Starting /dee2/code/volunteer_pipeline.sh SRR11389804 current disk space = 1544996052992 free memory = 1596379928 SRR11389804 SRAfilesize 7fbd6d324502bfe118f45bdfd7251c78 SRR11389804.sra SRR11389804.sra file validated SRR11389804 is paired end SRR11389804 is conventional basespace SRR11389804 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389804_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.0775 32.0 32.0 32.0 32.0 32.0 2 31.099 32.0 32.0 32.0 32.0 32.0 3 31.10625 32.0 32.0 32.0 32.0 32.0 4 31.204 32.0 32.0 32.0 32.0 32.0 5 31.19175 32.0 32.0 32.0 32.0 32.0 6 34.2385 36.0 36.0 36.0 32.0 36.0 7 34.11625 36.0 36.0 36.0 32.0 36.0 8 34.094 36.0 36.0 36.0 32.0 36.0 9 34.052 36.0 36.0 36.0 32.0 36.0 10-11 34.2385 36.0 36.0 36.0 32.0 36.0 12-13 34.270624999999995 36.0 36.0 36.0 32.0 36.0 14-15 34.203375 36.0 36.0 36.0 32.0 36.0 16-17 34.295874999999995 36.0 36.0 36.0 32.0 36.0 18-19 34.090375 36.0 36.0 36.0 32.0 36.0 20-21 34.076875 36.0 36.0 36.0 32.0 36.0 22-23 33.827375 36.0 36.0 36.0 32.0 36.0 24-25 33.797125 36.0 36.0 36.0 32.0 36.0 26-27 33.7675 36.0 36.0 36.0 32.0 36.0 28-29 33.66225 36.0 36.0 36.0 29.5 36.0 30-31 33.662 36.0 36.0 36.0 27.0 36.0 32-33 33.446875 36.0 36.0 36.0 24.0 36.0 34-35 33.369875 36.0 36.0 36.0 24.0 36.0 36-37 33.398974743685926 36.0 36.0 36.0 24.0 36.0 38-39 33.32945736434108 36.0 36.0 36.0 21.0 36.0 40-41 33.23255813953489 36.0 36.0 36.0 17.5 36.0 42-43 33.09052263065766 36.0 36.0 36.0 14.0 36.0 44-45 33.22868217054263 36.0 36.0 36.0 17.5 36.0 46-47 32.919979994998755 36.0 36.0 36.0 14.0 36.0 48-49 32.90985246311578 36.0 36.0 36.0 14.0 36.0 50-51 32.65003750937734 36.0 36.0 36.0 14.0 36.0 52-53 32.60665166291572 36.0 34.0 36.0 14.0 36.0 54-55 32.56626656664166 36.0 36.0 36.0 14.0 36.0 56-57 32.23105776444111 36.0 32.0 36.0 14.0 36.0 58-59 32.14678669667417 36.0 32.0 36.0 14.0 36.0 60-61 31.933108277069266 36.0 32.0 36.0 14.0 36.0 62-63 31.873843460865217 36.0 32.0 36.0 14.0 36.0 64-65 31.82058014503626 36.0 32.0 36.0 14.0 36.0 66-67 31.436984246061513 36.0 32.0 36.0 14.0 36.0 68-69 31.47524381095274 36.0 32.0 36.0 14.0 36.0 70-71 31.354894564061226 36.0 32.0 36.0 14.0 36.0 72-73 31.277156633770637 36.0 32.0 36.0 14.0 36.0 74-75 31.112222750439777 36.0 32.0 36.0 14.0 36.0 76 30.695970695970697 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 4.0 24 12.0 25 21.0 26 34.0 27 72.0 28 139.0 29 190.0 30 262.0 31 369.0 32 524.0 33 823.0 34 1014.0 35 532.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.58589647411853 11.47786946736684 12.478119529882472 32.45811452863216 2 23.680920230057513 14.47861965491373 33.9584896224056 27.881970492623154 3 25.256314078519633 22.080520130032507 21.905476369092273 30.75768942235559 4 27.781945486371594 28.08202050512628 18.254563640910227 25.881470367591895 5 25.881470367591895 31.45786446611653 21.75543885971493 20.905226306576644 6 23.08654327163582 30.415207603801903 24.037018509254626 22.461230615307652 7 17.62940735183796 23.85596399099775 37.38434608652163 21.13028257064266 8 19.80495123780945 22.43060765191298 30.08252063015754 27.68192048012003 9 21.13028257064266 21.80545136284071 