Starting /dee2/code/volunteer_pipeline.sh SRR11389799 current disk space = 1544976797696 free memory = 1601943768 SRR11389799 SRAfilesize 9b517297fe5fd06f5ab0cede2ece9571 SRR11389799.sra SRR11389799.sra file validated SRR11389799 is paired end SRR11389799 is conventional basespace SRR11389799 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389799_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.143 32.0 32.0 32.0 32.0 32.0 2 31.09175 32.0 32.0 32.0 32.0 32.0 3 31.18525 32.0 32.0 32.0 32.0 32.0 4 31.2495 32.0 32.0 32.0 32.0 32.0 5 31.1455 32.0 32.0 32.0 32.0 32.0 6 34.23625 36.0 36.0 36.0 32.0 36.0 7 34.162 36.0 36.0 36.0 32.0 36.0 8 34.15625 36.0 36.0 36.0 32.0 36.0 9 34.2955 36.0 36.0 36.0 32.0 36.0 10-11 34.172875000000005 36.0 36.0 36.0 32.0 36.0 12-13 34.29475 36.0 36.0 36.0 32.0 36.0 14-15 34.185625 36.0 36.0 36.0 32.0 36.0 16-17 34.181875000000005 36.0 36.0 36.0 32.0 36.0 18-19 34.052375 36.0 36.0 36.0 32.0 36.0 20-21 34.103625 36.0 36.0 36.0 32.0 36.0 22-23 33.948375 36.0 36.0 36.0 32.0 36.0 24-25 33.8625 36.0 36.0 36.0 32.0 36.0 26-27 33.687875000000005 36.0 36.0 36.0 29.5 36.0 28-29 33.53675 36.0 36.0 36.0 24.0 36.0 30-31 33.57225 36.0 36.0 36.0 26.5 36.0 32-33 33.490750000000006 36.0 36.0 36.0 27.0 36.0 34-35 33.42125 36.0 36.0 36.0 24.0 36.0 36-37 33.44843554443054 36.0 36.0 36.0 24.0 36.0 38-39 33.3558197747184 36.0 36.0 36.0 24.0 36.0 40-41 33.2468085106383 36.0 36.0 36.0 20.5 36.0 42-43 33.2441802252816 36.0 36.0 36.0 17.5 36.0 44-45 33.12453066332917 36.0 36.0 36.0 17.5 36.0 46-47 32.94705882352941 36.0 36.0 36.0 14.0 36.0 48-49 32.8459324155194 36.0 36.0 36.0 14.0 36.0 50-51 32.73729662077597 36.0 36.0 36.0 14.0 36.0 52-53 32.715322984476714 36.0 36.0 36.0 14.0 36.0 54-55 32.49749624436655 36.0 34.0 36.0 14.0 36.0 56-57 32.37393590385578 36.0 32.0 36.0 14.0 36.0 58-59 32.10916374561843 36.0 32.0 36.0 14.0 36.0 60-61 31.885578367551325 36.0 32.0 36.0 14.0 36.0 62-63 31.848522784176264 36.0 32.0 36.0 14.0 36.0 64-65 31.71557336004006 36.0 32.0 36.0 14.0 36.0 66-67 31.40959178562484 36.0 32.0 36.0 14.0 36.0 68-69 31.400325569747057 36.0 32.0 36.0 14.0 36.0 70-71 31.376158276984725 36.0 32.0 36.0 14.0 36.0 72-73 31.19372468179512 36.0 32.0 36.0 14.0 36.0 74-75 31.073469618832927 36.0 32.0 36.0 14.0 36.0 76 30.45732966276669 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 2.0 23 11.0 24 12.0 25 19.0 26 51.0 27 76.0 28 128.0 29 178.0 30 262.0 31 342.0 32 525.0 33 781.0 34 1044.0 35 561.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.95244055068836 10.938673341677097 10.563204005006257 36.545682102628284 2 25.75719649561952 12.190237797246558 32.49061326658323 29.561952440550687 3 25.65707133917397 18.67334167709637 20.851063829787233 34.81852315394243 4 31.11389236545682 23.804755944931163 17.09637046307885 27.98498122653317 5 28.38548185231539 26.90863579474343 20.550688360450565 24.155193992490613 6 25.00626409421198 27.962916562265093 23.076923076923077 23.95389626659985 7 19.0738423028786 21.752190237797247 34.34292866082603 24.831038798498124 8 22.152690863579476 19.22403003754693 29.161451814768462 29.46182728410513 9 22.377972465581976 18.523153942428035 30.16270337922403 28.936170212765955 10-11 24.593241551939926 26.33291614518148 22.265331664580724 26.80851063829787 12-13 25.481852315394242 21.151439299123904 23.754693366708384 