Starting /dee2/code/volunteer_pipeline.sh SRR11389801 current disk space = 1544930357248 free memory = 1597264836 SRR11389801 SRAfilesize b6ff0a3388007ef0ce3dd6d1a9c31b5c SRR11389801.sra SRR11389801.sra file validated SRR11389801 is paired end SRR11389801 is conventional basespace SRR11389801 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389801_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.14475 32.0 32.0 32.0 32.0 32.0 2 31.1505 32.0 32.0 32.0 32.0 32.0 3 31.10075 32.0 32.0 32.0 32.0 32.0 4 31.13775 32.0 32.0 32.0 32.0 32.0 5 31.1205 32.0 32.0 32.0 32.0 32.0 6 34.0785 36.0 36.0 36.0 32.0 36.0 7 34.11075 36.0 36.0 36.0 32.0 36.0 8 34.1035 36.0 36.0 36.0 32.0 36.0 9 34.25825 36.0 36.0 36.0 32.0 36.0 10-11 34.18725 36.0 36.0 36.0 32.0 36.0 12-13 34.26175 36.0 36.0 36.0 32.0 36.0 14-15 34.180125000000004 36.0 36.0 36.0 32.0 36.0 16-17 34.150375 36.0 36.0 36.0 32.0 36.0 18-19 34.08225 36.0 36.0 36.0 32.0 36.0 20-21 34.086375000000004 36.0 36.0 36.0 32.0 36.0 22-23 33.965125 36.0 36.0 36.0 32.0 36.0 24-25 33.84725 36.0 36.0 36.0 32.0 36.0 26-27 33.653375 36.0 36.0 36.0 24.0 36.0 28-29 33.757374999999996 36.0 36.0 36.0 29.5 36.0 30-31 33.594625 36.0 36.0 36.0 27.0 36.0 32-33 33.47975 36.0 36.0 36.0 27.0 36.0 34-35 33.45725 36.0 36.0 36.0 26.5 36.0 36-37 33.46424106026507 36.0 36.0 36.0 24.0 36.0 38-39 33.26544136034009 36.0 36.0 36.0 21.0 36.0 40-41 33.28157039259815 36.0 36.0 36.0 21.0 36.0 42-43 33.29457364341086 36.0 36.0 36.0 21.0 36.0 44-45 33.013753438359586 36.0 36.0 36.0 14.0 36.0 46-47 33.01487871967992 36.0 36.0 36.0 17.5 36.0 48-49 32.793323330832706 36.0 36.0 36.0 17.5 36.0 50-51 32.78814407203602 36.0 36.0 36.0 14.0 36.0 52-53 32.701975987994 36.0 36.0 36.0 14.0 36.0 54-55 32.45785392696348 36.0 36.0 36.0 14.0 36.0 56-57 32.41771135818159 36.0 34.0 36.0 14.0 36.0 58-59 32.16604104104104 36.0 32.0 36.0 14.0 36.0 60-61 32.0873433389533 36.0 32.0 36.0 14.0 36.0 62-63 31.85850237916354 36.0 32.0 36.0 14.0 36.0 64-65 31.762709742048585 36.0 32.0 36.0 14.0 36.0 66-67 31.61752910403828 36.0 32.0 36.0 14.0 36.0 68-69 31.49411175144074 36.0 32.0 36.0 14.0 36.0 70-71 31.269976753687196 36.0 32.0 36.0 14.0 36.0 72-73 31.23699115081269 36.0 32.0 36.0 14.0 36.0 74-75 31.214072111849042 36.0 32.0 36.0 14.0 36.0 76 30.82930402930403 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 4.0 23 3.0 24 11.0 25 23.0 26 49.0 27 85.0 28 136.0 29 200.0 30 263.0 31 331.0 32 508.0 33 684.0 34 1098.0 35 603.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.28607151787947 10.902725681420355 12.028007001750437 32.78319579894974 2 24.831207801950487 13.4783695923981 31.58289572393098 30.107526881720432 3 23.20580145036259 21.48037009252313 21.555388847211805 33.758439609902474 4 30.457614403600903 27.656914228557138 17.92948237059265 23.95598899724931 5 27.35683920980245 28.35708927231808 20.955238809702426 23.330832708177045 6 22.807017543859647 31.00250626566416 23.583959899749374 22.606516290726816 7 18.97974493623406 22.655663915978995 36.18404601150287 22.18054513628407 8 21.155288822205552 21.80545136284071 28.232058014503625 28.80720180045011 9 21.50537634408602 20.930232558139537 30.182545636409102 27.38184546136534 10-11 24.243560890222557 29.319829957489375 22.405601400350086 24.031007751937985 12-13 25.693923480870218 22.13053263315829 24.33108277069267 27.84446111527882 14-15 24.5311327831958 24.143535883970994 25.11877969492373 26.206551637909474 16-17 24.706176544136035 23.74343585896474 25.543885971492873 26.006501625406354 18-19 25.11877969492373 