0.125 0.0 0.0 0.0 0.0 34 0.125 0.0 0.0 0.0 0.0 35 0.125 0.0 0.0 0.0 0.0 36 0.125 0.0 0.0 0.0 0.0 37 0.125 0.0 0.0 0.0 0.0 38 0.125 0.0 0.0 0.0 0.0 39 0.125 0.0 0.0 0.0 0.0 40 0.125 0.0 0.0 0.0 0.0 41 0.125 0.0 0.0 0.0 0.0 42 0.125 0.0 0.0 0.0 0.0 43 0.125 0.0 0.0 0.0 0.0 44 0.125 0.0 0.0 0.0 0.0 45 0.125 0.0 0.0 0.0 0.0 46 0.125 0.0 0.0 0.0 0.0 47 0.125 0.0 0.0 0.0 0.0 48 0.125 0.0 0.0 0.0 0.0 49 0.125 0.0 0.0 0.0 0.0 50 0.125 0.0 0.0 0.0 0.0 51 0.125 0.0 0.0 0.0 0.0 52 0.125 0.0 0.0 0.0 0.0 53 0.125 0.0 0.0 0.0 0.0 54 0.125 0.0 0.0 0.0 0.0 55 0.125 0.0 0.0 0.0 0.0 56 0.125 0.0 0.0 0.0 0.0 57 0.125 0.0 0.0 0.0 0.0 58 0.125 0.0 0.0 0.0 0.0 59 0.125 0.0 0.0 0.0 0.0 60 0.125 0.0 0.0 0.0 0.0 61 0.125 0.0 0.0 0.0 0.0 62 0.125 0.0 0.0 0.0 0.0 63 0.125 0.0 0.0 0.0 0.0 64 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTCCA 15 0.0021074836 69.5974 50 CCTCCAG 15 0.0021074836 69.5974 51 CAGCTCC 20 0.0065885717 52.198055 55 TCCTTCT 20 0.0065885717 52.198055 38 CCAGCTC 20 0.0065885717 52.198055 54 CTCCTCC 20 0.0065885717 52.198055 49 CTCCAGC 20 0.0065885717 52.198055 52 TCCAGCT 20 0.0065885717 52.198055 53 CCTCCTC 20 0.0065885717 52.198055 48 CCTTCTT 20 0.0065885717 52.198055 39 GTCGAAG 35 0.0011381843 39.769943 1 >>END_MODULE SRR11389798 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389798_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.4785 32.0 32.0 32.0 21.0 32.0 2 29.1825 32.0 32.0 32.0 14.0 32.0 3 29.06 32.0 32.0 32.0 14.0 32.0 4 29.137 32.0 32.0 32.0 14.0 32.0 5 29.075 32.0 32.0 32.0 14.0 32.0 6 31.98275 36.0 36.0 36.0 14.0 36.0 7 32.2415 36.0 36.0 36.0 14.0 36.0 8 32.18525 36.0 36.0 36.0 14.0 36.0 9 32.0585 36.0 36.0 36.0 14.0 36.0 10-11 31.94725 36.0 36.0 36.0 14.0 36.0 12-13 32.162625 36.0 36.0 36.0 14.0 36.0 14-15 31.948 36.0 36.0 36.0 14.0 36.0 16-17 32.019625 36.0 36.0 36.0 14.0 36.0 18-19 31.903375 36.0 36.0 36.0 14.0 36.0 20-21 31.824375 36.0 36.0 36.0 14.0 36.0 22-23 31.828625 36.0 36.0 36.0 14.0 36.0 24-25 31.69225 36.0 36.0 36.0 14.0 36.0 26-27 31.679125 36.0 36.0 36.0 14.0 36.0 28-29 31.547 36.0 34.0 36.0 14.0 36.0 30-31 31.481749999999998 36.0 34.0 36.0 14.0 36.0 32-33 31.468 36.0 36.0 36.0 14.0 36.0 34-35 31.34675 36.0 32.0 36.0 14.0 36.0 36-37 32.66583508403362 36.0 36.0 36.0 14.0 36.0 38-39 32.684348739495796 36.0 36.0 36.0 14.0 36.0 40-41 32.63860583141846 36.0 36.0 36.0 14.0 36.0 42-43 32.58754674610658 36.0 36.0 36.0 14.0 36.0 44-45 32.169994745139256 36.0 34.0 36.0 14.0 36.0 46-47 32.23660010509721 36.0 34.0 36.0 14.0 36.0 48-49 32.149106673673145 36.0 32.0 36.0 14.0 36.0 50-51 32.08079348397267 36.0 32.0 36.0 14.0 36.0 52-53 31.91852825229961 36.0 32.0 36.0 14.0 36.0 54-55 31.721024967148487 36.0 32.0 36.0 14.0 36.0 56-57 31.713403416557163 36.0 32.0 36.0 14.0 36.0 58-59 31.63850197109067 36.0 32.0 36.0 14.0 36.0 60-61 31.379369250985548 36.0 32.0 36.0 14.0 36.0 62-63 31.25663600525624 36.0 32.0 36.0 14.0 36.0 64-65 30.98396607996399 36.0 32.0 36.0 14.0 36.0 66-67 31.168025243229028 36.0 32.0 36.0 14.0 36.0 68-69 30.82084336869184 36.0 29.5 36.0 14.0 36.0 70-71 30.81761486323647 36.0 29.5 36.0 14.0 36.0 72-73 30.584919752725835 36.0 27.0 36.0 14.0 36.0 74-75 30.471488871822146 36.0 27.0 36.0 14.0 36.0 76 29.504455637349864 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 192.0 3 0.0 4 0.0 5 3.