Starting /dee2/code/volunteer_pipeline.sh SRR11389807 current disk space = 1544822157312 free memory = 1600629328 SRR11389807 SRAfilesize 530e8a8a95ee05083e729a797d85910b SRR11389807.sra SRR11389807.sra file validated SRR11389807 is paired end SRR11389807 is conventional basespace SRR11389807 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389807_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9005 32.0 32.0 32.0 32.0 32.0 2 30.6255 32.0 32.0 32.0 32.0 32.0 3 30.71675 32.0 32.0 32.0 32.0 32.0 4 30.77375 32.0 32.0 32.0 32.0 32.0 5 30.8365 32.0 32.0 32.0 32.0 32.0 6 33.97625 36.0 36.0 36.0 32.0 36.0 7 33.85125 36.0 36.0 36.0 32.0 36.0 8 33.91625 36.0 36.0 36.0 32.0 36.0 9 33.905 36.0 36.0 36.0 32.0 36.0 10-11 33.763875 36.0 36.0 36.0 29.5 36.0 12-13 33.828625 36.0 36.0 36.0 32.0 36.0 14-15 33.857375 36.0 36.0 36.0 32.0 36.0 16-17 33.712875 36.0 36.0 36.0 32.0 36.0 18-19 33.635625 36.0 36.0 36.0 32.0 36.0 20-21 33.7415 36.0 36.0 36.0 32.0 36.0 22-23 33.608374999999995 36.0 36.0 36.0 29.5 36.0 24-25 33.485749999999996 36.0 36.0 36.0 29.5 36.0 26-27 33.4305 36.0 36.0 36.0 32.0 36.0 28-29 33.284499999999994 36.0 36.0 36.0 24.0 36.0 30-31 33.2665 36.0 36.0 36.0 21.0 36.0 32-33 33.25 36.0 36.0 36.0 24.0 36.0 34-35 33.273875000000004 36.0 36.0 36.0 24.0 36.0 36-37 33.78310038119441 36.0 36.0 36.0 32.0 36.0 38-39 33.666073697585766 36.0 36.0 36.0 29.5 36.0 40-41 33.53392630241423 36.0 36.0 36.0 27.0 36.0 42-43 33.633799237611186 36.0 36.0 36.0 29.5 36.0 44-45 33.25813421453991 36.0 36.0 36.0 20.5 36.0 46-47 33.323417238749045 36.0 36.0 36.0 21.0 36.0 48-49 33.31820493262141 36.0 36.0 36.0 21.0 36.0 50-51 33.16772634791455 36.0 36.0 36.0 21.0 36.0 52-53 33.19343708860861 36.0 36.0 36.0 21.0 36.0 54-55 32.84083969465649 36.0 32.0 36.0 17.5 36.0 56-57 32.77691524560957 36.0 32.0 36.0 14.0 36.0 58-59 32.8073301094426 36.0 34.0 36.0 14.0 36.0 60-61 32.74331550802139 36.0 32.0 36.0 14.0 36.0 62-63 32.50659603272156 36.0 32.0 36.0 14.0 36.0 64-65 32.39818253312717 36.0 32.0 36.0 14.0 36.0 66-67 32.33244002041858 36.0 32.0 36.0 14.0 36.0 68-69 32.1114088820827 36.0 32.0 36.0 14.0 36.0 70-71 32.10757667339193 36.0 32.0 36.0 14.0 36.0 72-73 31.852494270714416 36.0 32.0 36.0 14.0 36.0 74-75 31.827835763459653 36.0 32.0 36.0 14.0 36.0 76 30.694236526946106 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 65.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 5.0 23 9.0 24 20.0 25 25.0 26 41.0 27 81.0 28 118.0 29 149.0 30 188.0 31 285.0 32 390.0 33 605.0 34 965.0 35 1051.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.795425667090214 11.512071156289707 10.088945362134687 35.603557814485384 2 26.454891994917407 14.383735705209657 34.00254129606099 25.158831003811944 3 24.87928843710292 19.618805590851334 22.337992376111817 33.16391359593393 4 29.860228716645487 26.149936467598472 17.992376111817027 25.997458703939007 5 28.208386277001267 29.377382465057178 21.42312579415502 20.991105463786532 6 24.802648332060095 30.65953654188948 23.45301757066463 21.08479755538579 7 17.81448538754765 24.29479034307497 36.5438373570521 21.346886912325285 8 20.914866581956797 24.04066073697586 29.60609911054638 25.438373570520966 9 23.37992376111817 20.40660736975858 31.28335451080051 24.930114358322744 10-11 24.980940279542565 30.864040660736975 21.994917407878017 