Starting /dee2/code/volunteer_pipeline.sh SRR11389800 current disk space = 1544963670016 free memory = 1603156828 SRR11389800 SRAfilesize e9d4107f6124d04eb4fd31f4fabe2952 SRR11389800.sra SRR11389800.sra file validated SRR11389800 is paired end SRR11389800 is conventional basespace SRR11389800 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389800_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.07325 32.0 32.0 32.0 32.0 32.0 2 31.093 32.0 32.0 32.0 32.0 32.0 3 31.05675 32.0 32.0 32.0 32.0 32.0 4 31.1925 32.0 32.0 32.0 32.0 32.0 5 31.14025 32.0 32.0 32.0 32.0 32.0 6 33.97275 36.0 36.0 36.0 32.0 36.0 7 34.22825 36.0 36.0 36.0 32.0 36.0 8 34.17525 36.0 36.0 36.0 32.0 36.0 9 34.31425 36.0 36.0 36.0 32.0 36.0 10-11 34.230000000000004 36.0 36.0 36.0 32.0 36.0 12-13 34.269375 36.0 36.0 36.0 32.0 36.0 14-15 34.200874999999996 36.0 36.0 36.0 32.0 36.0 16-17 34.18025 36.0 36.0 36.0 32.0 36.0 18-19 34.1715 36.0 36.0 36.0 32.0 36.0 20-21 34.157 36.0 36.0 36.0 32.0 36.0 22-23 34.028 36.0 36.0 36.0 32.0 36.0 24-25 33.954499999999996 36.0 36.0 36.0 32.0 36.0 26-27 33.738125 36.0 36.0 36.0 29.5 36.0 28-29 33.615875 36.0 36.0 36.0 27.0 36.0 30-31 33.5475 36.0 36.0 36.0 27.0 36.0 32-33 33.55075 36.0 36.0 36.0 29.5 36.0 34-35 33.432875 36.0 36.0 36.0 27.0 36.0 36-37 33.50426492724536 36.0 36.0 36.0 27.0 36.0 38-39 33.40052684395384 36.0 36.0 36.0 24.0 36.0 40-41 33.30431510286001 36.0 36.0 36.0 17.5 36.0 42-43 33.27784746613146 36.0 36.0 36.0 21.0 36.0 44-45 33.328399397892625 36.0 36.0 36.0 24.0 36.0 46-47 33.091946813848466 36.0 36.0 36.0 17.5 36.0 48-49 33.00213246362268 36.0 36.0 36.0 17.5 36.0 50-51 32.72290516808831 36.0 36.0 36.0 14.0 36.0 52-53 32.78901154039137 36.0 36.0 36.0 14.0 36.0 54-55 32.55431510286001 36.0 36.0 36.0 14.0 36.0 56-57 32.446813848469645 36.0 34.0 36.0 14.0 36.0 58-59 32.30431510286001 36.0 32.0 36.0 14.0 36.0 60-61 32.18226292022078 36.0 32.0 36.0 14.0 36.0 62-63 31.904164576016058 36.0 32.0 36.0 14.0 36.0 64-65 32.03549905849897 36.0 32.0 36.0 14.0 36.0 66-67 31.772521957340025 36.0 32.0 36.0 14.0 36.0 68-69 31.557967377666248 36.0 32.0 36.0 14.0 36.0 70-71 31.391718946047682 36.0 32.0 36.0 14.0 36.0 72-73 31.394172731118246 36.0 32.0 36.0 14.0 36.0 74-75 31.291397502837874 36.0 32.0 36.0 14.0 36.0 76 30.308686288585786 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 4.0 23 7.0 24 8.0 25 34.0 26 46.0 27 72.0 28 108.0 29 175.0 30 214.0 31 325.0 32 513.0 33 754.0 34 1099.0 35 625.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.394281414597444 10.509154752947078 11.211437170805116 33.88512666165036 2 25.232004013042385 11.888638073739653 33.08251818409832 29.79683972911964 3 25.783797341359417 18.76097316277903 20.71733132681214 34.73789816904941 4 30.22322548281916 24.329069475796338 18.459994983697015 26.987710057687487 5 27.86556308001003 28.71833458740908 20.817657386506145 22.598444946074743 6 23.86335091685506 29.037930168299418 23.838231600100475 23.260487314745042 7 19.63882618510158 22.72385252069225 35.46526210183095 22.172059192375222 8 20.667168296965137 21.921244043140206 28.49260095309757 28.91898670679709 9 20.817657386506145 20.59192375219463 