30.682670667666915 26.38159539884971 10-11 24.143535883970994 29.819954988747188 22.280570142535634 23.755938984746187 12-13 24.681170292573142 22.818204551137786 23.643410852713178 28.857214303575894 14-15 23.280820205051263 25.006251562890725 25.76894223555889 25.943985996499126 16-17 24.20605151287822 23.893473368342086 25.056264066016503 26.84421105276319 18-19 24.33108277069267 25.331332833208304 24.243560890222557 26.094023505876468 20-21 23.34333583395849 25.256314078519633 24.99374843710928 26.406601650412604 22-23 23.518379594898725 26.19404851212803 25.081270317579396 25.206301575393848 24-25 23.48087021755439 25.081270317579396 24.99374843710928 26.44411102775694 26-27 23.380845211302827 24.831207801950487 24.88122030507627 26.906726681670417 28-29 23.705926481620406 25.09377344336084 24.681170292573142 26.51912978244561 30-31 24.518629657414355 24.981245311327832 25.168792198049513 25.331332833208304 32-33 23.143285821455365 25.44386096524131 25.218804701175294 26.19404851212803 34-35 24.01850462615654 24.956239059764943 24.18104526131533 26.84421105276319 36-37 25.056264066016503 24.293573393348336 23.793448362090523 26.85671417854464 38-39 23.730932733183295 25.1937984496124 25.681420355088775 25.393848462115532 40-41 23.85596399099775 25.79394848712178 24.306076519129782 26.04401100275069 42-43 24.418604651162788 25.98149537384346 23.818454613653415 25.78144536134033 44-45 23.868467116779193 26.30657664416104 23.705926481620406 26.11902975743936 46-47 24.3935983995999 25.743935983995996 24.131032758189548 25.731432858214554 48-49 24.718679669917478 24.006001500375092 25.418854713678417 25.85646411602901 50-51 23.593398349587396 24.681170292573142 25.29382345586397 26.431607901975497 52-53 24.01850462615654 25.6064016004001 24.44361090272568 25.93148287071768 54-55 23.705926481620406 25.581395348837212 24.306076519129782 26.406601650412604 56-57 23.768442110527634 24.843710927731934 24.731182795698924 26.65666416604151 58-59 24.493623405851466 24.131032758189548 24.706176544136035 26.669167291822955 60-61 24.01850462615654 24.493623405851466 24.58114528632158 26.906726681670417 62-63 24.48112028007002 24.60615153788447 24.493623405851466 26.419104776194047 64-65 24.243560890222557 24.756189047261813 24.643660915228807 26.356589147286826 66-67 24.3935983995999 25.406351587896975 23.980995248812203 26.219054763690924 68-69 24.20605151287822 25.04376094023506 24.543635908977244 26.206551637909474 70-71 24.384144054020258 25.146930098787045 24.346629986244842 26.12229586094785 72-73 24.934185784129372 24.407672057164348 23.856086247962892 26.802055910743388 74-75 25.119426751592357 21.642781316348195 25.583864118895967 27.65392781316348 76 27.3992673992674 0.0 35.201465201465204 37.3992673992674 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 1.5 24 0.5 25 0.5 26 3.0 27 7.5 28 11.5 29 13.5 30 14.5 31 18.0 32 23.0 33 31.0 34 43.0 35 67.0 36 99.0 37 114.5 38 126.0 39 155.5 40 173.0 41 174.0 42 178.5 43 185.0 44 204.0 45 230.0 46 232.0 47 224.5 48 223.0 49 211.0 50 213.0 51 199.5 52 175.5 53 154.5 54 125.5 55 111.0 56 107.5 57 107.0 58 101.5 59 92.0 60 84.0 61 76.5 62 71.0 63 73.0 64 64.5 65 58.5 66 62.5 67 65.5 68 68.0 69 58.5 70 50.0 71 50.5 72 47.0 73 43.5 74 36.5 75 32.0 76 34.5 77 29.0 78 23.5 79 24.0 80 17.5 81 9.0 82 6.0 83 4.5 84 2.5 85 1.5 86 2.0 87 1.