Starting /dee2/code/volunteer_pipeline.sh SRR11389803 current disk space = 1545006514176 free memory = 1598705344 SRR11389803 SRAfilesize 9cac32f3f013c0db436f9724c53a28dd SRR11389803.sra SRR11389803.sra file validated SRR11389803 is paired end SRR11389803 is conventional basespace SRR11389803 read1 length is 48-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389803_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 48-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.06 32.0 32.0 32.0 32.0 32.0 2 31.10525 32.0 32.0 32.0 32.0 32.0 3 31.056 32.0 32.0 32.0 32.0 32.0 4 31.26475 32.0 32.0 32.0 32.0 32.0 5 31.21425 32.0 32.0 32.0 32.0 32.0 6 34.2835 36.0 36.0 36.0 32.0 36.0 7 34.217 36.0 36.0 36.0 32.0 36.0 8 34.14925 36.0 36.0 36.0 32.0 36.0 9 34.25125 36.0 36.0 36.0 32.0 36.0 10-11 34.226 36.0 36.0 36.0 32.0 36.0 12-13 34.377 36.0 36.0 36.0 32.0 36.0 14-15 34.244875 36.0 36.0 36.0 32.0 36.0 16-17 34.295625 36.0 36.0 36.0 32.0 36.0 18-19 34.142375 36.0 36.0 36.0 32.0 36.0 20-21 34.13 36.0 36.0 36.0 32.0 36.0 22-23 34.037625000000006 36.0 36.0 36.0 32.0 36.0 24-25 33.83325 36.0 36.0 36.0 32.0 36.0 26-27 33.784499999999994 36.0 36.0 36.0 32.0 36.0 28-29 33.707125000000005 36.0 36.0 36.0 29.5 36.0 30-31 33.701750000000004 36.0 36.0 36.0 29.5 36.0 32-33 33.491625 36.0 36.0 36.0 27.0 36.0 34-35 33.566500000000005 36.0 36.0 36.0 27.0 36.0 36-37 33.478125000000006 36.0 36.0 36.0 27.0 36.0 38-39 33.1905 36.0 36.0 36.0 17.5 36.0 40-41 33.299125000000004 36.0 36.0 36.0 21.0 36.0 42-43 33.316375 36.0 36.0 36.0 24.0 36.0 44-45 33.186625 36.0 36.0 36.0 17.5 36.0 46-47 32.966375 36.0 36.0 36.0 17.5 36.0 48-49 32.846995780195044 36.0 36.0 36.0 14.0 36.0 50-51 32.74793698424606 36.0 36.0 36.0 14.0 36.0 52-53 32.76213106553277 36.0 36.0 36.0 14.0 36.0 54-55 32.51057768689198 36.0 36.0 36.0 14.0 36.0 56-57 32.40805604203152 36.0 32.0 36.0 14.0 36.0 58-59 32.27608206154616 36.0 32.0 36.0 14.0 36.0 60-61 32.021646646646644 36.0 32.0 36.0 14.0 36.0 62-63 31.850975975975977 36.0 32.0 36.0 14.0 36.0 64-65 31.930930930930927 36.0 32.0 36.0 14.0 36.0 66-67 31.512449715046714 36.0 32.0 36.0 14.0 36.0 68-69 31.45769712140175 36.0 32.0 36.0 14.0 36.0 70-71 31.471946020232753 36.0 32.0 36.0 14.0 36.0 72-73 31.185000025264713 36.0 32.0 36.0 14.0 36.0 74-75 31.21586255108815 36.0 32.0 36.0 14.0 36.0 76 30.27471725647574 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 6.0 24 10.0 25 19.0 26 36.0 27 52.0 28 133.0 29 188.0 30 237.0 31 391.0 32 599.0 33 736.0 34 1034.0 35 558.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.5 11.025 12.15 35.325 2 24.425 14.649999999999999 33.6 27.325 3 24.65 21.925 21.65 31.775 4 28.199999999999996 26.900000000000002 18.5 26.400000000000002 5 24.575 31.45 22.125 21.85 6 21.555388847211805 31.282820705176295 24.306076519129782 22.85571392848212 7 17.474999999999998 24.075 36.425000000000004 22.025 8 19.675 22.225 29.5 28.599999999999998 9 21.325 20.974999999999998 30.125 27.575 10-11 22.787499999999998 30.0375 22.8625 24.3125 12-13 23.525 23.9375 25.162499999999998 27.375 14-15 23.525 24.175 25.674999999999997 26.625 16-17 24.462500000000002 24.712500000000002 25.025 25.8 18-19 23.25 25.0375 25.45 26.2625 20-21 22.8875 25.0625 26.0 26.05 22-23 23.075000000000003 25.337500000000002 25.4 26.187500000000004 24-25 23.6875 25.387500000000003 25.0125 25.912499999999998 26-27 23.525 25.4875 24.3625 26.625 28-29 23.0875 