29.61201501877347 14-15 25.056320400500624 21.952440550688358 24.292866082603254 28.698372966207756 16-17 25.682102628285357 22.853566958698373 23.11639549436796 28.34793491864831 18-19 25.231539424280353 22.62828535669587 23.879849812265334 28.260325406758447 20-21 24.881101376720903 22.92866082603254 23.867334167709636 28.32290362953692 22-23 25.00625782227785 23.128911138923655 23.31664580725907 28.548185231539424 24-25 25.93241551939925 22.127659574468083 22.97872340425532 28.961201501877348 26-27 25.018773466833544 22.90362953692115 23.429286608260323 28.64831038798498 28-29 25.41927409261577 22.302878598247812 23.654568210262827 28.623279098873596 30-31 25.444305381727162 21.952440550688358 24.005006257822277 28.5982478097622 32-33 24.718397997496872 22.84105131414268 23.817271589486857 28.623279098873596 34-35 26.095118898623284 23.128911138923655 22.453066332916144 28.32290362953692 36-37 25.53191489361702 22.81602002503129 23.241551939924907 28.410513141426787 38-39 26.220275344180227 22.7909887359199 22.540675844806007 28.448060075093867 40-41 26.220275344180227 22.490613266583228 22.7909887359199 28.498122653316642 42-43 26.0450563204005 22.84105131414268 22.11514392991239 28.99874843554443 44-45 26.420525657071337 21.67709637046308 23.867334167709636 28.035043804755944 46-47 25.69461827284105 22.5531914893617 23.19148936170213 28.56070087609512 48-49 25.79474342928661 21.401752190237797 23.09136420525657 29.712140175219027 50-51 25.79474342928661 21.952440550688358 23.128911138923655 29.123904881101375 52-53 26.927891837756633 22.108162243365047 22.421131697546322 28.542814221331998 54-55 25.951427140711065 22.496244366549824 22.245868803204807 29.306459689534304 56-57 26.251877816725088 22.521281922884327 23.397596394591886 27.8292438657987 58-59 25.701051577366048 22.8592889334001 22.959439158738107 28.480220330495744 60-61 26.164246369554334 22.721582373560338 21.85778668002003 29.256384576865297 62-63 25.97646469704557 21.932899349023536 23.84827240861292 28.24236354531798 64-65 27.1407110665999 21.357035553329993 22.346019028542813 29.156234351527292 66-67 26.70924117205109 21.550212872526924 22.414224893563738 29.326321061858252 68-69 27.160030052592038 21.700475832707237 22.551965940395693 28.58752817430503 70-71 26.183320811419986 22.364137240170297 23.353368394690712 28.09917355371901 72-73 27.04094448630997 21.15046470735996 22.029640793770408 29.77895001255966 74-75 27.2008434370058 18.19978914074855 24.578281497100683 30.021085925144963 76 30.07570543702684 0.0 31.039229181004817 38.885065381968346 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.5 22 0.5 23 0.5 24 1.5 25 4.0 26 5.0 27 5.0 28 8.0 29 13.0 30 19.0 31 24.5 32 31.0 33 36.5 34 36.5 35 39.0 36 61.5 37 85.5 38 85.0 39 87.0 40 102.0 41 121.0 42 134.5 43 143.0 44 145.5 45 136.5 46 134.5 47 145.5 48 159.5 49 149.0 50 132.0 51 137.5 52 139.0 53 137.5 54 139.0 55 130.0 56 127.5 57 137.0 58 144.0 59 142.5 60 131.0 61 127.5 62 133.5 63 132.5 64 140.5 65 149.5 66 131.5 67 118.0 68 113.5 69 109.0 70 110.0 71 106.5 72 86.0 73 69.5 74 63.0 75 52.0 76 45.0 77 40.0 78 26.5 79 12.0 80 16.5 81 16.5 82 7.0 83 3.5 84 2.5 85 0.5 86 1.5 87 2.5 88 1.5 89 1.0 90 0.5 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.125 3 0.125 4 0.125 5 0.125 6 0.22499999999999998 7 0.125 8 0.125 9 0.125 10-11 0.125 12-13 0.125 14-15 0.125 16-17 0.125 18-19 0.125 20-21 0.125 22-23 0.125 24-25 0.125 26-27 0.125 28-29 0.125 30-31 0.125 32-33 0.125 34-35 0.125 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 5.