23.568392098024507 24.268567141785446 27.04426106526632 20-21 24.81870467616904 24.293573393348336 24.88122030507627 26.006501625406354 22-23 24.843710927731934 24.793698424606152 24.418604651162788 25.943985996499126 24-25 24.5311327831958 24.06851712928232 24.193548387096776 27.206801700425103 26-27 24.281070267566893 24.056014003500874 25.468867216804203 26.19404851212803 28-29 24.85621405351338 24.44361090272568 23.893473368342086 26.806701675418854 30-31 24.8062015503876 24.406101525381345 24.293573393348336 26.494123530882717 32-33 23.918479619904975 24.281070267566893 24.85621405351338 26.944236059014752 34-35 24.943735933983497 23.618404601150285 24.318579644911228 27.11927981995499 36-37 24.55613903475869 23.99349837459365 24.36859214803701 27.081770442610654 38-39 25.468867216804203 23.305826456614152 24.01850462615654 27.206801700425103 40-41 25.09377344336084 24.193548387096776 23.40585146286572 27.306826706676667 42-43 24.893723430857715 24.33108277069267 23.618404601150285 27.156789197299325 44-45 24.74368592148037 24.618654663665918 23.655913978494624 26.981745436359088 46-47 25.393848462115532 24.618654663665918 23.568392098024507 26.419104776194047 48-49 25.081270317579396 24.118529632408105 24.056014003500874 26.744186046511626 50-51 25.3751875937969 24.224612306153077 23.67433716858429 26.725862931465734 52-53 25.912956478239117 24.524762381190595 23.111555777888945 26.450725362681343 54-55 25.400200100050025 23.699349674837418 23.861930965482742 27.03851925962982 56-57 24.843632724543408 23.942957217913435 23.980485364023014 27.23292469352014 58-59 25.3003003003003 24.974974974974977 23.51101101101101 26.213713713713716 60-61 24.86229344016024 24.57436154231347 23.447671507260893 27.1156735102654 62-63 24.70573503631355 23.829201101928373 25.006260956674183 26.458802905083896 64-65 25.331830703731526 24.104683195592287 24.06711745554721 26.496368645128975 66-67 25.397620538509706 23.681903569192237 23.757044458359424 27.163431433938634 68-69 25.620145326985718 23.891255324480078 23.37759959909797 27.110999749436232 70-71 25.9435736677116 23.912225705329153 23.711598746081506 26.432601880877744 72-73 25.553877139979857 23.313192346424973 24.345417925478348 26.78751258811682 74-75 25.876549793360887 21.37048393547527 24.383415544594055 28.36955072656979 76 26.996336996336996 0.0 34.83516483516483 38.16849816849817 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 1.5 22 2.5 23 2.5 24 3.5 25 4.0 26 5.0 27 8.5 28 8.5 29 9.0 30 15.0 31 20.5 32 28.0 33 31.5 34 37.0 35 53.5 36 81.0 37 105.5 38 129.5 39 137.0 40 138.0 41 161.0 42 173.5 43 185.0 44 200.0 45 213.5 46 227.5 47 208.0 48 192.5 49 192.5 50 178.0 51 156.5 52 132.5 53 125.5 54 129.5 55 127.0 56 113.0 57 111.5 58 119.5 59 109.0 60 102.0 61 98.5 62 86.0 63 86.5 64 87.0 65 84.5 66 84.0 67 86.0 68 89.0 69 80.5 70 74.5 71 69.5 72 58.0 73 53.0 74 49.0 75 42.5 76 36.0 77 28.5 78 22.0 79 18.0 80 17.5 81 15.0 82 12.0 83 9.5 84 5.0 85 3.5 86 3.0 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.25 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 1.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 2.0 57 0.0 58 0.0 59 1.0 60 2.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 1.0 68 0.0 69 3.0 70 1.0 71 6.0 72 18.0 73 73.0 74 279.0 75 881.0 76 2730.