25.5375 25.25 26.125 30-31 23.7125 25.5625 24.474999999999998 26.25 32-33 22.9875 25.662499999999998 24.5625 26.787499999999998 34-35 23.95 25.15 25.2625 25.637500000000003 36-37 24.125 23.9875 24.3625 27.525 38-39 23.1625 26.1625 24.55 26.125 40-41 23.724999999999998 26.025 24.337500000000002 25.912499999999998 42-43 24.6625 25.2625 24.55 25.525 44-45 23.4625 25.374999999999996 25.05 26.1125 46-47 24.0125 25.124999999999996 24.6625 26.200000000000003 48-49 23.47793474184273 25.715714464308036 23.415426928366045 27.390923865483185 50-51 23.63090772693173 25.431357839459867 24.55613903475869 26.38159539884971 52-53 23.024012006003 25.850425212606304 24.949974987493746 26.17558779389695 54-55 24.002501563477175 25.77861163227017 24.40275171982489 25.816135084427767 56-57 23.505128846634975 24.856142106579934 25.2064048036027 26.432324243182386 58-59 24.218163622717036 26.294721040780583 24.718538904178132 24.768576432324245 60-61 24.024024024024023 24.88738738738739 24.587087087087088 26.5015015015015 62-63 23.76126126126126 25.675675675675674 24.6996996996997 25.863363363363362 64-65 23.786286286286288 25.375375375375377 24.6996996996997 26.13863863863864 66-67 23.476410962332626 25.691402828181705 24.364910524339884 26.46727568514579 68-69 22.991239048811014 24.81852315394243 24.98122653316646 27.2090112640801 70-71 24.467818682694716 25.156523916854496 24.58051590282995 25.79514149762084 72-73 24.842925358130184 24.528776074390553 24.729831615983915 25.89846695149535 74-75 24.190981432360743 21.949602122015914 26.379310344827587 27.480106100795755 76 25.975921196643558 0.0 36.41006931776724 37.6140094855892 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 1.0 24 1.5 25 1.5 26 2.0 27 3.0 28 6.5 29 13.0 30 17.0 31 19.5 32 33.5 33 48.0 34 55.5 35 58.5 36 67.5 37 93.5 38 116.5 39 151.0 40 180.5 41 202.0 42 217.0 43 217.5 44 227.5 45 236.5 46 241.0 47 217.0 48 200.0 49 210.5 50 206.5 51 185.5 52 173.5 53 174.5 54 164.0 55 143.0 56 128.0 57 112.0 58 94.0 59 95.5 60 90.5 61 73.5 62 64.0 63 63.5 64 70.5 65 76.0 66 61.5 67 49.5 68 48.0 69 48.0 70 46.5 71 40.0 72 41.0 73 36.0 74 27.5 75 24.5 76 22.0 77 21.0 78 18.0 79 13.5 80 9.0 81 5.0 82 5.0 83 4.5 84 4.0 85 3.5 86 2.0 87 1.0 88 1.5 89 1.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 48 1.0 49 0.0 50 0.0 51 1.0 52 0.0 53 0.0 54 1.0 55 0.0 56 0.0 57 0.0 58 0.0 59 1.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 0.0 68 0.0 69 1.0 70 2.0 71 4.0 72 18.0 73 75.0 74 250.0 75 904.0 76 2741.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389803 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389803_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.82125 32.0 32.0 32.0 32.0 32.0 2 30.35225 32.0 32.0 32.0 32.0 32.0 3 30.3955 32.0 32.0 32.0 27.0 32.0 4 30.32425 32.0 32.0 32.0 21.0 32.0 5 30.28 32.0 32.0 32.0 21.0 32.0 6 33.30975 36.0 36.0 36.0 21.0 36.0 7 33.486 36.0 36.0 36.0 21.0 36.0 8 33.4335 36.0 36.0 36.0 21.0 36.0 9 33.58825 36.0 36.0 36.0 21.0 36.0 10-11 33.30225 36.0 36.0 36.0 17.5 36.0 12-13 33.380624999999995 36.0 36.0 36.0 21.0 36.0 14-15 33.236125 36.0 36.0 36.0 21.0 36.0 16-17 33.284875 36.0 36.0 36.0 21.0 36.0 18-19 33.26125 36.0 36.0 36.0 21.0 36.0 20-21 33.073875 36.0 36.0 36.0 21.0 36.0 22-23 33.123625 36.0 36.0 36.0 21.0 36.0 24-25 33.018249999999995 36.0 36.0 36.0 17.5 36.0 26-27 32.950125 36.0 36.0 36.0 14.0 36.0 28-29 33.038624999999996 36.0 