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 1.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 3.0 72 18.0 73 50.0 74 256.0 75 760.0 76 2906.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06542056074767 98.05 2 0.8840616317251832 1.7500000000000002 3 0.025258903763576663 0.075 4 0.0 0.0 5 0.025258903763576663 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.025 0.0 0.0 0.0 15 0.0 0.025 0.0 0.0 0.0 16 0.0 0.025 0.0 0.0 0.0 17 0.0 0.025 0.0 0.0 0.0 18 0.0 0.025 0.0 0.0 0.0 19 0.0 0.025 0.0 0.0 0.0 20 0.0 0.025 0.0 0.0 0.0 21 0.0 0.025 0.0 0.0 0.0 22 0.0 0.025 0.0 0.0 0.0 23 0.0 0.025 0.0 0.0 0.0 24 0.0 0.025 0.0 0.0 0.0 25 0.0 0.025 0.0 0.0 0.0 26 0.0 0.025 0.0 0.0 0.0 27 0.0 0.025 0.0 0.0 0.0 28 0.0 0.025 0.0 0.0 0.0 29 0.0 0.025 0.0 0.0 0.0 30 0.0 0.025 0.0 0.0 0.0 31 0.0 0.025 0.0 0.0 0.0 32 0.0 0.025 0.0 0.0 0.0 33 0.0 0.025 0.0 0.0 0.0 34 0.0 0.025 0.0 0.0 0.0 35 0.0 0.025 0.0 0.0 0.0 36 0.0 0.025 0.0 0.0 0.0 37 0.0 0.025 0.0 0.0 0.0 38 0.0 0.025 0.0 0.0 0.0 39 0.0 0.025 0.0 0.0 0.0 40 0.0 0.025 0.0 0.0 0.0 41 0.0 0.025 0.0 0.0 0.0 42 0.0 0.025 0.0 0.0 0.0 43 0.0 0.025 0.0 0.0 0.0 44 0.0 0.025 0.0 0.0 0.0 45 0.025 0.025 0.0 0.0 0.0 46 0.025 0.025 0.0 0.0 0.0 47 0.025 0.025 0.0 0.0 0.0 48 0.025 0.025 0.0 0.0 0.0 49 0.025 0.025 0.0 0.0 0.0 50 0.025 0.025 0.0 0.0 0.0 51 0.025 0.025 0.0 0.0 0.0 52 0.025 0.025 0.0 0.0 0.0 53 0.025 0.025 0.0 0.0 0.0 54 0.025 0.025 0.0 0.0 0.0 55 0.025 0.025 0.0 0.0 0.0 56 0.025 0.025 0.0 0.0 0.0 57 0.025 0.025 0.0 0.0 0.0 58 0.025 0.025 0.0 0.0 0.0 59 0.025 0.025 0.0 0.0 0.0 60 0.025 0.025 0.0 0.0 0.0 61 0.025 0.025 0.0 0.0 0.0 62 0.025 0.025 0.0 0.0 0.0 63 0.025 0.025 0.0 0.0 0.0 64 0.025 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389799 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389799_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.75925 32.0 32.0 32.0 32.0 32.0 2 30.297 32.0 32.0 32.0 27.0 32.0 3 30.40625 32.0 32.0 32.0 32.0 32.0 4 30.311 32.0 32.0 32.0 21.0 32.0 5 30.34925 32.0 32.0 32.0 21.0 32.0 6 33.38825 36.0 36.0 36.0 21.0 36.0 7 33.507 36.0 36.0 36.0 21.0 36.0 8 33.607 36.0 36.0 36.0 32.0 36.0 9 33.445 36.0 36.0 36.0 21.0 36.0 10-11 33.459 36.0 36.0 36.0 21.0 36.0 12-13 33.553125 36.0 36.0 36.0 26.5 36.0 14-15 33.253375 36.0 36.0 36.0 21.0 36.0 16-17 33.443 36.0 36.0 36.0 21.0 36.0 18-19 33.375 36.0 36.0 36.0 21.0 36.0 20-21 33.22225 36.0 36.0 36.0 21.0 36.0 22-23 33.04675 36.0 36.0 36.0 17.5 36.0 24-25 33.105500000000006 36.0 36.0 36.0 17.5 36.0 26-27 33.046 36.0 36.0 36.0 17.5 36.0 28-29 33.021375 36.0 36.0 36.0 14.0 36.0 30-31 32.923249999999996 36.0 36.0 36.0 14.0 36.0 32-33 32.896375 36.0 36.0 36.0 14.0 36.0 34-35 32.799499999999995 36.0 36.0 36.0 14.0 36.0 36-37 32.72311356229632 36.0 36.0 36.0 14.0 36.0 38-39 32.59024818250188 36.0 36.0 36.0 14.0 36.0 40-41 32.573828027074455 36.0 36.0 36.0 14.0 36.0 42-43 32.42579593883178 36.0 36.0 36.0 14.0 36.0 44-45 32.30097232660629 36.0 36.0 36.0 14.0 36.0 46-47 32.324724172517556 36.0 36.0 36.0 14.0 36.0 48-49 32.30654463390171 36.0 34.0 36.0 14.0 36.0 50-51 32.12550477492171 36.0 32.0 36.0 14.0 36.0 52-53 31.897014550928247 