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389801 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389801_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.84025 32.0 32.0 32.0 32.0 32.0 2 30.64975 32.0 32.0 32.0 32.0 32.0 3 30.33125 32.0 32.0 32.0 21.0 32.0 4 30.1145 32.0 32.0 32.0 21.0 32.0 5 30.2915 32.0 32.0 32.0 21.0 32.0 6 33.4845 36.0 36.0 36.0 21.0 36.0 7 33.6975 36.0 36.0 36.0 32.0 36.0 8 33.514 36.0 36.0 36.0 21.0 36.0 9 33.563 36.0 36.0 36.0 21.0 36.0 10-11 33.469375 36.0 36.0 36.0 26.5 36.0 12-13 33.52875 36.0 36.0 36.0 26.5 36.0 14-15 33.277375 36.0 36.0 36.0 21.0 36.0 16-17 33.40125 36.0 36.0 36.0 21.0 36.0 18-19 33.15 36.0 36.0 36.0 21.0 36.0 20-21 33.152375 36.0 36.0 36.0 21.0 36.0 22-23 33.243875 36.0 36.0 36.0 21.0 36.0 24-25 33.143 36.0 36.0 36.0 17.5 36.0 26-27 32.984375 36.0 36.0 36.0 14.0 36.0 28-29 33.004125 36.0 36.0 36.0 14.0 36.0 30-31 32.8305 36.0 36.0 36.0 14.0 36.0 32-33 32.740125 36.0 36.0 36.0 14.0 36.0 34-35 32.753625 36.0 36.0 36.0 14.0 36.0 36-37 32.76270337922403 36.0 36.0 36.0 14.0 36.0 38-39 32.623279098873596 36.0 36.0 36.0 14.0 36.0 40-41 32.42493086305289 36.0 36.0 36.0 14.0 36.0 42-43 32.479088404708236 36.0 36.0 36.0 14.0 36.0 44-45 32.29251189581768 36.0 34.0 36.0 14.0 36.0 46-47 32.26383671424993 36.0 34.0 36.0 14.0 36.0 48-49 32.13548710242925 36.0 32.0 36.0 14.0 36.0 50-51 32.1002004008016 36.0 32.0 36.0 14.0 36.0 52-53 31.78431863727455 36.0 32.0 36.0 14.0 36.0 54-55 31.664078156312627 36.0 32.0 36.0 14.0 36.0 56-57 31.615890741382515 36.0 32.0 36.0 14.0 36.0 58-59 31.357894736842105 36.0 32.0 36.0 14.0 36.0 60-61 31.285814897413836 36.0 32.0 36.0 14.0 36.0 62-63 31.26611487333835 36.0 32.0 36.0 14.0 36.0 64-65 31.0522949586155 36.0 32.0 36.0 14.0 36.0 66-67 30.897018735375674 36.0 32.0 36.0 14.0 36.0 68-69 30.993851944792972 36.0 32.0 36.0 14.0 36.0 70-71 30.496967279675214 36.0 27.0 36.0 14.0 36.0 72-73 30.679817541613318 36.0 29.5 36.0 14.0 36.0 74-75 30.329126143101483 36.0 27.0 36.0 14.0 36.0 76 28.892831281679943 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 6.0 5 3.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 3.0 17 7.0 18 7.0 19 4.0 20 13.0 21 12.0 22 19.0 23 20.0 24 42.0 25 64.0 26 92.0 27 122.0 28 160.0 29 215.0 30 294.0 31 337.0 32 434.0 33 646.0 34 947.0 35 543.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.21331997996995 17.100650976464696 11.29193790686029 29.394091136705057 2 27.641462193289932 22.233350025037556 27.691537305958942 22.43365047571357 3 26.783479349186486 25.281602002503128 20.876095118898625 27.058823529411764 4 30.83854818523154 31.389236545682103 16.32040050062578 21.451814768460576 5 29.236545682102626 31.639549436795996 18.072590738423028 21.051314142678347 6 23.103879849812266 33.61702127659574 19.774718397997496 23.504380475594495 7 24.20525657071339 16.37046307884856 34.593241551939926 24.831038798498124 8 25.087719298245613 21.052631578947366 23.834586466165415 30.025062656641605 9 25.357411587659897 21.068472535741158 25.407574617506896 28.16654125909205 10-11 28.135975915704968 26.60561966884094 19.86954340190667 25.388861013547416 12-13 27.82936010037641 21.07904642409034 23.538268506900877 27.55332496863237 14-15 25.99472825404795 23.873478097150745 24.95293083971382 25.178862809087487 16-17 27.893547577203115 22.633693196083353 22.872206879236757 26.600552347476775 18-19 26.34617798418476 23.258441069411322 23.798167440692858 26.59721350571106 20-21 27.692693949284457 23.98945518453427 23.424554356013054 24.893296510168213 22-23 26.914386141099673 24.315842329902086 21.98091890534773 26.788852623650516 24-25 26.22724419334589 24.50721908349027 23.10106716886378 26.164469554300062 26-27 26.705187790478586 24.406481597789224 22.509734957919857 26.378595653812337 28-29 27.346887550200805 