36.0 36.0 14.0 36.0 30-31 32.735375000000005 36.0 36.0 36.0 14.0 36.0 32-33 32.630375 36.0 36.0 36.0 14.0 36.0 34-35 32.74625 36.0 36.0 36.0 14.0 36.0 36-37 32.54881101376721 36.0 36.0 36.0 14.0 36.0 38-39 32.567459324155195 36.0 36.0 36.0 14.0 36.0 40-41 32.40943997347711 36.0 36.0 36.0 14.0 36.0 42-43 32.17901852779169 36.0 34.0 36.0 14.0 36.0 44-45 32.21487603305785 36.0 34.0 36.0 14.0 36.0 46-47 32.0167793638868 36.0 32.0 36.0 14.0 36.0 48-49 32.0523399980527 36.0 32.0 36.0 14.0 36.0 50-51 31.829909819639276 36.0 32.0 36.0 14.0 36.0 52-53 31.82753006012024 36.0 32.0 36.0 14.0 36.0 54-55 31.54653625717986 36.0 32.0 36.0 14.0 36.0 56-57 31.539213229766975 36.0 32.0 36.0 14.0 36.0 58-59 31.265221748935105 36.0 32.0 36.0 14.0 36.0 60-61 31.209273182957393 36.0 32.0 36.0 14.0 36.0 62-63 31.066791979949876 36.0 32.0 36.0 14.0 36.0 64-65 30.684837092731833 36.0 27.0 36.0 14.0 36.0 66-67 30.810872223175135 36.0 29.5 36.0 14.0 36.0 68-69 30.558159939834546 36.0 29.5 36.0 14.0 36.0 70-71 30.35071177918003 36.0 27.0 36.0 14.0 36.0 72-73 30.375748924077776 36.0 27.0 36.0 14.0 36.0 74-75 30.18382550094348 36.0 27.0 36.0 14.0 36.0 76 28.998881848676856 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 1.0 5 4.0 6 1.0 7 0.0 8 1.0 9 2.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 4.0 16 7.0 17 9.0 18 6.0 19 9.0 20 9.0 21 8.0 22 9.0 23 24.0 24 50.0 25 69.0 26 70.0 27 117.0 28 169.0 29 217.0 30 323.0 31 387.0 32 532.0 33 661.0 34 858.0 35 447.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.51551551551552 17.892892892892892 11.511511511511511 30.08008008008008 2 28.57857857857858 22.24724724724725 29.354354354354356 19.81981981981982 3 26.2012012012012 26.901901901901905 21.346346346346344 25.55055055055055 4 29.47947947947948 31.506506506506504 17.09209209209209 21.92192192192192 5 29.179179179179176 32.007007007007005 19.01901901901902 19.794794794794797 6 21.871871871871875 33.50850850850851 21.871871871871875 22.74774774774775 7 22.997997997998 16.14114114114114 35.810810810810814 25.05005005005005 8 25.632040050062578 22.052565707133915 23.829787234042556 28.48560700876095 9 25.93241551939925 21.376720901126408 25.50688360450563 27.183979974968707 10-11 27.139456208495176 27.816063149981208 19.74689888485152 25.297581756672095 12-13 27.124592629731765 21.67209827024317 23.0383554775633 28.16495362246177 14-15 26.401605418286717 24.106358961495044 24.60805217609432 24.88398344412392 16-17 27.44384489898356 24.41962605094742 22.66281842138286 25.47371062868616 18-19 26.418172690763054 25.31375502008032 22.678212851405622 25.589859437751006 20-21 26.945281124497996 23.93323293172691 23.406124497991968 25.71536144578313 22-23 27.21796963232526 24.29413979169281 23.265152465804995 25.222738110176934 24-25 26.50269795457397 24.72079307315849 23.641611243568832 25.134897728698707 26-27 26.575445643986946 24.642229475269897 23.939241777554606 24.84308310318855 28-29 26.897503450006273 23.999498180905785 23.7360431564421 25.36695521264584 30-31 26.772048676452137 24.965499937272615 22.845314264207754 25.417137122067494 32-33 26.044410989838163 25.50495546355539 23.648224814954208 24.80240873165224 34-35 26.6541117388575 25.260514752040176 22.749529190207156 25.335844318895166 36-37 26.270867327726872 24.92782728756119 23.421614158403415 25.37969122630852 38-39 26.64407630522088 25.426706827309236 22.13855421686747 25.790662650602407 