29.897165788813645 28.693253072485582 10-11 25.056433408577877 28.442437923250562 21.30674692751442 25.194381740657136 12-13 24.830699774266364 22.410333584148482 24.78053674441936 27.97842989716579 14-15 23.551542513167796 23.288186606471033 25.658389766741912 27.501881113619262 16-17 25.70855279658891 23.727113117632307 24.441936292952093 26.122397792826686 18-19 24.115876598946574 23.68949084524705 24.617506897416604 27.577125658389768 20-21 24.454477050413846 24.36669174818159 24.5924253824931 26.586405818911462 22-23 24.805618259342864 24.078254326561325 23.890142964635064 27.22598444946075 24-25 26.02207173313268 23.350890393779782 23.82743917732631 26.799598695761222 26-27 24.228743416102333 23.714572360170553 24.115876598946574 27.94080762478054 28-29 24.642588412340103 24.19112114371708 23.6518685728618 27.514421871081012 30-31 24.542262352646098 24.404314020566844 23.5766240280913 27.476799598695763 32-33 24.253824931025832 24.090795084023075 24.341610233258088 27.313769751693002 34-35 25.771256583897667 23.187860546777024 23.78981690494106 27.251065964384246 36-37 24.473156046161566 24.360260913196186 23.381836427496236 27.784746613146012 38-39 25.313597591570495 24.623682890115404 22.905168088309082 27.157551430005018 40-41 25.35122930255896 24.29754139488209 23.406924234821876 26.94430506773708 42-43 24.598595082789764 24.24736578023081 23.331660812844955 27.822378324134473 44-45 25.01254390366282 24.13447064726543 23.632714500752634 27.22027094831912 46-47 25.639739086803814 24.385348720521826 23.0431510286001 26.93176116407426 48-49 24.811841445057702 23.432012042147516 23.97139989964877 27.784746613146012 50-51 25.01254390366282 23.89613647767185 23.457099849473156 27.634219769192175 52-53 24.799297541394882 23.98394380331159 23.921224284997493 27.29553437029604 54-55 25.501756146512793 22.541394882087307 23.79578524836929 28.161063723030605 56-57 24.623682890115404 24.510787757150023 23.595082789764174 27.270446562970395 58-59 25.23833416959358 23.68289011540391 23.469643753135976 27.609131961866535 60-61 26.204214751630705 23.632714500752634 22.930255895634723 27.232814851981935 62-63 25.11289513296538 23.406924234821876 23.89613647767185 27.584044154540894 64-65 24.852590641073892 23.999498180905785 23.811316020574584 27.336595157445743 66-67 25.232120451693852 23.199498117942284 23.57590966122961 27.99247176913425 68-69 25.06900878293601 22.823086574654955 24.00250941028858 28.10539523212045 70-71 25.947302383939775 23.81430363864492 22.910915934755334 27.327478042659976 72-73 26.816064459272315 22.573335011960218 22.988795165554578 27.621805363212893 74-75 25.68734227653075 19.856554655332715 25.036525434984725 29.41957763315181 76 29.32519741564968 0.0 30.402010050251256 40.27279253409907 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 19.0 1 9.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 1.5 24 2.0 25 3.0 26 4.5 27 7.0 28 9.0 29 9.0 30 13.5 31 23.0 32 25.5 33 27.0 34 42.5 35 62.5 36 76.0 37 87.5 38 95.5 39 118.0 40 134.0 41 144.5 42 166.5 43 179.0 44 191.0 45 188.5 46 184.5 47 190.0 48 188.5 49 173.0 50 163.0 51 152.5 52 143.5 53 144.0 54 131.5 55 125.0 56 119.5 57 117.5 58 124.0 59 120.5 60 107.0 61 109.5 62 119.0 63 108.5 64 101.0 65 110.5 66 111.5 67 103.0 68 97.5 69 87.5 70 82.5 71 83.0 72 72.0 73 55.0 74 51.5 75 51.0 76 43.0 77 32.0 78 20.0 79 16.0 80 16.5 81 12.0 82 7.0 83 6.0 84 5.0 85 4.0 86 2.