23.519076305220885 22.414658634538153 26.71937751004016 30-31 26.5470064014058 25.66838207606376 22.96975021965608 24.81486130287436 32-33 26.534454625329484 24.852516631103303 22.944646667503452 25.66838207606376 34-35 27.97035920622959 24.654609394624465 21.828686259733736 25.546345139412207 36-37 25.94173782019086 24.623304871923658 23.556002009040682 25.8789552988448 38-39 27.37886015566156 24.679889530504646 22.269645995480793 25.671604318353005 40-41 27.10843373493976 23.920682730923694 22.54016064257028 26.430722891566266 42-43 27.341200100426814 24.617122771780064 22.181772533266383 25.85990459452674 44-45 25.77203113231233 23.914135074064774 23.123273914135073 27.190559879487825 46-47 27.37198795180723 23.406124497991968 22.552710843373493 26.669176706827308 48-49 27.929172422453853 23.345472811754362 22.830591485620996 25.89476328017079 50-51 27.4827369742624 23.741368487131197 22.661644695543 26.1142498430634 52-53 27.2772961427315 23.55823595929137 23.533107174268125 25.631360723709008 54-55 26.670015067805124 23.593671521848318 23.09141135107986 26.644902059266702 56-57 26.59801582318222 23.70965716438528 22.99384654024865 26.69848047218385 58-59 27.239602965196635 22.942580726221887 22.867194371152156 26.950621937429325 60-61 27.601809954751133 23.76822523881347 22.637003519356462 25.992961287078938 62-63 27.203016970458833 23.104965430546827 23.846637335009426 25.845380263984914 64-65 27.118430978124213 24.62911742519487 22.290671360321852 25.96178023635907 66-67 26.926461345065995 24.450031426775613 23.142677561282213 25.480829666876176 68-69 26.374041001131932 24.726449503207142 23.330398691988428 25.569110803672494 70-71 27.062082861100617 24.467951139654957 22.679763253998235 25.790202745246187 72-73 26.77443798939126 24.42535993937863 22.84667845415509 25.95352361707502 74-75 27.408593541499865 20.789965305577795 24.833199893247933 26.968241259674407 76 29.749364329822015 0.0 32.836905194333454 37.41373047584453 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 2.5 2 1.0 3 2.5 4 3.0 5 2.5 6 1.5 7 1.0 8 1.0 9 0.5 10 0.0 11 0.5 12 1.0 13 0.5 14 1.0 15 1.0 16 1.5 17 3.5 18 4.0 19 4.0 20 3.0 21 1.5 22 1.0 23 2.5 24 4.5 25 4.5 26 6.0 27 10.0 28 15.0 29 18.5 30 17.0 31 17.0 32 21.0 33 24.0 34 35.5 35 51.0 36 61.0 37 74.5 38 99.0 39 112.5 40 127.5 41 166.5 42 193.0 43 183.0 44 170.0 45 183.5 46 191.5 47 181.5 48 172.0 49 169.5 50 176.5 51 161.0 52 131.0 53 123.0 54 121.5 55 126.5 56 121.0 57 115.0 58 122.5 59 123.5 60 118.0 61 111.5 62 106.5 63 110.0 64 108.0 65 104.0 66 101.0 67 91.5 68 96.5 69 90.5 70 77.5 71 77.5 72 80.5 73 76.0 74 60.0 75 50.0 76 44.5 77 33.0 78 25.5 79 23.0 80 18.5 81 12.5 82 9.0 83 10.0 84 8.0 85 3.5 86 1.5 87 1.0 88 1.5 89 1.5 90 0.5 91 0.0 92 0.0 93 0.5 94 1.0 95 1.0 96 1.0 97 0.5 98 0.5 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.15 3 0.125 4 0.125 5 0.125 6 0.125 7 0.125 8 0.25 9 0.325 10-11 0.35000000000000003 12-13 0.375 14-15 0.41250000000000003 16-17 0.42500000000000004 18-19 0.41250000000000003 20-21 0.42500000000000004 22-23 0.42500000000000004 24-25 0.43750000000000006 26-27 0.4875 28-29 0.4 30-31 0.41250000000000003 32-33 0.41250000000000003 34-35 0.475 36-37 0.3254067584480601 38-39 0.3003754693366708 40-41 0.25037556334501754 42-43 0.25043826696719257 44-45 0.25043826696719257 46-47 0.2253944402704733 48-49 0.28800400701227147 50-51 0.23797595190380763 52-53 0.31312625250501 54-55 0.250501002004008 56-57 0.238035580055124 58-59 0.2631578947368421 60-61 0.25075225677031093 62-63 0.2382743917732631 64-65 0.2508151492350138 66-67 0.22576194656967266 68-69 0.2383939774153074 70-71 0.23869346733668342 72-73 0.22681451612903228 74-75 0.23961661341853036 76 0.3258508327299059 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 5.0 36 0.0 37 0.0 38 0.0 39 0.0 40 2.