36.0 32.0 36.0 14.0 36.0 54-55 31.71500250878073 36.0 32.0 36.0 14.0 36.0 56-57 31.60544141005439 36.0 32.0 36.0 14.0 36.0 58-59 31.391969887076534 36.0 32.0 36.0 14.0 36.0 60-61 31.180070659047736 36.0 32.0 36.0 14.0 36.0 62-63 31.193649598393574 36.0 32.0 36.0 14.0 36.0 64-65 30.99761546184739 36.0 32.0 36.0 14.0 36.0 66-67 31.050451807228917 36.0 32.0 36.0 14.0 36.0 68-69 30.785117969996985 36.0 32.0 36.0 14.0 36.0 70-71 30.562584259093107 36.0 27.0 36.0 14.0 36.0 72-73 30.4442389392273 36.0 27.0 36.0 14.0 36.0 74-75 30.29042014222839 36.0 27.0 36.0 14.0 36.0 76 29.314366998577526 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 0.0 4 2.0 5 6.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 3.0 16 2.0 17 7.0 18 8.0 19 5.0 20 6.0 21 15.0 22 25.0 23 28.0 24 44.0 25 66.0 26 92.0 27 130.0 28 139.0 29 198.0 30 231.0 31 349.0 32 493.0 33 650.0 34 928.0 35 560.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.320962888665996 17.502507522567704 9.929789368104313 32.246740220661984 2 29.81444332998997 21.74022066198596 26.654964894684053 21.790371113340022 3 26.12183504637754 25.795938831787414 20.13035848583605 27.951867635998994 4 32.11331160691903 28.002005515166704 14.665329656555528 25.219353221358737 5 30.50889947355227 31.06041614439709 18.450739533717726 19.979944848332913 6 24.016044121333668 33.642516921534224 18.47580847330158 23.865630483830532 7 24.943594885936324 15.868638756580596 31.28603660065179 27.901729756831283 8 24.222668004012036 21.36409227683049 21.715145436308926 32.698094282848544 9 25.188158554942298 22.22779729051681 23.557451078775713 29.026593075765177 10-11 28.849535292640038 25.759859331826174 17.822155237377544 27.56845013815624 12-13 27.839195979899493 21.017587939698494 21.369346733668344 29.773869346733665 14-15 27.494345312892687 24.12666499120382 21.78939432018095 26.589595375722542 16-17 28.801206333249564 22.945463684342798 20.33174164362905 27.921588338778587 18-19 28.32014072119613 22.72898605352431 21.08305063450182 27.867822590777735 20-21 28.287654010560725 24.59140055318079 20.530550666331408 26.590394769927077 22-23 27.978883861236802 22.750125691302163 21.116138763197586 28.15485168426345 24-25 28.18547373711988 23.762251822065846 20.884644383010805 27.167630057803464 26-27 26.687617850408547 24.500314267756128 20.842237586423636 27.96983029541169 28-29 29.258793969849243 22.42462311557789 20.816582914572866 27.500000000000004 30-31 28.015075376884425 22.964824120603016 20.92964824120603 28.09045226130653 32-33 27.123115577889443 24.120603015075375 21.457286432160807 27.298994974874375 34-35 28.652250440030176 23.082725672617553 20.69399044505909 27.571033442293185 36-37 27.876273104488874 23.06048032189111 21.16182572614108 27.901420847478935 38-39 28.37209302325581 23.771213073538654 20.94280326838466 26.91389063482087 40-41 28.2286432160804 22.91457286432161 21.884422110552766 26.972361809045225 42-43 29.241015330485048 22.11610957527017 21.563206835888415 27.07966825835637 44-45 27.99497171590195 23.58265241986172 21.3073538654934 27.11502199874293 46-47 29.386626445449977 23.353443941679235 19.720965309200604 27.538964303670188 48-49 29.334842197912735 22.90959386395071 20.583427637369546 27.172136300767008 50-51 28.237364847875284 23.585617299471963 21.52376162936887 26.653256223283883 52-53 