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.05 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 1.0 71 4.0 72 11.0 73 73.0 74 284.0 75 896.0 76 2730.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.025 23 0.0 0.0 0.0 0.0 0.025 24 0.0 0.0 0.0 0.0 0.025 25 0.0 0.0 0.0 0.0 0.025 26 0.0 0.0 0.0 0.0 0.025 27 0.0 0.0 0.0 0.0 0.025 28 0.0 0.0 0.0 0.0 0.025 29 0.0 0.0 0.0 0.0 0.025 30 0.0 0.0 0.0 0.0 0.025 31 0.0 0.0 0.0 0.0 0.025 32 0.0 0.0 0.0 0.0 0.025 33 0.0 0.0 0.0 0.0 0.025 34 0.0 0.0 0.0 0.0 0.025 35 0.0 0.0 0.0 0.0 0.025 36 0.0 0.0 0.0 0.0 0.025 37 0.0 0.0 0.0 0.0 0.025 38 0.0 0.0 0.0 0.0 0.025 39 0.0 0.0 0.0 0.0 0.025 40 0.0 0.0 0.0 0.0 0.025 41 0.0 0.0 0.0 0.0 0.025 42 0.0 0.0 0.0 0.0 0.025 43 0.0 0.0 0.0 0.0 0.025 44 0.0 0.0 0.0 0.0 0.025 45 0.0 0.0 0.0 0.0 0.025 46 0.0 0.0 0.0 0.0 0.025 47 0.0 0.0 0.0 0.0 0.025 48 0.0 0.0 0.0 0.0 0.025 49 0.0 0.0 0.0 0.0 0.025 50 0.0 0.0 0.0 0.0 0.025 51 0.0 0.0 0.0 0.0 0.025 52 0.0 0.0 0.0 0.0 0.025 53 0.0 0.0 0.0 0.0 0.025 54 0.0 0.0 0.0 0.0 0.025 55 0.0 0.0 0.0 0.0 0.025 56 0.0 0.0 0.0 0.0 0.025 57 0.0 0.0 0.0 0.0 0.025 58 0.0 0.0 0.0 0.0 0.025 59 0.0 0.0 0.0 0.0 0.025 60 0.0 0.0 0.0 0.0 0.025 61 0.0 0.0 0.0 0.0 0.025 62 0.0 0.0 0.0 0.0 0.025 63 0.0 0.0 0.0 0.0 0.025 64 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389804 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389804_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.85625 32.0 32.0 32.0 32.0 32.0 2 30.594 32.0 32.0 32.0 32.0 32.0 3 30.4965 32.0 32.0 32.0 32.0 32.0 4 30.42125 32.0 32.0 32.0 32.0 32.0 5 30.4915 32.0 32.0 32.0 32.0 32.0 6 33.58625 36.0 36.0 36.0 21.0 36.0 7 33.63 36.0 36.0 36.0 21.0 36.0 8 33.603 36.0 36.0 36.0 32.0 36.0 9 33.62225 36.0 36.0 36.0 21.0 36.0 10-11 33.449625 36.0 36.0 36.0 21.0 36.0 12-13 33.503875 36.0 36.0 36.0 26.5 36.0 14-15 33.41375 36.0 36.0 36.0 21.0 36.0 16-17 33.44425 36.0 36.0 36.0 21.0 36.0 18-19 33.392250000000004 36.0 36.0 36.0 21.0 36.0 20-21 33.291 36.0 36.0 36.0 21.0 36.0 22-23 33.251875 36.0 36.0 36.0 21.0 36.0 24-25 33.146125 36.0 36.0 36.0 17.5 36.0 26-27 33.180875 36.0 36.0 36.0 17.5 36.0 28-29 33.066874999999996 36.0 36.0 36.0 14.0 36.0 30-31 32.949 36.0 36.0 36.0 14.0 36.0 32-33 32.8675 36.0 36.0 36.0 14.0 36.0 34-35 32.805625 36.0 36.0 36.0 14.0 36.0 36-37 32.68113585188891 36.0 36.0 36.0 14.0 36.0 38-39 32.688641481110835 36.0 36.0 36.0 14.0 36.0 40-41 32.51864364364364 36.0 36.0 36.0 14.0 36.0 42-43 32.496746746746744 36.0 36.0 36.0 14.0 36.0 44-45 32.22034534534534 36.0 34.0 36.0 14.0 36.0 46-47 32.2002002002002 36.0 32.0 36.0 14.0 36.0 48-49 32.00550550550551 36.0 32.0 36.0 14.0 36.0 50-51 31.995370370370374 36.0 32.0 36.0 14.0 36.0 52-53 31.780155155155157 36.0 32.0 36.0 14.0 36.0 54-55 31.538163163163162 36.0 32.0 36.0 14.0 36.0 56-57 31.462962962962962 36.0 32.0 36.0 14.0 36.0 58-59 31.442067067067068 36.0 32.0 36.0 14.0 36.0 60-61 31.23485985985986 36.0 32.0 36.0 14.0 36.0 62-63 31.13988988988989 36.0 32.0 36.0 14.0 36.0 64-65 30.8262012012012 36.0 32.0 36.0 14.0 36.0 66-67 31.044294294294296 36.0 32.0 36.0 14.0 36.0 68-69 30.88626126126126 36.0 32.0 36.0 14.0 36.0 70-71 30.628128128128125 36.0 27.0 36.0 14.0 36.0 72-73 30.553203336364703 36.0 27.0 36.0 14.0 36.0 74-75 30.21358247614987 36.0 27.0 36.0 14.0 36.0 76 28.96455223880597 32.