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.325 3 0.325 4 0.325 5 0.325 6 0.475 7 0.325 8 0.325 9 0.325 10-11 0.325 12-13 0.325 14-15 0.325 16-17 0.325 18-19 0.325 20-21 0.325 22-23 0.325 24-25 0.325 26-27 0.325 28-29 0.325 30-31 0.325 32-33 0.325 34-35 0.325 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 14.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 1.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 9.0 72 9.0 73 74.0 74 257.0 75 850.0 76 2786.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57189624779652 98.85000000000001 2 0.3777386048854193 0.75 3 0.02518257365902795 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02518257365902795 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 13 0.325 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGCCTC 15 0.002110377 69.625 64 >>END_MODULE SRR11389800 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389800_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.73075 32.0 32.0 32.0 32.0 32.0 2 30.42525 32.0 32.0 32.0 32.0 32.0 3 30.29625 32.0 32.0 32.0 21.0 32.0 4 30.2465 32.0 32.0 32.0 21.0 32.0 5 30.391 32.0 32.0 32.0 32.0 32.0 6 33.42725 36.0 36.0 36.0 21.0 36.0 7 33.63625 36.0 36.0 36.0 32.0 36.0 8 33.60525 36.0 36.0 36.0 32.0 36.0 9 33.599 36.0 36.0 36.0 32.0 36.0 10-11 33.3705 36.0 36.0 36.0 21.0 36.0 12-13 33.543 36.0 36.0 36.0 26.5 36.0 14-15 33.340125 36.0 36.0 36.0 21.0 36.0 16-17 33.34025 36.0 36.0 36.0 21.0 36.0 18-19 33.32899999999999 36.0 36.0 36.0 21.0 36.0 20-21 33.098749999999995 36.0 36.0 36.0 17.5 36.0 22-23 33.13175 36.0 36.0 36.0 21.0 36.0 24-25 33.046375 36.0 36.0 36.0 17.5 36.0 26-27 32.889375 36.0 36.0 36.0 14.0 36.0 28-29 32.946625 36.0 36.0 36.0 14.0 36.0 30-31 32.815875 36.0 36.0 36.0 14.0 36.0 32-33 32.692375 36.0 36.0 36.0 14.0 36.0 34-35 32.76649999999999 36.0 36.0 36.0 14.0 36.0 36-37 32.802961847389554 36.0 36.0 36.0 14.0 36.0 38-39 32.75012550200803 36.0 36.0 36.0 14.0 36.0 40-41 32.62085843373494 36.0 36.0 36.0 14.0 36.0 42-43 32.54831827309237 36.0 36.0 36.0 14.0 36.0 44-45 32.38887493721748 36.0 36.0 36.0 14.0 36.0 46-47 32.401180311401305 36.0 36.0 36.0 14.0 36.0 48-49 32.15846308387745 36.0 32.0 36.0 14.0 36.0 50-51 32.06152687091914 36.0 32.0 36.0 14.0 36.0 52-53 31.911099949773984 36.0 32.0 36.0 14.0 36.0 54-55 31.8216976393772 36.0 32.0 36.0 14.0 36.0 56-57 31.7435961828227 36.0 32.0 36.0 14.0 36.0 58-59 31.351707684580614 36.0 32.0 36.0 14.0 36.0 60-61 31.397162230035157 36.0 32.0 36.0 14.0 36.0 62-63 31.281140130587644 36.0 32.0 36.0 14.0 36.0 64-65 31.13877697062049 36.0 32.0 36.0 14.0 36.0 66-67 31.2008289374529 36.0 32.0 36.0 14.0 36.0 68-69 30.907812107510676 36.0 32.0 36.0 14.0 36.0 70-71 30.813296559007128 36.0 29.5 36.0 14.0 36.0 72-73 30.754852563252733 36.0 27.0 36.0 14.0 36.0 74-75 30.493560459205654 36.0 27.0 36.0 14.0 36.0 76 29.605871559633027 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 0.0 4 3.0 5 4.0 6 0.0 7 0.0 8 0.0 9 2.0 10 0.0 11 0.0 12 0.0 13 0.0 14 5.0 15 6.0 16 6.0 17 8.0 18 8.0 19 13.0 20 10.0 21 16.0 22 23.0 23 37.0 24 39.0 25 52.0 26 71.0 27 94.0 28 151.0 29 163.0 30 278.0 31 333.0 32 476.0 33 610.0 34 971.0 35 606.