22.16010165184244 12-13 23.74841168996188 23.761118170266837 24.86658195679797 27.623888182973317 14-15 23.456162642947902 24.80304955527319 26.569250317662007 25.1715374841169 16-17 25.65438373570521 24.167725540025415 24.269377382465056 25.90851334180432 18-19 24.29479034307497 24.05336721728081 24.841168996188056 26.810673443456164 20-21 24.955527318932656 24.574332909783987 24.917407878017787 25.552731893265566 22-23 24.34871012835176 26.280340576947513 24.183504892616597 25.187444402084125 24-25 24.815756035578147 24.3710292249047 24.307496823379925 26.50571791613723 26-27 24.11689961880559 24.218551461245237 23.78653113087675 27.87801778907243 28-29 25.139806812404675 24.809354346720895 24.771225216065073 25.279613624809354 30-31 24.34561626429479 24.40914866581957 25.374841168996188 25.870393900889454 32-33 24.08184013216419 24.793493455331046 24.818909645444148 26.30575676706062 34-35 24.76493011435832 25.01905972045743 23.570520965692506 26.645489199491738 36-37 25.959339263024145 23.837357052096568 24.320203303684877 25.883100381194406 38-39 24.282083862770012 25.46378653113088 25.044472681067344 25.209656925031766 40-41 25.196950444726813 24.980940279542565 24.8284625158831 24.993646759847522 42-43 24.853875476493013 24.104193138500634 25.362134688691235 25.679796696315123 44-45 24.36451448906965 23.46212506354855 25.203355363497714 26.970005083884086 46-47 24.510551741673023 24.81566234426646 23.53165522501907 27.142130689041444 48-49 24.497838799898297 24.82837528604119 24.624968217645563 26.04881769641495 50-51 24.974567650050865 24.08443540183113 25.11444557477111 25.826551373346895 52-53 25.028615032430366 23.642375683581328 23.477044385094747 27.85196489889355 54-55 25.025445292620862 24.134860050890588 25.35623409669211 25.483460559796438 56-57 23.110206159328072 24.242809875286333 25.693560702468822 26.953423262916772 58-59 23.593789768388902 23.746500381776535 25.693560702468822 26.96614914736574 60-61 24.688057040998217 23.52941176470588 25.07002801120448 26.712503183091417 62-63 24.280254777070066 23.197452229299362 25.834394904458595 26.687898089171973 64-65 26.77546857069999 23.24365676399337 24.44217773811042 25.538696927196224 66-67 24.374680959673302 24.961715160796324 23.621745788667685 27.041858090862686 68-69 24.974476773864215 24.655436447166924 24.540581929555895 25.829504849412967 70-71 24.958487674032444 24.89462255715928 23.834461617064758 26.312428151743518 72-73 25.150698986789795 24.65050660510453 24.265743234577403 25.93305117352828 74-75 25.071186440677966 22.318644067796612 25.071186440677966 27.53898305084746 76 28.892215568862273 0.0 32.26047904191617 38.84730538922156 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 66.0 1 33.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 2.0 17 3.5 18 5.5 19 8.0 20 9.0 21 10.5 22 9.5 23 9.5 24 11.0 25 9.5 26 9.5 27 12.5 28 13.0 29 15.5 30 27.5 31 35.0 32 39.5 33 40.0 34 38.0 35 57.0 36 73.0 37 83.0 38 100.0 39 139.5 40 161.5 41 162.5 42 181.0 43 198.0 44 215.5 45 208.5 46 194.0 47 192.5 48 175.0 49 152.5 50 137.5 51 129.5 52 130.5 53 116.0 54 101.5 55 102.0 56 102.0 57 126.0 58 150.5 59 140.5 60 134.5 61 132.5 62 122.5 63 116.5 64 105.0 65 90.5 66 86.0 67 83.0 68 75.0 69 68.0 70 61.0 71 52.0 72 43.0 73 38.5 74 35.5 75 31.0 76 29.5 77 26.0 78 16.0 79 9.0 80 7.5 81 6.5 82 4.5 83 2.5 84 2.0 85 2.0 86 1.5 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 1.625 3 1.625 4 1.625 5 1.625 6 1.825 7 1.625 8 1.625 9 1.625 10-11 1.625 12-13 1.625 14-15 1.625 16-17 1.625 18-19 1.625 20-21 1.625 22-23 1.6375000000000002 24-25 1.625 26-27 1.625 28-29 1.6500000000000001 30-31 1.625 32-33 1.6375000000000002 34-35 1.625 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 65.