40-41 27.19518314099348 24.460612142498743 23.582538886101354 24.761665830406425 42-43 26.364663069393902 24.97176559166771 23.22750658802861 25.436064750909775 44-45 26.50269795457397 24.984314217593173 22.938888191743004 25.574099636089848 46-47 26.838143036386448 25.094102885821833 22.810539523212046 25.257214554579672 48-49 26.340238543628374 25.17263025737602 24.092906465787824 24.394224733207786 50-51 26.53112449799197 24.284638554216865 23.920682730923694 25.26355421686747 52-53 28.0924274770815 24.789652141152832 23.018962702499056 24.098957679266608 54-55 26.99309478970496 24.569993722536097 22.962962962962962 25.47394852479598 56-57 26.39638508849002 24.06175473829547 24.0868582904481 25.45500188276641 58-59 26.917765222849972 24.97175141242938 23.854362837413685 24.25612052730697 60-61 26.623131985432625 25.15383649378375 23.18221775712671 25.04081376365691 62-63 26.808136614766447 24.962330487192368 23.63134103465595 24.59819186338523 64-65 26.381215469613263 25.23857358111502 23.756906077348066 24.623304871923658 66-67 26.126804770872567 25.51161330822348 23.79158819836786 24.569993722536097 68-69 28.104985558206707 24.237096571643853 22.692452593243754 24.96546527690569 70-71 26.545226130653266 25.23869346733668 23.680904522613066 24.535175879396984 72-73 25.97173144876325 24.68450277637557 23.47299343765775 25.870772337203434 74-75 27.234899328859058 21.838926174496645 24.7248322147651 26.201342281879192 76 29.895366218236173 0.0 34.56651718983558 35.53811659192825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 6.0 1 3.5 2 0.5 3 0.0 4 0.0 5 1.5 6 1.5 7 0.5 8 1.0 9 1.5 10 2.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.5 18 0.5 19 0.5 20 1.0 21 0.5 22 0.0 23 1.5 24 2.5 25 2.5 26 4.0 27 7.5 28 10.5 29 10.5 30 14.5 31 22.0 32 27.5 33 34.0 34 41.0 35 58.0 36 69.5 37 71.0 38 87.0 39 116.5 40 141.0 41 162.0 42 184.5 43 201.5 44 211.0 45 207.0 46 204.0 47 215.0 48 218.0 49 212.5 50 204.0 51 183.0 52 167.0 53 146.5 54 130.0 55 118.0 56 102.0 57 102.5 58 99.0 59 100.5 60 99.5 61 85.5 62 83.5 63 88.5 64 89.5 65 81.0 66 83.0 67 86.5 68 78.0 69 72.0 70 70.5 71 68.0 72 65.5 73 55.5 74 44.0 75 44.0 76 39.5 77 33.0 78 25.0 79 18.0 80 15.0 81 12.5 82 8.5 83 4.0 84 3.0 85 4.5 86 5.0 87 3.0 88 2.5 89 1.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.1 3 0.1 4 0.1 5 0.1 6 0.1 7 0.1 8 0.125 9 0.125 10-11 0.2375 12-13 0.27499999999999997 14-15 0.3375 16-17 0.3875 18-19 0.4 20-21 0.4 22-23 0.3875 24-25 0.3875 26-27 0.42500000000000004 28-29 0.36250000000000004 30-31 0.36250000000000004 32-33 0.36250000000000004 34-35 0.43750000000000006 36-37 0.2878598247809762 38-39 0.2753441802252816 40-41 0.2127925898109901 42-43 0.23785678517776665 44-45 0.2128725269221137 46-47 0.20035061357375405 48-49 0.25046963055729493 50-51 0.2004008016032064 52-53 0.26302605210420843 54-55 0.2254791431792559 56-57 0.18792282635930843 58-59 0.21297920320721622 60-61 0.2130325814536341 62-63 0.20050125313283207 64-65 0.20050125313283207 66-67 0.17546058403308684 68-69 0.18801704687891702 70-71 0.18808777429467086 72-73 0.1763668430335097 74-75 0.20093770931011384 76 0.2609019754006709 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 5.0 36 0.0 37 0.0 38 0.0 39 0.0 40 1.0 41 0.0 42 0.0 43 1.0 44 0.0 45 0.0 46 0.0 47 0.0 48 1.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 1.0 55 0.0 56 0.0 57 0.0 58 0.0 59 1.