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.78815261044177 18.498995983935743 9.713855421686747 30.998995983935746 2 30.020080321285143 20.983935742971887 27.083333333333332 21.912650602409638 3 27.202007528230865 26.82559598494354 20.677540777917187 25.294855708908408 4 29.259723964868257 28.983688833124216 18.996235884567128 22.760351317440403 5 29.259723964868257 30.41405269761606 19.121706398996235 21.20451693851945 6 23.98996235884567 32.69761606022585 20.501882057716436 22.810539523212046 7 23.764115432873275 15.959849435382687 34.35382685069009 25.922208281053955 8 24.886991461577097 21.672526368658964 23.17930688096434 30.261175288799596 9 24.93088715757728 21.135963810002515 25.157074641869816 28.776074390550388 10-11 26.57782247925572 27.420165954236865 18.632134774955997 27.369876791551423 12-13 27.527665995975852 21.31539235412475 22.975352112676056 28.18158953722334 14-15 26.280035224556546 24.103660837841236 22.669518178387218 26.946785759214997 16-17 28.841072102680254 23.027557568893922 22.247388951805714 25.883981376620106 18-19 27.877720467983398 24.003019247704113 22.531135991948673 25.58812429236382 20-21 26.904192370640818 23.756766964622937 23.051743673674935 26.28729699106131 22-23 26.321752265861026 24.458710976837867 22.21802618328298 27.001510574018127 24-25 27.14573370249182 24.36446010571357 21.79713063176441 26.692675560030203 26-27 27.213197330311047 23.81312177307644 22.18864122906435 26.785039667548165 28-29 27.69462960633883 24.03471261476544 22.173311533140485 26.097346245755247 30-31 25.798742138364776 24.91823899371069 22.553459119496853 26.729559748427672 32-33 26.83356397031073 23.66335388099132 23.43691030318279 26.066171845515157 34-35 26.693528078569628 24.741878619994964 21.959204230672373 26.60538907076303 36-37 27.53148614609572 24.672544080604535 22.241813602015114 25.554156171284635 38-39 27.370011330731465 23.819715472743297 22.749590834697216 26.060682361828025 40-41 27.17664821338702 24.421238047307497 22.471061902365374 25.93105183694011 42-43 27.47294236093632 24.729423609363202 21.87264032217468 25.9249937075258 44-45 26.388014604053883 24.5247387636913 23.404255319148938 25.68299131310588 46-47 27.079401031835914 24.009060022650054 22.09638857430477 26.815150371209263 48-49 27.402090416824077 24.090164966628887 23.057549427024306 25.450195189522727 50-51 27.325361862806798 24.103209565764633 22.1019509125236 26.46947765890497 52-53 27.15707267917874 24.914976697317044 22.005290338833603 25.922660284670613 54-55 27.938585451799646 24.075006292474203 22.577397432670526 25.409010823055628 56-57 27.280734868503835 23.644142443689443 22.687806719516797 26.387315968289922 58-59 27.001510574018127 24.55941591137966 22.419436052366564 26.01963746223565 60-61 27.93303121852971 23.250251762336354 22.6460221550856 26.17069486404834 62-63 27.06000754811926 23.47465089948421 