Starting /dee2/code/volunteer_pipeline.sh SRR11389802 current disk space = 1545010536448 free memory = 1600578216 SRR11389802 SRAfilesize eb5bc6998159c22cdb733c427fe644d4 SRR11389802.sra SRR11389802.sra file validated SRR11389802 is paired end SRR11389802 is conventional basespace SRR11389802 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389802_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.106 32.0 32.0 32.0 32.0 32.0 2 31.1925 32.0 32.0 32.0 32.0 32.0 3 31.22675 32.0 32.0 32.0 32.0 32.0 4 31.193 32.0 32.0 32.0 32.0 32.0 5 31.15375 32.0 32.0 32.0 32.0 32.0 6 34.26775 36.0 36.0 36.0 32.0 36.0 7 34.13225 36.0 36.0 36.0 32.0 36.0 8 34.09 36.0 36.0 36.0 32.0 36.0 9 34.33625 36.0 36.0 36.0 32.0 36.0 10-11 34.175625 36.0 36.0 36.0 32.0 36.0 12-13 34.291124999999994 36.0 36.0 36.0 32.0 36.0 14-15 34.162625 36.0 36.0 36.0 32.0 36.0 16-17 34.100750000000005 36.0 36.0 36.0 32.0 36.0 18-19 34.2025 36.0 36.0 36.0 32.0 36.0 20-21 34.062625 36.0 36.0 36.0 32.0 36.0 22-23 33.97125 36.0 36.0 36.0 32.0 36.0 24-25 33.793375 36.0 36.0 36.0 32.0 36.0 26-27 33.685125 36.0 36.0 36.0 29.5 36.0 28-29 33.633250000000004 36.0 36.0 36.0 27.0 36.0 30-31 33.762249999999995 36.0 36.0 36.0 32.0 36.0 32-33 33.446124999999995 36.0 36.0 36.0 27.0 36.0 34-35 33.461749999999995 36.0 36.0 36.0 27.0 36.0 36-37 33.50662665666417 36.0 36.0 36.0 24.0 36.0 38-39 33.213178294573645 36.0 36.0 36.0 17.5 36.0 40-41 33.2050512628157 36.0 36.0 36.0 17.5 36.0 42-43 33.06076519129782 36.0 36.0 36.0 14.0 36.0 44-45 33.14628657164291 36.0 36.0 36.0 17.5 36.0 46-47 32.72718179544886 36.0 36.0 36.0 14.0 36.0 48-49 32.674543635908975 36.0 36.0 36.0 14.0 36.0 50-51 32.660040010002504 36.0 36.0 36.0 14.0 36.0 52-53 32.538884721180295 36.0 34.0 36.0 14.0 36.0 54-55 32.42535633908477 36.0 34.0 36.0 14.0 36.0 56-57 32.40547636909227 36.0 32.0 36.0 14.0 36.0 58-59 32.11840460115029 36.0 32.0 36.0 14.0 36.0 60-61 31.956989247311824 36.0 32.0 36.0 14.0 36.0 62-63 31.8184092046023 36.0 32.0 36.0 14.0 36.0 64-65 31.833666833416707 36.0 32.0 36.0 14.0 36.0 66-67 31.455227613806905 36.0 32.0 36.0 14.0 36.0 68-69 31.270703027270454 36.0 32.0 36.0 14.0 36.0 70-71 31.230673004753562 36.0 32.0 36.0 14.0 36.0 72-73 31.079545069618383 36.0 32.0 36.0 14.0 36.0 74-75 30.971899178471816 36.0 32.0 36.0 14.0 36.0 76 30.659253945480632 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 0.0 23 6.0 24 10.0 25 23.0 26 50.0 27 85.0 28 121.0 29 197.0 30 278.0 31 364.0 32 533.0 33 741.0 34 1046.0 35 544.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.48562140535134 10.252563140785197 12.328082020505127 34.93373343335834 2 24.656164041010253 13.628407101775444 32.65816454113528 29.057264316079017 3 25.18129532383096 20.005001250312578 20.980245061265315 33.833458364591145 4 30.882720680170046 24.8062015503876 17.60440110027507 26.70667666916729 5 28.382095523880967 28.457114278569644 20.05501375343836 23.10577644411103 6 23.454317897371716 29.93742177722153 22.853566958698373 23.754693366708384 7 18.95473868467117 24.056014003500874 34.508627156789196 22.48062015503876 8 21.8304576144036 21.8304576144036 29.15728932233058 27.181795448862218 9 23.055763940985248 