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 1.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 2.0 57 0.0 58 0.0 59 1.0 60 2.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 1.0 68 0.0 69 4.0 70 2.0 71 3.0 72 16.0 73 71.0 74 266.0 75 861.0 76 2762.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49660206393153 98.825 2 0.37754845205134663 0.75 3 0.10067958721369243 0.3 4 0.0 0.0 5 0.025169896803423106 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 997872 spots for SRR11389801.sra Written 997872 spots for SRR11389801.sra Read 997872 spots for SRR11389801.sra Written 997872 spots for SRR11389801.sra Read 997888 spots for SRR11389801.sra Written 997888 spots for SRR11389801.sra Read 997872 spots for SRR11389801.sra Written 997872 spots for SRR11389801.sra Read 997872 spots for SRR11389801.sra Written 997872 spots for SRR11389801.sra Read 997872 spots for SRR11389801.sra Written 997872 spots for SRR11389801.sra Read 997872 spots for SRR11389801.sra Written 997872 spots for SRR11389801.sra Read 997872 spots for SRR11389801.sra Written 997872 spots for SRR11389801.sra Read 997872 spots for SRR11389801.sra Written 997872 spots for SRR11389801.sra Read 997872 spots for SRR11389801.sra Written 997872 spots for SRR11389801.sra Read 997872 spots for SRR11389801.sra Written 997872 spots for SRR11389801.sra Read 997872 spots for SRR11389801.sra Written 997872 spots for SRR11389801.sra Read 997872 spots for SRR11389801.sra Written 997872 spots for SRR11389801.sra Read 997872 spots for SRR11389801.sra Written 997872 spots for SRR11389801.sra Read 997872 spots for SRR11389801.sra Written 997872 spots for SRR11389801.sra Read 997872 spots for SRR11389801.sra Written 997872 spots for SRR11389801.sra Read 997872 spots for SRR11389801.sra Written 997872 spots for SRR11389801.sra Read 997872 spots for SRR11389801.sra Written 997872 spots for SRR11389801.sra Read 997872 spots for SRR11389801.sra Written 997872 spots for SRR11389801.sra Read 997872 spots for SRR11389801.sra Written 997872 spots for SRR11389801.sra SRR ids: ['SRR11389801.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p_dt0_u3 SRR11389801.sra spots: 19957456 blocks: [[1, 997872], [997873, 1995744], [1995745, 2993616], [2993617, 3991488], [3991489, 4989360], [4989361, 5987232], [5987233, 6985104], [6985105, 7982976], [7982977, 8980848], [8980849, 9978720], [9978721, 10976592], [10976593, 11974464], [11974465, 12972336], [12972337, 13970208], [13970209, 14968080], [14968081, 15965952], [15965953, 16963824], [16963825, 17961696], [17961697, 18959568], [18959569, 19957456]] SRR11389801 file size 3798840 SRR11389801 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389801 SRR11389801_1.fastq SRR11389801_2.fastq Input file: SRR11389801_1.fastq Paired file: SRR11389801_2.fastq trimmed: SRR11389801-trimmed-pair1.fastq, SRR11389801-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:51:33 2024 >> started Sat Dec 7 06:51:51 2024 >> done (17.759s) 19957456 read pairs processed; of these: 740 ( 0.00%) short read pairs filtered out after trimming by size control 20739 ( 0.10%) empty read pairs filtered out after trimming by size control 19935977 (99.89%) read pairs available; of these: 9445 ( 0.05%) trimmed read pairs available after processing 