23.41174990564851 26.05359164674802 64-65 27.291037260825778 24.760825780463243 22.318731117824772 25.629405840886204 66-67 28.47257171615501 23.28887770508304 22.458480120785104 25.78007045797685 68-69 27.325361862806798 24.027690371302707 22.995594713656388 25.65135305223411 70-71 26.856279889252455 24.163100931286184 22.892021142713315 26.08859803674805 72-73 27.11864406779661 23.792056665823424 22.80546420440172 26.283835061978245 74-75 27.814302965248892 20.595733261773784 23.802495639339863 27.78746813363746 76 30.721118469462837 0.0 32.00883002207506 37.2700515084621 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 20.0 1 11.0 2 1.5 3 1.0 4 1.0 5 2.0 6 2.0 7 1.5 8 1.5 9 1.5 10 1.5 11 1.0 12 1.0 13 1.5 14 1.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 2.0 22 3.0 23 2.5 24 4.5 25 4.5 26 3.5 27 6.5 28 12.0 29 14.5 30 16.5 31 22.0 32 25.5 33 24.5 34 32.5 35 47.0 36 58.0 37 70.0 38 78.5 39 102.5 40 132.0 41 147.5 42 152.5 43 164.0 44 182.0 45 173.0 46 161.0 47 182.5 48 191.0 49 163.5 50 148.5 51 156.5 52 172.5 53 153.5 54 124.5 55 127.0 56 130.0 57 126.0 58 123.5 59 118.5 60 114.0 61 116.0 62 120.0 63 116.5 64 114.5 65 119.5 66 110.0 67 99.0 68 96.0 69 104.5 70 94.0 71 74.0 72 68.0 73 65.5 74 61.5 75 51.5 76 43.0 77 31.0 78 23.5 79 21.0 80 19.0 81 17.0 82 11.5 83 6.0 84 4.0 85 1.5 86 0.5 87 0.0 88 0.5 89 1.5 90 1.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.4 3 0.375 4 0.375 5 0.375 6 0.375 7 0.375 8 0.44999999999999996 9 0.525 10-11 0.575 12-13 0.6 14-15 0.6375 16-17 0.6625 18-19 0.6375 20-21 0.7125 22-23 0.7000000000000001 24-25 0.675 26-27 0.7374999999999999 28-29 0.6125 30-31 0.625 32-33 0.6375 34-35 0.7250000000000001 36-37 0.3514056224899598 38-39 0.3137550200803213 40-41 0.25100401606425704 42-43 0.2761044176706827 44-45 0.2636865896534405 46-47 0.21346057257659468 48-49 0.2887995981918634 50-51 0.23857358111501756 52-53 0.31391260673028626 54-55 0.22601707684580613 56-57 0.21346057257659468 58-59 0.25113008538422904 60-61 0.25113008538422904 62-63 0.1883475640381718 64-65 0.23860354137887732 66-67 0.17583521728208992 68-69 0.21351419241396632 70-71 0.17587939698492464 72-73 0.20196919969704621 74-75 0.21421877091980182 76 0.25688073394495414 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 16.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 2.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 1.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 2.0 71 9.0 72 18.0 73 83.0 74 269.0 75 875.0 76 2725.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52104865137383 98.7 2 0.4285354171918326 0.8500000000000001 3 0.025207965717166627 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025207965717166627 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 15 0.375 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.05 0.0 0.0 0.0 0.0 61 0.05 0.0 0.0 0.0 0.0 62 0.05 0.0 0.0 0.0 0.0 63 0.05 0.0 0.0 0.0 0.0 64 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 785062 spots for SRR11389800.sra Written 785062 spots for SRR11389800.sra Read 785062 spots for SRR11389800.sra Written 785062 spots for SRR11389800.sra Read 785062 spots for SRR11389800.sra