19.854963740935233 30.107526881720432 26.981745436359088 10-11 25.10627656914228 28.19454863715929 21.630407601900476 25.068767191797946 12-13 25.55638909727432 21.680420105026258 24.868717179294826 27.894473618404604 14-15 23.893473368342086 24.193548387096776 25.418854713678417 26.494123530882717 16-17 24.293573393348336 23.99349837459365 23.943485871467868 27.769442360590148 18-19 24.943735933983497 23.655913978494624 24.50612653163291 26.894223555888974 20-21 24.90622655663916 24.031007751937985 24.618654663665918 26.44411102775694 22-23 23.99349837459365 24.431107776944234 24.718679669917478 26.85671417854464 24-25 24.76869217304326 23.455863965991497 24.668667166791696 27.106776694173547 26-27 25.018754688672168 24.756189047261813 23.36834208552138 26.85671417854464 28-29 25.29382345586397 23.793448362090523 23.705926481620406 27.206801700425103 30-31 24.831207801950487 23.85596399099775 24.081020255063766 27.231807951987996 32-33 24.8062015503876 23.568392098024507 24.76869217304326 26.85671417854464 34-35 24.8062015503876 23.50587646911728 24.131032758189548 27.556889222305575 36-37 25.731432858214554 23.755938984746187 24.306076519129782 26.206551637909474 38-39 24.706176544136035 24.10602650662666 24.131032758189548 27.056764191047762 40-41 25.656414103525883 24.031007751937985 24.23105776444111 26.081520380095025 42-43 25.056264066016503 23.968492123030757 23.78094523630908 27.19429857464366 44-45 25.681420355088775 23.36834208552138 24.3935983995999 26.556639159789945 46-47 25.51887971992998 24.36859214803701 22.918229557389346 27.19429857464366 48-49 24.01850462615654 23.15578894723681 24.568642160540136 28.257064266066518 50-51 24.44361090272568 24.63115778944736 24.056014003500874 26.86921730432608 52-53 25.28132033008252 23.605901475368842 24.056014003500874 27.056764191047762 54-55 25.11877969492373 23.36834208552138 24.193548387096776 27.319329832458116 56-57 25.131282820705174 23.918479619904975 24.343585896474117 26.60665166291573 58-59 25.393848462115532 23.893473368342086 23.468367091772944 27.24431107776944 60-61 25.431357839459867 23.918479619904975 23.830957739434858 26.819204801200303 62-63 25.337668834417208 23.6368184092046 23.06153076538269 27.963981990995496 64-65 25.87543771885943 23.536768384192097 23.899449724862432 26.688344172086044 66-67 25.125062531265634 23.84942471235618 23.66183091545773 27.363681840920464 68-69 26.144608456342254 22.75456592444333 23.692769577182887 27.408056042031525 70-71 26.09457092819615 23.367525644233176 23.179884913685264 27.358018513885412 72-73 25.269491100526448 23.84056154424668 23.527199799448482 27.362747555778387 74-75 25.70524650672291 20.47192196150804 24.9406802003691 28.882151331399946 76 28.084648493543757 0.0 32.81922525107604 39.096126255380206 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 2.0 17 2.5 18 1.5 19 0.5 20 0.5 21 1.5 22 4.0 23 3.5 24 2.5 25 4.5 26 5.0 27 7.5 28 13.5 29 16.5 30 18.5 31 20.5 32 26.5 33 36.0 34 41.0 35 58.0 36 75.0 37 82.5 38 101.5 39 124.5 40 145.0 41 170.5 42 185.5 43 178.5 44 183.5 45 204.0 46 212.0 47 189.5 48 165.0 49 177.0 50 188.0 51 167.0 52 142.5 53 133.5 54 125.0 55 109.0 56 104.5 57 109.5 58 102.0 59 104.5 60 111.0 61 103.5 62 100.5 63 95.5 64 91.5 65 101.5 66 109.5 67 105.0 68 100.5 69 98.0 70 83.0 71 65.0 72 64.0 73 66.0 74 48.5 75 35.0 76 34.0 77 31.5 78 27.0 79 22.5 80 16.5 81 8.5 82 5.5 83 5.5 84 4.5 85 3.0 86 3.5 87 3.5 88 1.