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 0.0 68 0.0 69 1.0 70 1.0 71 4.0 72 28.0 73 80.0 74 285.0 75 907.0 76 2683.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8747808665164 99.7 2 0.10017530678687703 0.2 3 0.0 0.0 4 0.025043826696719257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.025 0.0 0.0 62 0.0 0.0 0.025 0.0 0.0 63 0.0 0.0 0.025 0.0 0.0 64 0.0 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTGGA 20 0.006597501 52.218754 44 >>END_MODULE Read 900090 spots for SRR11389803.sra Written 900090 spots for SRR11389803.sra Read 900090 spots for SRR11389803.sra Written 900090 spots for SRR11389803.sra Read 900090 spots for SRR11389803.sra Written 900090 spots for SRR11389803.sra Read 900090 spots for SRR11389803.sra Written 900090 spots for SRR11389803.sra Read 900090 spots for SRR11389803.sra Written 900090 spots for SRR11389803.sra Read 900090 spots for SRR11389803.sra Written 900090 spots for SRR11389803.sra Read 900090 spots for SRR11389803.sra Written 900090 spots for SRR11389803.sra Read 900090 spots for SRR11389803.sra Written 900090 spots for SRR11389803.sra Read 900090 spots for SRR11389803.sra Written 900090 spots for SRR11389803.sra Read 900090 spots for SRR11389803.sra Written 900090 spots for SRR11389803.sra Read 900090 spots for SRR11389803.sra Written 900090 spots for SRR11389803.sra Read 900098 spots for SRR11389803.sra Written 900098 spots for SRR11389803.sra Read 900090 spots for SRR11389803.sra Written 900090 spots for SRR11389803.sra Read 900090 spots for SRR11389803.sra Written 900090 spots for SRR11389803.sra Read 900090 spots for SRR11389803.sra Written 900090 spots for SRR11389803.sra Read 900090 spots for SRR11389803.sra Written 900090 spots for SRR11389803.sra Read 900090 spots for SRR11389803.sra Written 900090 spots for SRR11389803.sra Read 900090 spots for SRR11389803.sra Written 900090 spots for SRR11389803.sra Read 900090 spots for SRR11389803.sra Written 900090 spots for SRR11389803.sra Read 900090 spots for SRR11389803.sra Written 900090 spots for SRR11389803.sra SRR ids: ['SRR11389803.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2qvrryku SRR11389803.sra spots: 18001808 blocks: [[1, 900090], [900091, 1800180], [1800181, 2700270], [2700271, 3600360], [3600361, 4500450], [4500451, 5400540], [5400541, 6300630], [6300631, 7200720], [7200721, 8100810], [8100811, 9000900], [9000901, 9900990], [9900991, 10801080], [10801081, 11701170], [11701171, 12601260], [12601261, 13501350], [13501351, 14401440], [14401441, 15301530], [15301531, 16201620], [16201621, 17101710], [17101711, 18001808]] SRR11389803 file size 3425245 SRR11389803 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389803 SRR11389803_1.fastq SRR11389803_2.fastq Input file: SRR11389803_1.fastq Paired file: SRR11389803_2.fastq trimmed: SRR11389803-trimmed-pair1.fastq, SRR11389803-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:53:05 2024 >> started Sat Dec 7 06:53:20 2024 >> done (14.960s) 18001808 read pairs processed; of these: 601 ( 0.00%) short read pairs filtered out after trimming by size control 10084 ( 0.06%) empty read pairs filtered out after trimming by size control 17991123 (99.94%) read pairs available; of these: 11744 ( 0.07%) trimmed read pairs available after processing 17979379 (99.