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 3.0 16 5.0 17 6.0 18 8.0 19 7.0 20 10.0 21 10.0 22 20.0 23 30.0 24 40.0 25 54.0 26 84.0 27 103.0 28 149.0 29 204.0 30 247.0 31 301.0 32 470.0 33 625.0 34 862.0 35 564.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.081932773109244 19.485294117647058 10.399159663865547 34.03361344537815 2 31.092436974789916 21.139705882352942 28.04621848739496 19.721638655462183 3 24.080882352941178 25.49894957983193 23.293067226890756 27.127100840336134 4 29.884453781512605 29.543067226890756 17.17436974789916 23.39810924369748 5 29.20168067226891 31.013655462184875 19.93172268907563 19.852941176470587 6 22.846638655462183 35.241596638655466 19.774159663865547 22.137605042016805 7 23.79201680672269 15.519957983193278 33.71848739495798 26.96953781512605 8 23.319327731092436 20.535714285714285 24.711134453781515 31.433823529411764 9 25.11823436678928 20.599054125065685 25.538623226484496 28.744088281660535 10-11 27.266754270696453 26.517739816031536 19.513797634691198 26.701708278580817 12-13 27.608409986859396 20.43363994743758 22.930354796320632 29.027595269382388 14-15 26.249342451341402 23.68490268279853 23.855865334034718 26.209889531825354 16-17 27.39347711730668 22.540768016833248 23.290373487638085 26.77538137822199 18-19 26.71575072311333 23.5734946095188 22.705758611622404 27.004996055745462 20-21 27.098132070507763 23.848987108655617 22.61247040252565 26.44041041831097 22-23 28.084714548802946 24.296237832149433 21.58642462509866 26.032622993948962 24-25 27.09456793371038 24.003682756806523 22.793634091805867 26.10811521767723 26-27 26.943823181160376 24.733587685830813 23.14169188264702 25.180897250361795 28-29 27.570339205890086 23.50775703392059 22.35077570339206 26.571128056797267 30-31 26.873520904549043 24.52011569813305 22.455955824349196 26.15040757296871 32-33 25.887457270575858 24.45437812253484 23.704969760715226 25.95319484617407 34-35 26.81578947368421 24.07894736842105 22.82894736842105 26.276315789473685 36-37 27.68643956333026 23.76693410495857 21.623043535446534 26.923582796264633 38-39 26.249342451341402 25.144660704892164 22.435560231457128 26.17043661230931 40-41 27.784352399737017 23.063773833004603 22.143326758711375 27.00854700854701 42-43 26.805208470340652 24.358805734578457 22.372747599631722 26.46323819544916 44-45 27.80994998683864 24.335351408265332 22.861279284022114 24.993419320873915 46-47 27.4796106287819 24.99342278347803 21.665351223362272 25.861615364377794 48-49 27.37202263455718 23.64784840110541 22.831951572575342 26.148177391762072 50-51 26.684210526315788 24.35526315789474 22.88157894736842 26.07894736842105 52-53 28.214238715620475 23.77944466377155 22.56875904724306 25.437557573364916 54-55 26.479873717442775 24.6514075243357 22.980794527755855 25.887924230465664 56-57 26.624572480926073 24.414627729544858 23.414890818205734 25.545908971323332 58-59 27.46414001842348 24.161073825503358 22.687195683642585 25.687590472430582 60-61 28.27631578947368 22.64473684210526 22.736842105263158 26.342105263157894 62-63 28.13733228097869 23.71744277821626 23.53328071560116 24.611944225203892 64-65 28.603396077398973 23.785704883506646 21.403185467947875 26.207713571146506 66-67 26.56928543229372 24.66113962363469 22.7003553099092 26.069219634162387 68-69 26.27419992097985 24.957197418675094 22.507572764388254 26.2610298959568 70-71 27.195990503824845 23.252439989448696 23.78000527565286 25.771564231073597 72-73 26.86290108724476 