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.125 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 1.0 68 0.0 69 0.0 70 0.0 71 4.0 72 8.0 73 52.0 74 280.0 75 865.0 76 2788.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39546599496222 98.65 2 0.5037783375314862 1.0 3 0.05037783375314861 0.15 4 0.05037783375314861 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389802 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389802_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.68225 32.0 32.0 32.0 32.0 32.0 2 30.2295 32.0 32.0 32.0 21.0 32.0 3 30.04625 32.0 32.0 32.0 21.0 32.0 4 30.05475 32.0 32.0 32.0 21.0 32.0 5 30.16675 32.0 32.0 32.0 21.0 32.0 6 33.27225 36.0 36.0 36.0 21.0 36.0 7 33.2705 36.0 36.0 36.0 21.0 36.0 8 33.238 36.0 36.0 36.0 21.0 36.0 9 33.0395 36.0 36.0 36.0 21.0 36.0 10-11 33.136125 36.0 36.0 36.0 17.5 36.0 12-13 33.134125 36.0 36.0 36.0 21.0 36.0 14-15 32.950125 36.0 36.0 36.0 17.5 36.0 16-17 32.902375 36.0 36.0 36.0 14.0 36.0 18-19 33.03425 36.0 36.0 36.0 17.5 36.0 20-21 32.844625 36.0 36.0 36.0 14.0 36.0 22-23 32.64875000000001 36.0 36.0 36.0 14.0 36.0 24-25 32.815250000000006 36.0 36.0 36.0 14.0 36.0 26-27 32.524375 36.0 36.0 36.0 14.0 36.0 28-29 32.622749999999996 36.0 36.0 36.0 14.0 36.0 30-31 32.446125 36.0 36.0 36.0 14.0 36.0 32-33 32.406875 36.0 36.0 36.0 14.0 36.0 34-35 32.420375 36.0 36.0 36.0 14.0 36.0 36-37 32.374593241551935 36.0 32.0 36.0 14.0 36.0 38-39 32.31076345431789 36.0 34.0 36.0 14.0 36.0 40-41 32.110165247871805 36.0 32.0 36.0 14.0 36.0 42-43 31.907861792689033 36.0 32.0 36.0 14.0 36.0 44-45 31.83074611917877 36.0 32.0 36.0 14.0 36.0 46-47 31.728718077115673 36.0 32.0 36.0 14.0 36.0 48-49 31.564722083124686 36.0 32.0 36.0 14.0 36.0 50-51 31.6306960440661 36.0 32.0 36.0 14.0 36.0 52-53 31.2778612572001 36.0 32.0 36.0 14.0 36.0 54-55 31.14588029050839 36.0 32.0 36.0 14.0 36.0 56-57 31.237290257951415 36.0 32.0 36.0 14.0 36.0 58-59 30.943150513398447 36.0 32.0 36.0 14.0 36.0 60-61 30.82481843225645 36.0 29.5 36.0 14.0 36.0 62-63 30.79809619238477 36.0 29.5 36.0 14.0 36.0 64-65 30.463552104208418 36.0 27.0 36.0 14.0 36.0 66-67 30.455160320641284 36.0 27.0 36.0 14.0 36.0 68-69 30.29090453520421 36.0 27.0 36.0 14.0 36.0 70-71 30.136483227899525 36.0 27.0 36.0 14.0 36.0 72-73 30.100356521032353 36.0 27.0 36.0 14.0 36.0 74-75 29.9004592983139 36.0 27.0 36.0 14.0 36.0 76 28.94649446494465 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 0.0 5 4.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 9.0 17 17.0 18 13.0 19 7.0 20 9.0 21 19.0 22 16.0 23 31.0 24 48.0 25 88.0 26 111.0 27 133.0 28 161.0 29 259.0 30 295.0 31 386.0 32 544.0 33 645.0 34 799.0 35 396.