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 4.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 3.0 17 5.0 18 7.0 19 6.0 20 14.0 21 12.0 22 16.0 23 25.0 24 37.0 25 68.0 26 77.0 27 112.0 28 149.0 29 213.0 30 294.0 31 364.0 32 528.0 33 714.0 34 895.0 35 450.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.16616616616617 18.743743743743742 10.36036036036036 29.72972972972973 2 27.909887359198997 23.204005006257823 28.010012515644554 20.876095118898625 3 26.044533400050035 26.845133850387793 22.091568676507382 25.01876407305479 4 27.920940705529144 32.94971228421316 16.56242181636227 22.566925193895422 5 27.995996997748314 32.69952464348261 18.563922942206652 20.740555416562422 6 23.267450587940957 34.62596947710783 20.540405303977984 21.56617463097323 7 23.742807105328996 16.18714035526645 34.550913184888664 25.519139354515886 8 25.619214410808105 21.015761821366024 24.043032274205654 29.321991493620214 9 24.23028785982478 21.65206508135169 26.132665832290364 27.98498122653317 10-11 27.147508139243676 28.437265214124718 19.747057350363136 24.66816929626847 12-13 27.054108216432866 20.99198396793587 23.284068136272545 28.669839679358716 14-15 25.924069665455455 24.708683122415735 24.007016664578373 25.360230547550433 16-17 26.75438596491228 23.93483709273183 23.64661654135338 25.664160401002505 18-19 27.136056126284142 24.01653720871962 21.73640691556001 27.110999749436232 20-21 27.300075206818754 24.454750564051142 23.514665329656555 24.730508899473552 22-23 26.548007019303082 24.730508899473552 23.126096766106794 25.595387315116568 24-25 25.776942355889727 24.837092731829575 23.082706766917294 26.303258145363408 26-27 26.710955126598147 25.294560040110305 22.536976685886188 25.457508147405367 28-29 26.61573146292585 23.647294589178355 23.584669338677354 26.152304609218437 30-31 26.1681072278592 24.52712013027684 23.925842415132156 25.378930226731804 32-33 27.17023675310034 24.36427408242515 22.923712889891018 25.541776274583487 34-35 27.450488844321885 23.978440711957884 23.301579343193783 25.269491100526448 36-37 25.98721323805942 24.33245581045506 22.95349128745142 26.726839664034095 38-39 27.224868388067186 24.27926798696415 24.016044121333668 24.479819503634996 40-41 26.92885771543086 24.19839679358717 23.38426853707415 25.488476953907817 42-43 26.38175209926056 24.652212056648704 22.960270710615365 26.00576513347537 44-45 26.58561042867887 24.191526698420656 23.66507896715969 25.557783905740788 46-47 26.214929859719437 24.486472945891784 23.208917835671343 26.089679358717433 48-49 26.5104036099273 24.642767610930058 23.351717222361497 25.495111556781147 50-51 26.212254103495802 25.209873449442426 22.616213507079312 25.961658939982456 52-53 27.685173580649202 24.326356686301544 