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 1.0 44 0.0 45 1.0 46 0.0 47 0.0 48 0.0 49 1.0 50 0.0 51 0.0 52 1.0 53 1.0 54 0.0 55 1.0 56 0.0 57 0.0 58 0.0 59 2.0 60 0.0 61 1.0 62 2.0 63 2.0 64 1.0 65 3.0 66 0.0 67 0.0 68 0.0 69 2.0 70 3.0 71 6.0 72 17.0 73 71.0 74 263.0 75 884.0 76 2672.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.975 #Duplication Level Percentage of deduplicated Percentage of total 1 97.20670391061452 91.35 2 1.9952114924181963 3.75 3 0.4522479382814578 1.275 4 0.1596169193934557 0.6 5 0.026602819898909287 0.125 6 0.026602819898909287 0.15 7 0.026602819898909287 0.17500000000000002 8 0.0 0.0 9 0.026602819898909287 0.22499999999999998 >10 0.053205639797818574 0.7250000000000001 >50 0.026602819898909287 1.625 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 65 1.625 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 17 0.42500000000000004 TruSeq Adapter, Index 7 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 12 0.3 TruSeq Adapter, Index 7 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAA 9 0.22499999999999998 TruSeq Adapter, Index 7 (97% over 36bp) GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 7 0.17500000000000002 No Hit CAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGG 6 0.15 No Hit GGGAATTCGTAGATCCTCCAGACGTAGAGCACGTAGGGCTTTGAAACCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 57 0.05 0.0 0.0 0.0 0.0 58 0.05 0.0 0.0 0.0 0.0 59 0.05 0.0 0.0 0.0 0.0 60 0.05 0.0 0.0 0.0 0.0 61 0.05 0.0 0.0 0.0 0.0 62 0.05 0.0 0.0 0.0 0.0 63 0.05 0.0 0.0 0.0 0.0 64 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389807 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389807_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.40075 32.0 32.0 32.0 32.0 32.0 2 30.063 32.0 32.0 32.0 21.0 32.0 3 30.01 32.0 32.0 32.0 21.0 32.0 4 30.1325 32.0 32.0 32.0 21.0 32.0 5 30.11675 32.0 32.0 32.0 21.0 32.0 6 33.34675 36.0 36.0 36.0 21.0 36.0 7 33.245 36.0 36.0 36.0 21.0 36.0 8 33.123 36.0 36.0 36.0 21.0 36.0 9 32.992 36.0 36.0 36.0 21.0 36.0 10-11 32.934875 36.0 36.0 36.0 17.5 36.0 12-13 32.992875 36.0 36.0 36.0 21.0 36.0 14-15 32.82125 36.0 36.0 36.0 17.5 36.0 16-17 32.903625 36.0 36.0 36.0 21.0 36.0 18-19 32.72725 36.0 36.0 36.0 14.0 36.0 20-21 32.55475 36.0 36.0 36.0 14.0 36.0 22-23 32.675 36.0 36.0 36.0 14.0 36.0 24-25 32.45625 36.0 36.0 36.0 14.0 36.0 26-27 32.397125 36.0 36.0 36.0 14.0 36.0 28-29 32.260125 36.0 36.0 36.0 14.0 36.0 30-31 32.367000000000004 36.0 36.0 36.0 14.0 36.0 32-33 32.369875 36.0 36.0 36.0 14.0 36.0 34-35 32.363125 36.0 36.0 36.0 14.0 36.0 36-37 32.97304856343758 36.0 36.0 36.0 14.0 36.0 38-39 32.58517670989067 36.0 36.0 36.0 14.0 36.0 40-41 32.65280956013221 36.0 36.0 36.0 14.0 36.0 42-43 32.78337147215866 36.0 36.0 36.0 14.0 36.0 44-45 32.50940996948118 36.0 36.0 36.0 14.0 36.0 46-47 32.28275248028491 36.0 34.0 36.0 14.0 36.0 48-49 32.40460442635462 