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.19709491610318 17.63085399449036 10.543451039318807 30.628600050087652 2 29.476584022038566 21.462559479088405 27.42299023290759 21.63786626596544 3 27.2090112640801 25.65707133917397 20.750938673341675 26.382978723404253 4 30.21276595744681 30.43804755944931 15.969962453066334 23.379224030037545 5 27.95994993742178 32.59073842302879 18.523153942428035 20.926157697121404 6 23.204005006257823 31.76470588235294 20.650813516896118 24.380475594493117 7 23.85481852315394 16.270337922403 32.91614518147685 26.958698372966204 8 24.130162703379224 21.226533166458072 23.053817271589487 31.589486858573217 9 24.94365138993238 22.063611319809667 24.94365138993238 28.049085900325572 10-11 28.07567025808068 26.885492357805063 18.692057128539215 26.34678025557504 12-13 27.58707090954648 20.15785517414182 23.640691556001002 28.614382360310696 14-15 26.1283851554664 23.8716148445336 23.971915747241727 26.028084252758276 16-17 27.53259779338014 23.382647943831493 22.37963891675025 26.705115346038117 18-19 27.600902481825017 23.364251692153424 22.374028578591126 26.660817247430437 20-21 26.987710057687487 23.6518685728618 22.736393278154 26.624028091296715 22-23 28.329571106094807 24.216202658640583 21.83345874090795 25.62076749435666 24-25 26.843029087261783 24.398194583751255 22.367101303911735 26.391675025075223 26-27 26.840586981061083 25.222626363978428 22.46331368368243 25.473472971278067 28-29 27.287540737026823 23.640010027575833 21.872649786914014 27.19979944848333 30-31 25.632990724492355 24.291802456756077 22.86287290047631 27.212333918275256 32-33 26.52293807971923 24.22913010779644 22.46176986713462 26.78616194534971 34-35 27.016179606170827 24.0687319704001 22.011789790543084 26.903298632885992 36-37 28.087774294670847 23.510971786833856 22.557993730407524 25.843260188087775 38-39 27.49498495486459 24.084754262788366 22.254262788365097 26.165997993981943 40-41 28.3153672599649 23.865630483830532 21.183253948357986 26.63574830784658 42-43 27.337678616194534 23.401855101529208 22.035597894209076 27.224868388067186 44-45 27.213443691998997 24.01555053925257 22.322548281916227 26.448457486832204 46-47 27.224868388067186 23.351717222361497 22.436700927550763 26.986713462020557 48-49 26.56132430398796 24.19112114371708 22.247303737145725 27.000250815149236 50-51 26.705115346038117 24.0346038114343 22.931293881644933 26.32898696088265 52-53 27.586206896551722 23.924764890282134 22.018808777429467 26.470219435736674 54-55 28.11481574329406 24.12885434946102 21.43394334419654 26.322386563048383 56-57 27.14966156931562 24.091250940085235 22.098270243168713 26.660817247430437 58-59 27.64890282131661 24.852664576802507 21.253918495297803 26.244514106583072 60-61 26.68004012036108 23.64593781344032 22.15396188565697 27.520060180541623 62-63 27.28184553660983 24.34804413239719 22.367101303911735 26.00300902708124 64-65 28.016052169551042 24.316528718334588 21.356909957361424 26.31050915475295 66-67 28.309929789368105 22.71815446339017 23.00651955867603 25.9653961885657 68-69 27.22027094831912 24.197190165579528 22.528850978424487 26.05368790767687 70-71 27.00702458605118 23.94631209232313 22.027094831911693 27.019568489713997 72-73 27.548834278512917 23.011972274732198 22.785129174543165 26.65406427221172 74-75 27.478376580172988 20.39920159680639 24.644045242847636 27.478376580172988 76 29.785661492978566 0.0 31.263858093126384 