23.022935204912898 24.965534528136356 54-55 26.36261120160381 24.345320135321387 23.555945370254356 25.73612329282045 56-57 27.195289991231363 24.890392083176753 23.149192033070275 24.76512589252161 58-59 26.512968299711815 24.583385540659066 23.042225285051998 25.861420874577117 60-61 27.112058159939835 24.75557783905741 23.0383554775633 25.09400852343946 62-63 25.7296755605662 25.416510083928344 23.975948891394214 24.87786546411124 64-65 27.44360902255639 24.82456140350877 22.99498746867168 24.736842105263158 66-67 26.753507014028056 23.897795591182362 23.647294589178355 25.701402805611224 68-69 26.62573612329282 25.072046109510087 23.768951259240698 24.533266507956398 70-71 26.518852561693603 24.71501941625955 23.19929850933233 25.566829512714516 72-73 26.507237256135934 24.707363121460038 23.838892385147894 24.946507237256135 74-75 27.283637818375784 21.522869715962127 24.229897319642618 26.963595146019472 76 29.035874439461885 0.0 33.37070254110613 37.59342301943199 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.5 4 1.0 5 1.5 6 1.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 1.5 13 1.5 14 0.5 15 0.0 16 0.5 17 1.5 18 1.5 19 1.0 20 0.5 21 0.0 22 0.5 23 3.0 24 3.5 25 1.5 26 3.0 27 9.5 28 11.0 29 9.5 30 11.0 31 15.5 32 23.5 33 27.0 34 39.0 35 59.0 36 73.5 37 77.0 38 87.5 39 119.5 40 151.5 41 159.5 42 156.0 43 169.0 44 182.0 45 206.0 46 228.5 47 213.0 48 191.0 49 194.0 50 201.5 51 186.0 52 169.0 53 153.0 54 140.5 55 138.0 56 127.5 57 117.5 58 114.0 59 101.5 60 94.0 61 89.0 62 80.5 63 84.0 64 90.0 65 99.5 66 96.5 67 86.5 68 90.5 69 87.5 70 71.0 71 56.0 72 53.0 73 55.0 74 50.0 75 47.5 76 40.0 77 27.5 78 26.0 79 26.0 80 17.0 81 9.5 82 7.5 83 6.0 84 6.5 85 5.0 86 2.0 87 0.5 88 0.0 89 1.0 90 1.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.125 3 0.075 4 0.075 5 0.075 6 0.075 7 0.075 8 0.075 9 0.125 10-11 0.17500000000000002 12-13 0.2 14-15 0.2375 16-17 0.25 18-19 0.22499999999999998 20-21 0.27499999999999997 22-23 0.27499999999999997 24-25 0.25 26-27 0.27499999999999997 28-29 0.2 30-31 0.21250000000000002 32-33 0.21250000000000002 34-35 0.27499999999999997 36-37 0.21265949462096573 38-39 0.20015011258443832 40-41 0.10010010010010009 42-43 0.16266266266266266 44-45 0.17517517517517517 46-47 0.10010010010010009 48-49 0.17517517517517517 50-51 0.13763763763763764 52-53 0.16266266266266266 54-55 0.13763763763763764 56-57 0.11261261261261261 58-59 0.13763763763763764 60-61 0.17517517517517517 62-63 0.11261261261261261 64-65 0.15015015015015015 66-67 0.10010010010010009 68-69 0.13763763763763764 70-71 0.11261261261261261 72-73 0.10059097196026656 74-75 0.10656720394298655 76 0.1492537313432836 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 3.0 36 0.0 37 0.0 38 0.0 39 1.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 8.0 72 23.0 73 83.0 74 257.0 75 945.0 76 2680.