29.193406316849124 22.51163961243236 20.900968919088964 27.393985151629547 54-55 28.555262165220675 23.28681000880171 20.67144473783478 27.486483088142837 56-57 28.844461209606436 23.33710549478184 21.62705897145731 26.19137432415441 58-59 29.311863127437416 23.524971694552775 20.00251603975343 27.16064913825638 60-61 28.082536487166582 23.07498741821842 21.16255661801711 27.679919476597885 62-63 28.880503144654092 23.232704402515722 20.88050314465409 27.0062893081761 64-65 28.04479114242577 23.452440865626574 21.036738802214394 27.466029189733266 66-67 28.503144654088054 23.08176100628931 21.22012578616352 27.19496855345912 68-69 28.388070970177427 23.25405813514534 20.926135648672457 27.43173524600478 70-71 28.224487227884737 22.750723543475527 21.555303888259722 27.469485340380018 72-73 28.329542582764724 22.365428354814256 21.228203184230477 28.076825878190547 74-75 29.38655237074739 19.24725421912671 22.274310206268417 29.09188320385749 76 30.68141277202997 0.0 27.256510881198714 42.06207634677131 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 11.0 1 5.5 2 0.0 3 0.5 4 1.0 5 2.5 6 3.5 7 3.0 8 3.0 9 1.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 3.0 24 3.5 25 3.5 26 3.5 27 5.0 28 7.5 29 10.0 30 14.5 31 15.5 32 19.0 33 24.5 34 30.5 35 37.5 36 48.5 37 60.0 38 62.0 39 68.0 40 86.5 41 110.5 42 118.5 43 116.5 44 125.0 45 118.5 46 112.5 47 137.5 48 148.0 49 129.5 50 124.0 51 142.5 52 163.0 53 165.5 54 158.5 55 144.5 56 140.0 57 137.0 58 127.0 59 152.5 60 168.5 61 162.5 62 164.0 63 143.5 64 131.0 65 140.5 66 142.0 67 139.0 68 136.5 69 135.5 70 115.0 71 89.0 72 84.0 73 78.5 74 65.5 75 57.0 76 49.5 77 38.0 78 27.5 79 22.5 80 17.0 81 10.5 82 7.5 83 5.5 84 3.5 85 5.0 86 6.0 87 4.0 88 2.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.5 95 1.0 96 1.0 97 0.5 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.3 3 0.27499999999999997 4 0.27499999999999997 5 0.27499999999999997 6 0.27499999999999997 7 0.27499999999999997 8 0.3 9 0.35000000000000003 10-11 0.475 12-13 0.5 14-15 0.525 16-17 0.525 18-19 0.5125000000000001 20-21 0.575 22-23 0.5499999999999999 24-25 0.525 26-27 0.5625 28-29 0.5 30-31 0.5 32-33 0.5 34-35 0.575 36-37 0.31336174479819506 38-39 0.2882928052143395 40-41 0.22562045625470042 42-43 0.25068939583855604 44-45 0.2757929046007271 46-47 0.25075225677031093 48-49 0.2883650952858576 50-51 0.2633228840125392 52-53 0.3135975915704967 54-55 0.23833416959357753 56-57 0.22581859239744073 58-59 0.26348808030112925 60-61 0.26352114443468444 62-63 0.2259036144578313 64-65 0.25100401606425704 66-67 0.2259036144578313 68-69 0.25103552152629593 70-71 0.22598870056497175 72-73 0.22692889561270801 74-75 0.25384101536406145 76 0.3200568990042674 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 11.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 1.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 1.0 51 1.0 52 0.0 53 0.0 54 0.0 55 0.0 56 1.0 57 0.0 58 0.0 59 0.0 60 1.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 0.0 70 1.0 71 3.0 72 26.0 73 63.0 74 295.0 75 783.0 76 2812.