36.0 34.0 36.0 14.0 36.0 50-51 32.27175572519084 36.0 32.0 36.0 14.0 36.0 52-53 32.0529262086514 36.0 32.0 36.0 14.0 36.0 54-55 32.1926698905574 36.0 32.0 36.0 14.0 36.0 56-57 31.973523421588595 36.0 32.0 36.0 14.0 36.0 58-59 31.784368635437882 36.0 32.0 36.0 14.0 36.0 60-61 31.82195618950586 36.0 32.0 36.0 14.0 36.0 62-63 31.798668184201937 36.0 32.0 36.0 14.0 36.0 64-65 31.76365940982361 36.0 32.0 36.0 14.0 36.0 66-67 31.56586673474598 36.0 32.0 36.0 14.0 36.0 68-69 31.351289251978557 36.0 32.0 36.0 14.0 36.0 70-71 31.293502688980517 36.0 32.0 36.0 14.0 36.0 72-73 31.258220590324832 36.0 32.0 36.0 14.0 36.0 74-75 31.233548233886857 36.0 32.0 36.0 14.0 36.0 76 30.080197643481565 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 67.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 2.0 15 4.0 16 22.0 17 34.0 18 16.0 19 14.0 20 17.0 21 10.0 22 20.0 23 20.0 24 43.0 25 49.0 26 77.0 27 81.0 28 121.0 29 140.0 30 235.0 31 274.0 32 378.0 33 629.0 34 954.0 35 791.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.59765724471607 18.81843646549529 10.058568882098294 31.52533740769035 2 30.39714867617108 22.70875763747454 28.5132382892057 18.380855397148675 3 26.602238046795524 25.96642929806714 21.515768056968465 25.91556459816887 4 30.689041444190185 29.621154335113147 17.162471395881006 22.527332824815662 5 31.50266971777269 30.307653190948386 18.179506737859143 20.01017035341978 6 24.40884820747521 34.350368675311465 19.32367149758454 21.91711161962878 7 23.976608187134502 17.289600813628272 33.48588863463005 25.24790236460717 8 26.08695652173913 20.36613272311213 24.02745995423341 29.51945080091533 9 25.667769015517678 20.681760366319 25.79496311371152 27.855507504451793 10-11 28.311026131293815 26.794136392606756 18.878266411727214 26.01657106437221 12-13 29.12374411802111 19.954215948111408 22.713976853618213 28.208063080249268 14-15 27.38430069036052 23.53618000511378 24.571720787522374 24.507798517003323 16-17 28.410976388002553 22.833439693682195 23.254626675175494 25.50095724313976 18-19 27.770668031737905 23.44509854108011 22.945994369081134 25.838239058100843 20-21 28.554957724827055 24.353061747373815 22.457084294132716 24.63489623366641 22-23 27.725936341556945 24.108398312667774 23.72491371596574 24.440751629809537 24-25 27.607833098681684 23.66568539613465 22.42416485344938 26.302316651734287 26-27 27.107586030446463 24.881668159140336 22.310349238838427 25.700396571574775 28-29 27.31232385344607 25.467589034076347 22.136817832436588 25.083269280040994 30-31 26.469836400817996 24.833844580777097 22.967791411042946 25.72852760736196 32-33 26.136509156101933 24.36931745421949 24.202842873607374 25.2913305160712 34-35 27.858148764562795 23.825374471898606 22.775572909998722 25.54090385353988 36-37 27.373377449732754 24.43369814202087 22.21939424790023 25.973530160346144 38-39 25.88010204081633 25.178571428571427 22.95918367346939 25.982142857142858 40-41 27.570332480818415 24.373401534526852 22.647058823529413 25.40920716112532 42-43 27.470985843642392 23.887259278153298 23.92551970411937 24.71623517408494 44-45 27.88682131022177 24.114198317614072 22.72495539128218 25.274024980881975 46-47 26.881308291810402 24.632681742685573 23.11230356458413 25.373706400919893 48-49 26.164051537185866 24.569460390355914 23.74027299400434 