38.95048041389505 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 2.5 2 0.5 3 1.0 4 1.0 5 1.0 6 0.5 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.5 15 1.5 16 2.0 17 1.5 18 1.0 19 1.5 20 2.5 21 2.5 22 2.5 23 4.0 24 4.5 25 6.5 26 7.0 27 7.0 28 11.5 29 12.5 30 14.5 31 19.0 32 20.0 33 25.0 34 38.0 35 60.5 36 71.5 37 68.5 38 88.5 39 108.0 40 114.0 41 135.0 42 144.0 43 162.0 44 182.5 45 168.0 46 157.5 47 153.5 48 150.0 49 149.0 50 152.5 51 156.5 52 147.5 53 140.5 54 142.5 55 145.0 56 138.0 57 133.5 58 131.0 59 111.0 60 112.5 61 116.5 62 101.5 63 98.5 64 101.0 65 106.5 66 117.0 67 122.0 68 118.5 69 111.5 70 97.0 71 88.5 72 81.5 73 72.0 74 57.0 75 43.0 76 44.0 77 36.0 78 23.5 79 20.5 80 20.0 81 17.5 82 12.0 83 9.0 84 8.5 85 5.5 86 2.0 87 1.0 88 0.5 89 0.5 90 1.0 91 1.0 92 1.0 93 1.0 94 0.5 95 1.0 96 2.0 97 1.5 98 1.5 99 3.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.17500000000000002 3 0.125 4 0.125 5 0.125 6 0.125 7 0.125 8 0.125 9 0.17500000000000002 10-11 0.22499999999999998 12-13 0.22499999999999998 14-15 0.3 16-17 0.3 18-19 0.27499999999999997 20-21 0.325 22-23 0.325 24-25 0.3 26-27 0.3375 28-29 0.27499999999999997 30-31 0.27499999999999997 32-33 0.27499999999999997 34-35 0.3375 36-37 0.18773466833541927 38-39 0.17521902377972465 40-41 0.12518778167250877 42-43 0.12518778167250877 44-45 0.17526289434151227 46-47 0.12518778167250877 48-49 0.17526289434151227 50-51 0.15022533800701052 52-53 0.13774104683195593 54-55 0.10017530678687703 56-57 0.10017530678687703 58-59 0.13774104683195593 60-61 0.12521913348359628 62-63 0.1002004008016032 64-65 0.125250501002004 66-67 0.1002004008016032 68-69 0.12528188423953898 70-71 0.10025062656641603 72-73 0.10071761299257208 74-75 0.10634055562940316 76 0.14760147601476015 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 5.0 36 0.0 37 0.0 38 0.0 39 1.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 1.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 1.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 1.0 68 0.0 69 0.0 70 2.0 71 7.0 72 21.0 73 63.0 74 273.0 75 915.0 76 2710.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21796165489405 98.32499999999999 2 0.7063572149344097 1.4000000000000001 3 0.050454086781029264 0.15 4 0.0 0.0 5 0.025227043390514632 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.025 47 0.025 0.0 0.0 0.0 0.025 48 0.025 0.0 0.0 0.0 0.025 49 0.025 0.0 0.0 0.0 0.025 50 0.025 0.0 0.0 0.0 0.025 51 0.025 0.0 0.0 0.0 0.025 52 0.025 0.0 0.0 0.0 0.025 53 0.025 0.0 0.0 0.0 0.025 54 0.025 0.0 0.0 0.0 0.025 55 0.025 0.0 0.0 0.0 0.025 56 0.025 0.0 0.0 0.0 0.025 57 0.025 0.0 0.0 0.0 0.025 58 0.025 0.0 0.0 0.0 0.025 59 0.025 0.0 0.0 0.0 0.025 60 0.025 0.0 0.0 0.0 0.025 61 0.025 0.0 0.0 0.0 0.025 62 0.025 0.0 0.0 0.0 0.025 63 0.025 0.0 0.0 0.0 0.025 64 0.025 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 824662 spots for SRR11389802.sra Written 824662 spots for SRR11389802.sra Read 824662 spots for SRR11389802.sra Written 824662 spots for SRR11389802.sra Read 824662 spots for SRR11389802.sra Written 824662 spots for SRR11389802.sra Read 824662 spots for SRR11389802.sra Written 824662 spots for SRR11389802.sra