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83307965499746 97.39999999999999 2 1.06544901065449 2.1 3 0.076103500761035 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025367833587011668 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 11 0.27499999999999997 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 872358 spots for SRR11389799.sra Written 872358 spots for SRR11389799.sra Read 872358 spots for SRR11389799.sra Written 872358 spots for SRR11389799.sra Read 872358 spots for SRR11389799.sra Written 872358 spots for SRR11389799.sra Read 872358 spots for SRR11389799.sra Written 872358 spots for SRR11389799.sra Read 872358 spots for SRR11389799.sra Written 872358 spots for SRR11389799.sra Read 872358 spots for SRR11389799.sra Written 872358 spots for SRR11389799.sra Read 872358 spots for SRR11389799.sra Written 872358 spots for SRR11389799.sra Read 872358 spots for SRR11389799.sra Written 872358 spots for SRR11389799.sra Read 872358 spots for SRR11389799.sra Written 872358 spots for SRR11389799.sra Read 872358 spots for SRR11389799.sra Written 872358 spots for SRR11389799.sra Read 872366 spots for SRR11389799.sra Written 872366 spots for SRR11389799.sra Read 872358 spots for SRR11389799.sra Written 872358 spots for SRR11389799.sra Read 872358 spots for SRR11389799.sra Written 872358 spots for SRR11389799.sra Read 872358 spots for SRR11389799.sra Written 872358 spots for SRR11389799.sra Read 872358 spots for SRR11389799.sra Written 872358 spots for SRR11389799.sra Read 872358 spots for SRR11389799.sra Written 872358 spots for SRR11389799.sra Read 872358 spots for SRR11389799.sra Written 872358 spots for SRR11389799.sra Read 872358 spots for SRR11389799.sra Written 872358 spots for SRR11389799.sra Read 872358 spots for SRR11389799.sra Written 872358 spots for SRR11389799.sra Read 872358 spots for SRR11389799.sra Written 872358 spots for SRR11389799.sra SRR ids: ['SRR11389799.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__k_j3rbi SRR11389799.sra spots: 17447168 blocks: [[1, 872358], [872359, 1744716], [1744717, 2617074], [2617075, 3489432], [3489433, 4361790], [4361791, 5234148], [5234149, 6106506], [6106507, 6978864], [6978865, 7851222], [7851223, 8723580], [8723581, 9595938], [9595939, 10468296], [10468297, 11340654], [11340655, 12213012], [12213013, 13085370], [13085371, 13957728], [13957729, 14830086], [14830087, 15702444], [15702445, 16574802], [16574803, 17447168]] SRR11389799 file size 3319445 SRR11389799 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389799 SRR11389799_1.fastq SRR11389799_2.fastq Input file: SRR11389799_1.fastq Paired file: SRR11389799_2.fastq trimmed: SRR11389799-trimmed-pair1.fastq, SRR11389799-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:49:39 2024 >> started Sat Dec 7 06:49:54 2024 >> done (15.208s) 17447168 read pairs processed; of these: 607 ( 0.00%) short read pairs filtered out after trimming by size control 25469 ( 0.15%) empty read pairs filtered out after trimming by size control 17421092 (99.85%) read pairs available; of these: 12125 ( 0.07%) trimmed read pairs available after processing 17408967 (99.