Written 785062 spots for SRR11389800.sra Read 785062 spots for SRR11389800.sra Written 785062 spots for SRR11389800.sra Read 785062 spots for SRR11389800.sra Written 785062 spots for SRR11389800.sra Read 785062 spots for SRR11389800.sra Written 785062 spots for SRR11389800.sra Read 785062 spots for SRR11389800.sra Written 785062 spots for SRR11389800.sra Read 785062 spots for SRR11389800.sra Written 785062 spots for SRR11389800.sra Read 785062 spots for SRR11389800.sra Written 785062 spots for SRR11389800.sra Read 785062 spots for SRR11389800.sra Written 785062 spots for SRR11389800.sra Read 785062 spots for SRR11389800.sra Written 785062 spots for SRR11389800.sra Read 785062 spots for SRR11389800.sra Written 785062 spots for SRR11389800.sra Read 785062 spots for SRR11389800.sra Written 785062 spots for SRR11389800.sra Read 785062 spots for SRR11389800.sra Written 785062 spots for SRR11389800.sra Read 785062 spots for SRR11389800.sra Written 785062 spots for SRR11389800.sra Read 785062 spots for SRR11389800.sra Written 785062 spots for SRR11389800.sra Read 785062 spots for SRR11389800.sra Written 785062 spots for SRR11389800.sra Read 785062 spots for SRR11389800.sra Written 785062 spots for SRR11389800.sra Read 785062 spots for SRR11389800.sra Written 785062 spots for SRR11389800.sra Read 785064 spots for SRR11389800.sra Written 785064 spots for SRR11389800.sra SRR ids: ['SRR11389800.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v_kbz9u7 SRR11389800.sra spots: 15701242 blocks: [[1, 785062], [785063, 1570124], [1570125, 2355186], [2355187, 3140248], [3140249, 3925310], [3925311, 4710372], [4710373, 5495434], [5495435, 6280496], [6280497, 7065558], [7065559, 7850620], [7850621, 8635682], [8635683, 9420744], [9420745, 10205806], [10205807, 10990868], [10990869, 11775930], [11775931, 12560992], [12560993, 13346054], [13346055, 14131116], [14131117, 14916178], [14916179, 15701242]] SRR11389800 file size 2982696 SRR11389800 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389800 SRR11389800_1.fastq SRR11389800_2.fastq Input file: SRR11389800_1.fastq Paired file: SRR11389800_2.fastq trimmed: SRR11389800-trimmed-pair1.fastq, SRR11389800-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:50:31 2024 >> started Sat Dec 7 06:50:43 2024 >> done (12.099s) 15701242 read pairs processed; of these: 576 ( 0.00%) short read pairs filtered out after trimming by size control 47568 ( 0.30%) empty read pairs filtered out after trimming by size control 15653098 (99.69%) read pairs available; of these: 12442 ( 0.08%) trimmed read pairs available after processing 15640656 (99.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 36 0.00% 19 8 0.00% 20 66 0.00% 21 11 0.00% 22 75 0.00% 23 15 0.00% 24 117 0.00% 25 23 0.00% 26 126 0.00% 27 17 0.00% 28 117 0.00% 29 15 0.00% 30 106 0.00% 31 19 0.00% 32 115 0.00% 33 14 0.00% 34 95 0.00% 35 235 0.00% 36 584 0.00% 37 237 0.00% 38 429 0.00% 39 251 0.00% 40 352 0.00% 41 237 0.00% 42 289 0.00% 43 259 0.00% 44 315 0.00% 45 330 0.00% 46 279 0.00% 47 301 0.00% 48 310 0.00% 49 320 0.00% 50 321 0.00% 51 342 0.00% 52 366 0.00% 53 344 0.00% 54 323 0.00% 55 525 0.00% 