23.50835322195704 22.75258552108194 26.876160169716258 74-75 26.308404658341516 21.537813946962256 24.65272905850989 27.501052336186333 76 29.79053529868115 0.0 32.311869666408064 37.897595034910786 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 192.0 1 97.0 2 1.5 3 2.0 4 2.5 5 1.5 6 1.5 7 1.5 8 1.0 9 0.5 10 0.5 11 2.5 12 3.5 13 1.5 14 0.0 15 1.0 16 1.0 17 0.5 18 7.0 19 9.5 20 8.5 21 14.0 22 15.5 23 9.5 24 5.0 25 5.5 26 8.5 27 14.5 28 19.0 29 20.5 30 26.0 31 27.5 32 28.5 33 32.0 34 36.5 35 45.5 36 58.0 37 73.0 38 88.0 39 92.0 40 94.5 41 103.0 42 106.0 43 126.0 44 141.0 45 127.0 46 112.5 47 139.0 48 154.0 49 144.0 50 143.0 51 133.5 52 122.0 53 120.0 54 132.0 55 128.0 56 132.5 57 136.5 58 128.0 59 137.0 60 154.0 61 155.5 62 143.5 63 146.5 64 135.5 65 120.0 66 114.5 67 105.0 68 95.0 69 82.0 70 76.5 71 70.5 72 62.5 73 57.5 74 51.0 75 49.5 76 45.0 77 27.0 78 17.0 79 15.5 80 8.5 81 6.5 82 6.0 83 2.5 84 1.5 85 1.5 86 1.5 87 1.0 88 0.5 89 0.5 90 0.5 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.8 2 4.8 3 4.8 4 4.8 5 4.8 6 4.8 7 4.8 8 4.8 9 4.8500000000000005 10-11 4.875 12-13 4.875 14-15 4.95 16-17 4.95 18-19 4.925 20-21 4.9750000000000005 22-23 4.9750000000000005 24-25 4.9625 26-27 4.987500000000001 28-29 4.925 30-31 4.925 32-33 4.925 34-35 5.0 36-37 0.17069327731092437 38-39 0.15756302521008403 40-41 0.13131976362442546 42-43 0.13135426244581636 44-45 0.18392012611665792 46-47 0.13137151865475566 48-49 0.17078297425118233 50-51 0.1576458223857068 52-53 0.1445466491458607 54-55 0.10512483574244415 56-57 0.10512483574244415 58-59 0.1445466491458607 60-61 0.1314060446780552 62-63 0.10512483574244415 64-65 0.13145786775338505 66-67 0.09203260583749671 68-69 0.1315270288044193 70-71 0.09223876663592041 72-73 0.0794912559618442 74-75 0.08411608019066312 76 0.1162340178225494 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 192.0 36 0.0 37 0.0 38 0.0 39 0.0 40 1.0 41 0.0 42 1.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 1.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 1.0 64 1.0 65 0.0 66 0.0 67 1.0 68 1.0 69 2.0 70 9.0 71 6.0 72 20.0 73 58.0 74 279.0 75 846.0 76 2581.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.625 #Duplication Level Percentage of deduplicated Percentage of total 1 97.13506139154161 89.0 2 2.155525238744884 3.95 3 0.3819918144611187 1.05 4 0.21828103683492497 0.8 5 0.054570259208731244 0.25 6 0.027285129604365622 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.027285129604365622 4.8 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 192 4.8 No Hit GGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACA 6 0.15 No Hit GAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGA 5 0.125 No Hit AGCTAATCGAGTGGCTTTAGAAGCCTGTGTACAAGCTCGTAACGAAGGGCGCGATCTTGCTCGTGAAGGTAATGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.075 0.0 0.0 0.0 0.0 36 0.075 0.0 0.0 0.0 0.0 37 0.075 0.0 0.0 0.0 0.0 38 0.075 0.0 0.0 0.0 0.0 39 0.075 0.0 0.0 0.0 0.0 40 0.075 0.0 0.0 0.0 0.0 41 0.075 0.0 0.0 0.0 0.0 42 0.075 0.0 0.0 0.0 0.0 43 0.075 0.0 0.0 0.0 0.0 44 0.075 0.0 0.0 0.0 0.0 45 0.075 0.0 0.0 0.0 0.0 46 0.075 0.0 0.0 0.0 0.0 47 0.075 0.0 0.0 0.0 0.0 48 0.075 0.0 0.0 0.0 0.0 49 0.075 0.0 0.0 0.0 0.0 50 0.075 0.0 0.0 0.0 0.0 51 0.075 0.0 0.0 0.0 0.0 52 0.075 0.0 0.0 0.0 0.0 53 0.075 0.0 0.0 0.0 0.0 54 0.075 0.0 0.0 0.0 0.0 55 0.075 0.0 0.0 0.0 0.0 56 0.075 0.0 0.0 0.0 0.0 57 0.075 0.0 0.0 0.0 0.0 