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82460536206464 99.6 2 0.12528188423953898 0.25 3 0.05011275369581559 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 643466 spots for SRR11389804.sra Written 643466 spots for SRR11389804.sra Read 643466 spots for SRR11389804.sra Written 643466 spots for SRR11389804.sra Read 643466 spots for SRR11389804.sra Written 643466 spots for SRR11389804.sra Read 643466 spots for SRR11389804.sra Written 643466 spots for SRR11389804.sra Read 643466 spots for SRR11389804.sra Written 643466 spots for SRR11389804.sra Read 643466 spots for SRR11389804.sra Written 643466 spots for SRR11389804.sra Read 643466 spots for SRR11389804.sra Written 643466 spots for SRR11389804.sra Read 643466 spots for SRR11389804.sra Written 643466 spots for SRR11389804.sra Read 643466 spots for SRR11389804.sra Written 643466 spots for SRR11389804.sra Read 643466 spots for SRR11389804.sra Written 643466 spots for SRR11389804.sra Read 643466 spots for SRR11389804.sra Written 643466 spots for SRR11389804.sra Read 643466 spots for SRR11389804.sra Written 643466 spots for SRR11389804.sra Read 643466 spots for SRR11389804.sra Written 643466 spots for SRR11389804.sra Read 643466 spots for SRR11389804.sra Written 643466 spots for SRR11389804.sra Read 643466 spots for SRR11389804.sra Written 643466 spots for SRR11389804.sra Read 643466 spots for SRR11389804.sra Written 643466 spots for SRR11389804.sra Read 643466 spots for SRR11389804.sra Written 643466 spots for SRR11389804.sra Read 643466 spots for SRR11389804.sra Written 643466 spots for SRR11389804.sra Read 643466 spots for SRR11389804.sra Written 643466 spots for SRR11389804.sra Read 643478 spots for SRR11389804.sra Written 643478 spots for SRR11389804.sra SRR ids: ['SRR11389804.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ex_u8jhh SRR11389804.sra spots: 12869332 blocks: [[1, 643466], [643467, 1286932], [1286933, 1930398], [1930399, 2573864], [2573865, 3217330], [3217331, 3860796], [3860797, 4504262], [4504263, 5147728], [5147729, 5791194], [5791195, 6434660], [6434661, 7078126], [7078127, 7721592], [7721593, 8365058], [8365059, 9008524], [9008525, 9651990], [9651991, 10295456], [10295457, 10938922], [10938923, 11582388], [11582389, 12225854], [12225855, 12869332]] SRR11389804 file size 2442850 SRR11389804 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389804 SRR11389804_1.fastq SRR11389804_2.fastq Input file: SRR11389804_1.fastq Paired file: SRR11389804_2.fastq trimmed: SRR11389804-trimmed-pair1.fastq, SRR11389804-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 06:54:32 2024 >> started Sat Dec 7 06:54:43 2024 >> done (10.983s) 12869332 read pairs processed; of these: 462 ( 0.00%) short read pairs filtered out after trimming by size control 3754 ( 0.03%) empty read pairs filtered out after trimming by size control 12865116 (99.97%) read pairs available; of these: 11222 ( 0.09%) trimmed read pairs available after processing 12853894 (99.