25.526215078453884 50-51 26.482565538304915 24.77729702214304 23.008399083736318 25.731738355815732 52-53 27.197346600331674 24.30156907768848 23.70200280648042 24.799081515499427 54-55 27.00878645103782 24.869476633133832 22.95937858143385 25.162358334394497 56-57 28.29299363057325 23.49044585987261 23.29936305732484 24.9171974522293 58-59 28.238440962934657 23.907782448095784 22.022672271048275 25.831104317921284 60-61 27.1650534895568 23.841059602649008 23.178807947019866 25.815078960774322 62-63 28.14729867482161 24.00611620795107 22.515290519877677 25.33129459734964 64-65 27.162541464659352 24.393978055626437 22.352640979841794 26.090839499872416 66-67 27.582684203805393 23.304814199974462 23.687907036138427 25.424594560081726 68-69 27.189175389328568 24.189430686750065 24.11284146030125 24.508552463620116 70-71 26.846409404548936 24.201380015333505 23.43470483005367 25.51750575006389 72-73 25.390070921985814 24.925854287556415 23.43004513217279 26.254029658284978 74-75 26.299319727891156 22.01360544217687 24.897959183673468 26.789115646258505 76 29.000380083618392 0.0 31.965032307107567 39.03458760927404 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 69.0 1 34.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 2.0 15 1.5 16 1.0 17 2.0 18 5.0 19 7.0 20 5.5 21 4.5 22 6.0 23 5.5 24 5.0 25 7.5 26 8.0 27 10.0 28 17.0 29 19.5 30 18.5 31 22.5 32 29.0 33 34.5 34 44.5 35 71.0 36 83.0 37 81.0 38 98.5 39 119.0 40 121.0 41 128.5 42 144.5 43 158.5 44 169.0 45 161.0 46 159.5 47 154.0 48 154.0 49 156.0 50 146.5 51 136.5 52 121.5 53 123.0 54 128.5 55 134.5 56 130.5 57 129.5 58 144.0 59 148.5 60 149.0 61 143.5 62 134.5 63 111.0 64 97.0 65 103.0 66 99.5 67 96.5 68 90.5 69 83.5 70 75.5 71 67.5 72 66.0 73 56.5 74 47.0 75 47.5 76 39.5 77 29.0 78 25.0 79 24.0 80 18.0 81 10.5 82 7.5 83 4.0 84 2.0 85 2.0 86 3.0 87 3.0 88 2.0 89 1.0 90 0.5 91 0.5 92 1.0 93 0.5 94 1.0 95 1.0 96 0.0 97 0.5 98 1.0 99 1.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.825 2 1.7999999999999998 3 1.7000000000000002 4 1.675 5 1.675 6 1.675 7 1.675 8 1.675 9 1.725 10-11 1.9375 12-13 1.7125000000000001 14-15 2.225 16-17 2.0625 18-19 2.325 20-21 2.4250000000000003 22-23 2.2125 24-25 2.3375 26-27 2.2875 28-29 2.4250000000000003 30-31 2.1999999999999997 32-33 2.3875 34-35 2.3625 36-37 0.10170353419781336 38-39 0.33053648614289344 40-41 0.5847953216374269 42-43 0.3178235443681668 44-45 0.2288911495422177 46-47 0.4451793436784533 48-49 0.29254642584584073 50-51 0.02544529262086514 52-53 0.26717557251908397 54-55 0.06362942224484602 56-57 0.07637474541751527 58-59 0.06364562118126273 60-61 0.0 62-63 0.0 64-65 0.038260425966075755 66-67 0.038294613224406436 68-69 0.0 70-71 0.0 72-73 0.18020337237739734 74-75 0.14943621790517592 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 67.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 1.0 44 0.0 45 1.0 46 0.0 47 0.0 48 0.0 49 1.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 1.0 56 0.0 57 0.0 58 0.0 59 2.0 60 0.0 61 1.0 62 2.0 63 2.0 64 1.0 65 3.0 66 0.0 67 0.0 68 0.0 69 2.0 70 4.0 71 14.0 72 25.0 73 64.0 74 255.0 75 922.0 76 2631.