Read 824662 spots for SRR11389802.sra Written 824662 spots for SRR11389802.sra Read 824662 spots for SRR11389802.sra Written 824662 spots for SRR11389802.sra Read 824662 spots for SRR11389802.sra Written 824662 spots for SRR11389802.sra Read 824662 spots for SRR11389802.sra Written 824662 spots for SRR11389802.sra Read 824662 spots for SRR11389802.sra Written 824662 spots for SRR11389802.sra Read 824662 spots for SRR11389802.sra Written 824662 spots for SRR11389802.sra Read 824662 spots for SRR11389802.sra Written 824662 spots for SRR11389802.sra Read 824662 spots for SRR11389802.sra Written 824662 spots for SRR11389802.sra Read 824662 spots for SRR11389802.sra Written 824662 spots for SRR11389802.sra Read 824662 spots for SRR11389802.sra Written 824662 spots for SRR11389802.sra Read 824662 spots for SRR11389802.sra Written 824662 spots for SRR11389802.sra Read 824662 spots for SRR11389802.sra Written 824662 spots for SRR11389802.sra Read 824662 spots for SRR11389802.sra Written 824662 spots for SRR11389802.sra Read 824662 spots for SRR11389802.sra Written 824662 spots for SRR11389802.sra Read 824662 spots for SRR11389802.sra Written 824662 spots for SRR11389802.sra Read 824668 spots for SRR11389802.sra Written 824668 spots for SRR11389802.sra SRR ids: ['SRR11389802.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_znwf_rb0 SRR11389802.sra spots: 16493246 blocks: [[1, 824662], [824663, 1649324], [1649325, 2473986], [2473987, 3298648], [3298649, 4123310], [4123311, 4947972], [4947973, 5772634], [5772635, 6597296], [6597297, 7421958], [7421959, 8246620], [8246621, 9071282], [9071283, 9895944], [9895945, 10720606], [10720607, 11545268], [11545269, 12369930], [12369931, 13194592], [13194593, 14019254], [14019255, 14843916], [14843917, 15668578], [15668579, 16493246]] SRR11389802 file size 3137030 SRR11389802 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389802 SRR11389802_1.fastq SRR11389802_2.fastq Input file: SRR11389802_1.fastq Paired file: SRR11389802_2.fastq trimmed: SRR11389802-trimmed-pair1.fastq, SRR11389802-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:53:55 2024 >> started Sat Dec 7 06:54:10 2024 >> done (15.624s) 16493246 read pairs processed; of these: 589 ( 0.00%) short read pairs filtered out after trimming by size control 21895 ( 0.13%) empty read pairs filtered out after trimming by size control 16470762 (99.86%) read pairs available; of these: 7953 ( 0.05%) trimmed read pairs available after processing 16462809 (99.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 7 0.00% 20 22 0.00% 21 12 0.00% 22 28 0.00% 23 25 0.00% 24 35 0.00% 25 18 0.00% 26 37 0.00% 27 25 0.00% 28 40 0.00% 29 40 0.00% 30 35 0.00% 31 22 0.00% 32 46 0.00% 33 28 0.00% 34 42 0.00% 35 185 0.00% 36 198 0.00% 37 213 0.00% 38 209 0.00% 39 214 0.00% 40 232 0.00% 41 251 0.00% 42 270 0.00% 43 291 0.00% 44 353 0.00% 45 339 0.00% 46 299 0.00% 47 345 0.00% 48 406 0.00% 49 440 0.00% 50 459 0.00% 51 477 0.00% 52 526 0.00% 53 615 0.00% 54 582 0.00% 55 692 0.00% 56 744 0.00% 57 913 0.01% 58 941 0.01% 59 1011 0.01% 60 1120 0.01% 61 1099 0.01% 62 1126 0.01% 63 1306 0.01% 64 1376 0.01% 65 1554 0.01% 66 1711 0.01% 67 2013 