56 842 0.01% 57 775 0.00% 58 625 0.00% 59 750 0.00% 60 761 0.00% 61 660 0.00% 62 687 0.00% 63 853 0.01% 64 781 0.00% 65 963 0.01% 66 1028 0.01% 67 1235 0.01% 68 1043 0.01% 69 1225 0.01% 70 1815 0.01% 71 2918 0.02% 72 11629 0.07% 73 123147 0.79% 74 1078940 6.89% 75 6750738 43.13% 76 7663759 48.96% 15653098 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.27 fanout-score-rank=18 prefix-density=0.38 prefix-fanout=3.1 sequence=GTCTCCTTCCAGTCCATGCGGGCGTTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=51.67 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=11.0 sequence=GCCGGCGCCGGCGCCG criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=4.29 fanout-score-rank=19 prefix-density=0.40 prefix-fanout=3.6 sequence=ACAATGTCGCTGGTGAGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=12 fanout-score=237.51 fanout-score-rank=1 prefix-density=1.14 prefix-fanout=25.0 sequence=CGCCGCCGCCGC SRR11389800 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:51:41 Started mapping on | Dec 07 06:51:41 Finished on | Dec 07 06:53:02 Mapping speed, Million of reads per hour | 695.69 Number of input reads | 15653098 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 14373483 Uniquely mapped reads % | 91.83% Average mapped length | 150.01 Number of splices: Total | 5112526 Number of splices: Annotated (sjdb) | 4859726 Number of splices: GT/AG | 5041950 Number of splices: GC/AG | 61953 Number of splices: AT/AC | 2674 Number of splices: Non-canonical | 5949 Mismatch rate per base, % | 1.22% Deletion rate per base | 0.01% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 298727 % of reads mapped to multiple loci | 1.91% Number of reads mapped to too many loci | 64358 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.45% % of reads unmapped: other | 1.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 980894 980894 980894 N_multimapping 298727 298727 298727 N_noFeature 675116 13887789 932029 N_ambiguous 277800 2141 50161 UnstrandedReadsAssigned:13420567 PositiveStrandReadsAssigned:483553 NegativeStrandReadsAssigned:13391293 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389800 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389800-trimmed-pair1.fastq SRR11389800-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,653,098 reads, 13,683,164 reads pseudoaligned [quant] estimated average fragment length: 212.722 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,117 rounds 52973 SRR11389800.ke.tsv 35125 SRR11389800.se.tsv 88098 total ==> SRR11389800.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 724.492 0 0 PNS24247 1044 832.278 33.4497 3.96571 PNS24249 1928 1716.28 286.931 16.4963 PNS24246 1044 832.278 33.4497 3.96571 PNS24248 1044 832.278 33.4497 3.96571 PNS24244 1471 1259.28 22.7199 1.78025 PNS24243 293 97.8385 1 1.00853 KQK14069 1603 1391.28 8698.16 616.894 KQK14071 474 264.609 609.21 227.174 ==> SRR11389800.se.tsv <== BRADI_1g14170v3 9881 BRADI_1g53295v3 883 BRADI_1g59795v3 243 BRADI_1g07683v3 0 BRADI_1g00485v3 33 BRADI_1g20270v3 545 BRADI_1g74790v3 444 BRADI_1g09890v3 2 BRADI_1g77505v3 137 BRADI_1g48960v3 0 SRR11389800 completed mapping pipeline successfully