19926532 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 37 0.00% 19 7 0.00% 20 32 0.00% 21 14 0.00% 22 33 0.00% 23 19 0.00% 24 43 0.00% 25 22 0.00% 26 48 0.00% 27 28 0.00% 28 36 0.00% 29 40 0.00% 30 38 0.00% 31 23 0.00% 32 40 0.00% 33 34 0.00% 34 43 0.00% 35 248 0.00% 36 268 0.00% 37 302 0.00% 38 301 0.00% 39 378 0.00% 40 402 0.00% 41 469 0.00% 42 474 0.00% 43 537 0.00% 44 612 0.00% 45 660 0.00% 46 752 0.00% 47 757 0.00% 48 911 0.00% 49 883 0.00% 50 985 0.00% 51 1116 0.01% 52 1215 0.01% 53 1268 0.01% 54 1389 0.01% 55 1721 0.01% 56 1952 0.01% 57 2119 0.01% 58 2343 0.01% 59 2475 0.01% 60 2663 0.01% 61 2809 0.01% 62 3041 0.02% 63 3390 0.02% 64 3876 0.02% 65 4273 0.02% 66 4661 0.02% 67 5195 0.03% 68 5048 0.03% 69 5847 0.03% 70 6914 0.03% 71 9499 0.05% 72 22233 0.11% 73 165670 0.83% 74 1361246 6.83% 75 8678891 43.53% 76 9625647 48.28% 19935977 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=18 prefix-density=0.29 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=17 fanout-score=192.98 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=21.5 sequence=CCGCCGCCGCCG criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=18 prefix-density=0.22 prefix-fanout=2.4 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=215.63 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=24.2 sequence=CCGCCGCCGCCTCC SRR11389801 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:52:21 Started mapping on | Dec 07 06:52:21 Finished on | Dec 07 06:54:15 Mapping speed, Million of reads per hour | 629.56 Number of input reads | 19935977 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 17826005 Uniquely mapped reads % | 89.42% Average mapped length | 149.95 Number of splices: Total | 7713111 Number of splices: Annotated (sjdb) | 7370700 Number of splices: GT/AG | 7609145 Number of splices: GC/AG | 93492 Number of splices: AT/AC | 3674 Number of splices: Non-canonical | 6800 Mismatch rate per base, % | 1.17% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1006816 % of reads mapped to multiple loci | 5.05% Number of reads mapped to too many loci | 35860 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.68% % of reads unmapped: other | 0.68% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1103163 1103163 1103163 N_multimapping 1006816 1006816 1006816 N_noFeature 582702 17352250 737117 N_ambiguous 410766 2326 95725 UnstrandedReadsAssigned:16832537 PositiveStrandReadsAssigned:471429 NegativeStrandReadsAssigned:16993163 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389801 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389801-trimmed-pair1.fastq SRR11389801-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,935,977 reads, 18,012,771 reads pseudoaligned [quant] estimated average fragment length: 186.243 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52973 SRR11389801.ke.tsv 35125 SRR11389801.se.tsv 88098 total ==> SRR11389801.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 750.926 0 0 PNS24247 1044 858.757 28.4928 2.66661 PNS24249 1928 1742.76 237.826 10.9678 PNS24246 1044 858.757 28.4928 2.66661 PNS24248 1044 858.757 28.4928 2.66661 PNS24244 1471 1285.76 19.6953 1.23112 PNS24243 293 120.07 0 0 KQK14069 1603 1417.76 9289.11 526.584 KQK14071 474 290.544 880.647 243.605 ==> SRR11389801.se.tsv <== BRADI_1g14170v3 10854 BRADI_1g53295v3 103 BRADI_1g59795v3 428 BRADI_1g07683v3 0 BRADI_1g00485v3 19 BRADI_1g20270v3 1220 BRADI_1g74790v3 414 BRADI_1g09890v3 7 BRADI_1g77505v3 285 BRADI_1g48960v3 0 SRR11389801 completed mapping pipeline successfully