0.01% 68 1883 0.01% 69 2020 0.01% 70 2889 0.02% 71 3926 0.02% 72 14488 0.09% 73 128658 0.78% 74 1089132 6.61% 75 7029847 42.68% 76 8174933 49.63% 16470762 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=18 prefix-density=0.26 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=33.06 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.3 sequence=TTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCACGAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGTTCCTCCACCAAATTGTAATACAGAATCATCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCGTCGCGCAATAAATCAACAAAACCTAAAGTGATTTCGCGTTCCCCTTCTAACTTACCTACTACTGTACCGGCGTGGATATGATCTCCCCCAGACAT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=4.57 fanout-score-rank=12 prefix-density=0.29 prefix-fanout=3.4 sequence=GAGGGCATCAAGAAGTTCGA criterion=fanout-score sequence-density=0.13 sequence-density-rank=10 fanout-score=163.98 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=22.8 sequence=CCGCCGCCGCCTCC SRR11389802 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:54:43 Started mapping on | Dec 07 06:54:43 Finished on | Dec 07 06:56:34 Mapping speed, Million of reads per hour | 534.19 Number of input reads | 16470762 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 14430462 Uniquely mapped reads % | 87.61% Average mapped length | 149.80 Number of splices: Total | 6041587 Number of splices: Annotated (sjdb) | 5789703 Number of splices: GT/AG | 5962444 Number of splices: GC/AG | 71129 Number of splices: AT/AC | 2599 Number of splices: Non-canonical | 5415 Mismatch rate per base, % | 1.43% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 833804 % of reads mapped to multiple loci | 5.06% Number of reads mapped to too many loci | 25580 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.47% % of reads unmapped: other | 0.70% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1206501 1206501 1206501 N_multimapping 833804 833804 833804 N_noFeature 438307 14051891 560656 N_ambiguous 349404 1978 98140 UnstrandedReadsAssigned:13642751 PositiveStrandReadsAssigned:376593 NegativeStrandReadsAssigned:13771666 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389802 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389802-trimmed-pair1.fastq SRR11389802-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,470,762 reads, 14,695,945 reads pseudoaligned [quant] estimated average fragment length: 227.143 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52973 SRR11389802.ke.tsv 35125 SRR11389802.se.tsv 88098 total ==> SRR11389802.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 709.972 60.6627 8.00175 PNS24247 1044 817.857 10.9214 1.25056 PNS24249 1928 1701.86 143.573 7.9005 PNS24246 1044 817.857 10.9214 1.25056 PNS24248 1044 817.857 10.9214 1.25056 PNS24244 1471 1244.86 0 0 PNS24243 293 89.7341 0 0 KQK14069 1603 1376.86 5557.88 378.029 KQK14071 474 250.481 472.055 176.49 ==> SRR11389802.se.tsv <== BRADI_1g14170v3 6515 BRADI_1g53295v3 78 BRADI_1g59795v3 433 BRADI_1g07683v3 0 BRADI_1g00485v3 24 BRADI_1g20270v3 1019 BRADI_1g74790v3 96 BRADI_1g09890v3 5 BRADI_1g77505v3 263 BRADI_1g48960v3 0 SRR11389802 completed mapping pipeline successfully