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 12 0.00% 20 27 0.00% 21 11 0.00% 22 42 0.00% 23 15 0.00% 24 59 0.00% 25 15 0.00% 26 77 0.00% 27 8 0.00% 28 52 0.00% 29 21 0.00% 30 55 0.00% 31 19 0.00% 32 48 0.00% 33 19 0.00% 34 49 0.00% 35 309 0.00% 36 408 0.00% 37 305 0.00% 38 402 0.00% 39 331 0.00% 40 340 0.00% 41 288 0.00% 42 350 0.00% 43 335 0.00% 44 405 0.00% 45 424 0.00% 46 395 0.00% 47 355 0.00% 48 406 0.00% 49 403 0.00% 50 433 0.00% 51 378 0.00% 52 441 0.00% 53 423 0.00% 54 496 0.00% 55 630 0.00% 56 737 0.00% 57 829 0.00% 58 827 0.00% 59 851 0.00% 60 877 0.01% 61 768 0.00% 62 806 0.00% 63 983 0.01% 64 966 0.01% 65 1067 0.01% 66 1238 0.01% 67 1468 0.01% 68 1187 0.01% 69 1372 0.01% 70 1860 0.01% 71 2962 0.02% 72 12347 0.07% 73 128009 0.73% 74 1112572 6.39% 75 7215718 41.42% 76 8924842 51.23% 17421092 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=5.53 fanout-score-rank=17 prefix-density=0.63 prefix-fanout=3.9 sequence=GCCTTGAACACGTGCGCCTCGGGGGTCTCCTTCCAGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=39 fanout-score=191.32 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=20.3 sequence=CCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCTTGCCGCCGCTGCAGACGACGGCGAAGTTGGAGCCCCGCCGCGACAGCGACGGCAGGCTCGTCGGCGC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=4.78 fanout-score-rank=19 prefix-density=0.58 prefix-fanout=3.8 sequence=ACAATGTCGCTGGTGAGGAGGAGCAGCGTGTTCGACC criterion=fanout-score sequence-density=0.21 sequence-density-rank=15 fanout-score=20.67 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=9.4 sequence=ACAAGAAGAAGGTGGA SRR11389799 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:50:50 Started mapping on | Dec 07 06:50:50 Finished on | Dec 07 06:52:21 Mapping speed, Million of reads per hour | 689.19 Number of input reads | 17421092 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 15735284 Uniquely mapped reads % | 90.32% Average mapped length | 150.06 Number of splices: Total | 4406463 Number of splices: Annotated (sjdb) | 4221437 Number of splices: GT/AG | 4355305 Number of splices: GC/AG | 41151 Number of splices: AT/AC | 1765 Number of splices: Non-canonical | 8242 Mismatch rate per base, % | 1.27% Deletion rate per base | 0.01% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 362950 % of reads mapped to multiple loci | 2.08% Number of reads mapped to too many loci | 91044 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.56% % of reads unmapped: other | 2.51% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1322864 1322864 1322864 N_multimapping 362950 362950 362950 N_noFeature 710009 15209787 994773 N_ambiguous 293177 1888 53175 UnstrandedReadsAssigned:14732098 PositiveStrandReadsAssigned:523609 NegativeStrandReadsAssigned:14687336 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389799 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389799-trimmed-pair1.fastq SRR11389799-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,421,092 reads, 14,862,534 reads pseudoaligned [quant] estimated average fragment length: 212.531 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,043 rounds 52973 SRR11389799.ke.tsv 35125 SRR11389799.se.tsv 88098 total ==> SRR11389799.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 724.535 4.71357 0.519707 PNS24247 1044 832.469 0 0 PNS24249 1928 1716.47 107.286 4.99317 PNS24246 1044 832.469 0 0 PNS24248 1044 832.469 0 0 PNS24244 1471 1259.47 0 0 PNS24243 293 97.7326 0 0 KQK14069 1603 1391.47 3473.11 199.394 KQK14071 474 264.3 147.51 44.5854 ==> SRR11389799.se.tsv <== BRADI_1g14170v3 3675 BRADI_1g53295v3 1642 BRADI_1g59795v3 104 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 215 BRADI_1g74790v3 162 BRADI_1g09890v3 0 BRADI_1g77505v3 111 BRADI_1g48960v3 0 SRR11389799 completed mapping pipeline successfully