58 0.075 0.0 0.0 0.0 0.0 59 0.075 0.0 0.0 0.0 0.0 60 0.075 0.0 0.0 0.0 0.0 61 0.075 0.0 0.0 0.0 0.0 62 0.075 0.0 0.0 0.0 0.0 63 0.075 0.0 0.0 0.0 0.0 64 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 565638 spots for SRR11389798.sra Written 565638 spots for SRR11389798.sra Read 565638 spots for SRR11389798.sra Read 565638 spots for SRR11389798.sra Written 565638 spots for SRR11389798.sra Read 565652 spots for SRR11389798.sra Written 565652 spots for SRR11389798.sra Read 565638 spots for SRR11389798.sra Written 565638 spots for SRR11389798.sra Written 565638 spots for SRR11389798.sra Read 565638 spots for SRR11389798.sra Read 565638 spots for SRR11389798.sra Written 565638 spots for SRR11389798.sra Written 565638 spots for SRR11389798.sra Read 565638 spots for SRR11389798.sra Written 565638 spots for SRR11389798.sra Read 565638 spots for SRR11389798.sra Written 565638 spots for SRR11389798.sra Read 565638 spots for SRR11389798.sra Written 565638 spots for SRR11389798.sra Read 565638 spots for SRR11389798.sra Written 565638 spots for SRR11389798.sra Read 565638 spots for SRR11389798.sra Written 565638 spots for SRR11389798.sra Read 565638 spots for SRR11389798.sra Written 565638 spots for SRR11389798.sra Read 565638 spots for SRR11389798.sra Written 565638 spots for SRR11389798.sra Read 565638 spots for SRR11389798.sra Written 565638 spots for SRR11389798.sra Read 565638 spots for SRR11389798.sra Written 565638 spots for SRR11389798.sra Read 565638 spots for SRR11389798.sra Written 565638 spots for SRR11389798.sra Read 565638 spots for SRR11389798.sra Written 565638 spots for SRR11389798.sra Read 565638 spots for SRR11389798.sra Written 565638 spots for SRR11389798.sra Read 565638 spots for SRR11389798.sra Written 565638 spots for SRR11389798.sra SRR ids: ['SRR11389798.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__xaqtaw9 SRR11389798.sra spots: 11312774 blocks: [[1, 565638], [565639, 1131276], [1131277, 1696914], [1696915, 2262552], [2262553, 2828190], [2828191, 3393828], [3393829, 3959466], [3959467, 4525104], [4525105, 5090742], [5090743, 5656380], [5656381, 6222018], [6222019, 6787656], [6787657, 7353294], [7353295, 7918932], [7918933, 8484570], [8484571, 9050208], [9050209, 9615846], [9615847, 10181484], [10181485, 10747122], [10747123, 11312774]] SRR11389798 file size 2083057 SRR11389798 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389798 SRR11389798_1.fastq SRR11389798_2.fastq Input file: SRR11389798_1.fastq Paired file: SRR11389798_2.fastq trimmed: SRR11389798-trimmed-pair1.fastq, SRR11389798-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:48:01 2024 >> started Sat Dec 7 06:48:11 2024 >> done (9.632s) 11312774 read pairs processed; of these: 1043 ( 0.01%) short read pairs filtered out after trimming by size control 830968 ( 7.35%) empty read pairs filtered out after trimming by size control 10480763 (92.65%) read pairs available; of these: 22536 ( 0.22%) trimmed read pairs available after processing 10458227 (99.