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 5 0.00% 20 29 0.00% 21 13 0.00% 22 36 0.00% 23 21 0.00% 24 39 0.00% 25 34 0.00% 26 44 0.00% 27 34 0.00% 28 33 0.00% 29 38 0.00% 30 53 0.00% 31 31 0.00% 32 27 0.00% 33 33 0.00% 34 35 0.00% 35 177 0.00% 36 184 0.00% 37 181 0.00% 38 192 0.00% 39 184 0.00% 40 236 0.00% 41 202 0.00% 42 224 0.00% 43 255 0.00% 44 272 0.00% 45 287 0.00% 46 268 0.00% 47 304 0.00% 48 367 0.00% 49 363 0.00% 50 391 0.00% 51 408 0.00% 52 432 0.00% 53 489 0.00% 54 466 0.00% 55 620 0.00% 56 638 0.00% 57 812 0.00% 58 849 0.00% 59 920 0.01% 60 986 0.01% 61 858 0.00% 62 1035 0.01% 63 1170 0.01% 64 1242 0.01% 65 1353 0.01% 66 1511 0.01% 67 1805 0.01% 68 1621 0.01% 69 1943 0.01% 70 2640 0.01% 71 3905 0.02% 72 13949 0.08% 73 150675 0.84% 74 1336465 7.43% 75 8077945 44.90% 76 8381779 46.59% 17991123 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=181.45 fanout-score-rank=14 prefix-density=0.53 prefix-fanout=22.1 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=518.91 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=33.3 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=107.85 fanout-score-rank=22 prefix-density=1.37 prefix-fanout=18.0 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=434.83 fanout-score-rank=1 prefix-density=1.15 prefix-fanout=21.9 sequence=CCGCCGCCGCGA SRR11389803 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:53:57 Started mapping on | Dec 07 06:53:57 Finished on | Dec 07 06:55:37 Mapping speed, Million of reads per hour | 647.68 Number of input reads | 17991123 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 16335436 Uniquely mapped reads % | 90.80% Average mapped length | 149.77 Number of splices: Total | 7074510 Number of splices: Annotated (sjdb) | 6737497 Number of splices: GT/AG | 6979401 Number of splices: GC/AG | 82899 Number of splices: AT/AC | 6067 Number of splices: Non-canonical | 6143 Mismatch rate per base, % | 1.36% Deletion rate per base | 0.01% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 315024 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 42127 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.15% % of reads unmapped: other | 1.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1340668 1340668 1340668 N_multimapping 315024 315024 315024 N_noFeature 651718 15923635 812921 N_ambiguous 303558 2685 55982 UnstrandedReadsAssigned:15380160 PositiveStrandReadsAssigned:409116 NegativeStrandReadsAssigned:15466533 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389803 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389803-trimmed-pair1.fastq SRR11389803-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,991,123 reads, 15,886,224 reads pseudoaligned [quant] estimated average fragment length: 220.891 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52973 SRR11389803.ke.tsv 35125 SRR11389803.se.tsv 88098 total ==> SRR11389803.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 716.277 0 0 PNS24247 1044 824.109 81.9988 9.14878 PNS24249 1928 1708.11 673.853 36.2735 PNS24246 1044 824.109 81.9988 9.14878 PNS24248 1044 824.109 81.9988 9.14878 PNS24244 1471 1251.11 37.1509 2.73033 PNS24243 293 92.3383 0 0 KQK14069 1603 1383.11 16.4529 1.09377 KQK14071 474 256.526 1 0.358433 ==> SRR11389803.se.tsv <== BRADI_1g14170v3 27 BRADI_1g53295v3 17 BRADI_1g59795v3 296 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 840 BRADI_1g74790v3 16 BRADI_1g09890v3 0 BRADI_1g77505v3 331 BRADI_1g48960v3 1 SRR11389803 completed mapping pipeline successfully