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 7 0.00% 21 11 0.00% 22 11 0.00% 23 24 0.00% 24 13 0.00% 25 29 0.00% 26 18 0.00% 27 33 0.00% 28 32 0.00% 29 21 0.00% 30 26 0.00% 31 23 0.00% 32 14 0.00% 33 24 0.00% 34 30 0.00% 35 174 0.00% 36 154 0.00% 37 159 0.00% 38 154 0.00% 39 158 0.00% 40 191 0.00% 41 166 0.00% 42 168 0.00% 43 178 0.00% 44 179 0.00% 45 207 0.00% 46 192 0.00% 47 201 0.00% 48 205 0.00% 49 190 0.00% 50 217 0.00% 51 272 0.00% 52 245 0.00% 53 244 0.00% 54 256 0.00% 55 329 0.00% 56 385 0.00% 57 414 0.00% 58 479 0.00% 59 508 0.00% 60 543 0.00% 61 436 0.00% 62 494 0.00% 63 629 0.00% 64 574 0.00% 65 662 0.01% 66 712 0.01% 67 903 0.01% 68 735 0.01% 69 871 0.01% 70 1501 0.01% 71 2184 0.02% 72 9229 0.07% 73 106671 0.83% 74 950657 7.39% 75 5748670 44.68% 76 6033296 46.90% 12865116 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=192.74 fanout-score-rank=14 prefix-density=0.54 prefix-fanout=23.4 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=13 fanout-score=437.13 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=34.3 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=117.85 fanout-score-rank=21 prefix-density=1.37 prefix-fanout=18.7 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=31 fanout-score=462.13 fanout-score-rank=1 prefix-density=1.16 prefix-fanout=22.3 sequence=CCGCCGCCGCGA SRR11389804 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 06:55:14 Started mapping on | Dec 07 06:55:14 Finished on | Dec 07 06:56:25 Mapping speed, Million of reads per hour | 652.32 Number of input reads | 12865116 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 11790937 Uniquely mapped reads % | 91.65% Average mapped length | 149.81 Number of splices: Total | 5239349 Number of splices: Annotated (sjdb) | 5002770 Number of splices: GT/AG | 5169451 Number of splices: GC/AG | 60960 Number of splices: AT/AC | 4464 Number of splices: Non-canonical | 4474 Mismatch rate per base, % | 1.34% Deletion rate per base | 0.01% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 217170 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 27830 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.45% % of reads unmapped: other | 0.99% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 857013 857013 857013 N_multimapping 217170 217170 217170 N_noFeature 423335 11506143 537177 N_ambiguous 205373 1826 36064 UnstrandedReadsAssigned:11162229 PositiveStrandReadsAssigned:282968 NegativeStrandReadsAssigned:11217696 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389804 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389804-trimmed-pair1.fastq SRR11389804-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,865,116 reads, 11,475,332 reads pseudoaligned [quant] estimated average fragment length: 229.536 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,051 rounds 52973 SRR11389804.ke.tsv 35125 SRR11389804.se.tsv 88098 total ==> SRR11389804.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 707.699 8.10185 1.46905 PNS24247 1044 815.464 66.8538 10.5202 PNS24249 1928 1699.46 377.928 28.5364 PNS24246 1044 815.464 66.8538 10.5202 PNS24248 1044 815.464 66.8538 10.5202 PNS24244 1471 1242.46 25.4084 2.62418 PNS24243 293 85.8018 0 0 KQK14069 1603 1374.46 27.7668 2.59235 KQK14071 474 248.215 3.4459 1.78146 ==> SRR11389804.se.tsv <== BRADI_1g14170v3 48 BRADI_1g53295v3 9 BRADI_1g59795v3 156 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 734 BRADI_1g74790v3 11 BRADI_1g09890v3 0 BRADI_1g77505v3 224 BRADI_1g48960v3 1 SRR11389804 completed mapping pipeline successfully