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 964 0.01% 19 17 0.00% 20 1275 0.01% 21 16 0.00% 22 1443 0.01% 23 11 0.00% 24 1819 0.02% 25 18 0.00% 26 2010 0.02% 27 18 0.00% 28 1907 0.02% 29 17 0.00% 30 1445 0.01% 31 17 0.00% 32 1354 0.01% 33 12 0.00% 34 1268 0.01% 35 91 0.00% 36 6290 0.06% 37 94 0.00% 38 3591 0.03% 39 77 0.00% 40 1955 0.02% 41 81 0.00% 42 1024 0.01% 43 99 0.00% 44 677 0.01% 45 89 0.00% 46 284 0.00% 47 138 0.00% 48 302 0.00% 49 165 0.00% 50 273 0.00% 51 201 0.00% 52 271 0.00% 53 202 0.00% 54 705 0.01% 55 2588 0.02% 56 3713 0.04% 57 2208 0.02% 58 1405 0.01% 59 1237 0.01% 60 1025 0.01% 61 630 0.01% 62 678 0.01% 63 717 0.01% 64 838 0.01% 65 1013 0.01% 66 1068 0.01% 67 1289 0.01% 68 1194 0.01% 69 1353 0.01% 70 1823 0.02% 71 2990 0.03% 72 14793 0.14% 73 98922 0.94% 74 698570 6.67% 75 4551105 43.42% 76 5061384 48.29% 10480763 reads passed initial QC criterion=sequence-density sequence-density=1.14 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=25 prefix-density=1.07 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.23 sequence-density-rank=17 fanout-score=8.10 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=2.1 sequence=CCGAACATGGGAAGCTTCCACAT criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=15 prefix-density=0.87 prefix-fanout=2.8 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=10.93 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.1 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC SRR11389798 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:48:42 Started mapping on | Dec 07 06:48:42 Finished on | Dec 07 06:50:53 Mapping speed, Million of reads per hour | 288.02 Number of input reads | 10480763 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 8470954 Uniquely mapped reads % | 80.82% Average mapped length | 149.95 Number of splices: Total | 2818938 Number of splices: Annotated (sjdb) | 2694930 Number of splices: GT/AG | 2783597 Number of splices: GC/AG | 30849 Number of splices: AT/AC | 451 Number of splices: Non-canonical | 4041 Mismatch rate per base, % | 1.31% Deletion rate per base | 0.01% Deletion average length | 1.68 Insertion rate per base | 0.00% Insertion average length | 1.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1244936 % of reads mapped to multiple loci | 11.88% Number of reads mapped to too many loci | 46489 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.87% % of reads unmapped: other | 1.99% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 764878 764878 764878 N_multimapping 1244936 1244936 1244936 N_noFeature 255549 8240009 327547 N_ambiguous 295949 1310 150234 UnstrandedReadsAssigned:7919456 PositiveStrandReadsAssigned:229635 NegativeStrandReadsAssigned:7993173 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389798 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389798-trimmed-pair1.fastq SRR11389798-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,480,763 reads, 9,198,858 reads pseudoaligned [quant] estimated average fragment length: 192.911 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,047 rounds 52973 SRR11389798.ke.tsv 35125 SRR11389798.se.tsv 88098 total ==> SRR11389798.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 744.149 0 0 PNS24247 1044 852.089 9.16716 1.4597 PNS24249 1928 1736.09 31.2311 2.44078 PNS24246 1044 852.089 9.16716 1.4597 PNS24248 1044 852.089 9.16716 1.4597 PNS24244 1471 1279.09 18.2674 1.93771 PNS24243 293 112.141 0 0 KQK14069 1603 1411.09 159.692 15.3547 KQK14071 474 283.221 0 0 ==> SRR11389798.se.tsv <== BRADI_1g14170v3 169 BRADI_1g53295v3 0 BRADI_1g59795v3 247 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 119 BRADI_1g74790v3 71 BRADI_1g09890v3 0 BRADI_1g77505v3 70 BRADI_1g48960v3 0 SRR11389798 completed mapping pipeline successfully