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.675 #Duplication Level Percentage of deduplicated Percentage of total 1 97.75280898876404 93.525 2 1.7507185785210346 3.35 3 0.3658217925267834 1.05 4 0.10452051215050953 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.026130128037627383 1.675 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 67 1.675 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.075 0.0 0.0 0.0 0.0 26 0.075 0.0 0.0 0.0 0.0 27 0.075 0.0 0.0 0.0 0.0 28 0.075 0.0 0.0 0.0 0.0 29 0.075 0.0 0.0 0.0 0.0 30 0.075 0.0 0.0 0.0 0.0 31 0.075 0.0 0.0 0.0 0.0 32 0.075 0.0 0.0 0.0 0.0 33 0.1 0.0 0.0 0.0 0.0 34 0.1 0.0 0.0 0.0 0.0 35 0.1 0.0 0.0 0.0 0.0 36 0.1 0.0 0.0 0.0 0.0 37 0.1 0.0 0.0 0.0 0.0 38 0.1 0.0 0.0 0.0 0.0 39 0.1 0.0 0.0 0.0 0.0 40 0.1 0.0 0.0 0.0 0.0 41 0.1 0.0 0.0 0.0 0.0 42 0.1 0.0 0.0 0.0 0.0 43 0.1 0.0 0.0 0.0 0.0 44 0.1 0.0 0.0 0.0 0.0 45 0.1 0.0 0.0 0.0 0.0 46 0.1 0.0 0.0 0.0 0.0 47 0.1 0.0 0.0 0.0 0.0 48 0.1 0.0 0.0 0.0 0.0 49 0.1 0.0 0.0 0.0 0.0 50 0.1 0.0 0.0 0.0 0.0 51 0.1 0.0 0.0 0.0 0.0 52 0.1 0.0 0.0 0.0 0.0 53 0.1 0.0 0.0 0.0 0.0 54 0.1 0.0 0.0 0.0 0.0 55 0.1 0.0 0.0 0.0 0.0 56 0.1 0.0 0.0 0.0 0.0 57 0.1 0.0 0.0 0.0 0.0 58 0.1 0.0 0.0 0.0 0.0 59 0.1 0.0 0.0 0.0 0.0 60 0.1 0.0 0.0 0.0 0.0 61 0.1 0.0 0.0 0.0 0.0 62 0.1 0.0 0.0 0.0 0.0 63 0.1 0.0 0.0 0.0 0.0 64 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1338584 spots for SRR11389807.sra Written 1338584 spots for SRR11389807.sra Read 1338584 spots for SRR11389807.sra Written 1338584 spots for SRR11389807.sra Read 1338584 spots for SRR11389807.sra Written 1338584 spots for SRR11389807.sra Read 1338584 spots for SRR11389807.sra Written 1338584 spots for SRR11389807.sra Read 1338584 spots for SRR11389807.sra Written 1338584 spots for SRR11389807.sra Read 1338584 spots for SRR11389807.sra Written 1338584 spots for SRR11389807.sra Read 1338584 spots for SRR11389807.sra Written 1338584 spots for SRR11389807.sra Read 1338597 spots for SRR11389807.sra Written 1338597 spots for SRR11389807.sra Read 1338584 spots for SRR11389807.sra Written 1338584 spots for SRR11389807.sra Read 1338584 spots for SRR11389807.sra Written 1338584 spots for SRR11389807.sra Read 1338584 spots for SRR11389807.sra Written 1338584 spots for SRR11389807.sra Read 1338584 spots for SRR11389807.sra Written 1338584 spots for SRR11389807.sra Read 1338584 spots for SRR11389807.sra Written 1338584 spots for SRR11389807.sra Read 1338584 spots for SRR11389807.sra Written 1338584 spots for SRR11389807.sra Read 1338584 spots for SRR11389807.sra Written 1338584 spots for SRR11389807.sra Read 1338584 spots for SRR11389807.sra Written 1338584 spots for SRR11389807.sra Read 1338584 spots for SRR11389807.sra Written 1338584 spots for SRR11389807.sra Read 1338584 spots for SRR11389807.sra Written 1338584 spots for SRR11389807.sra Read 1338584 spots for SRR11389807.sra Written 1338584 spots for SRR11389807.sra Read 1338584 spots for SRR11389807.sra Written 1338584 spots for SRR11389807.sra SRR ids: ['SRR11389807.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v_z7j1ge SRR11389807.sra spots: 26771693 blocks: [[1, 1338584], [1338585, 2677168], [2677169, 4015752], [4015753, 5354336], [5354337, 6692920], [6692921, 8031504], [8031505, 9370088], [9370089, 10708672], [10708673, 12047256], [12047257, 13385840], [13385841, 14724424], [14724425, 16063008], [16063009, 17401592], [17401593, 18740176], [18740177, 20078760], [20078761, 21417344], [21417345, 22755928], [22755929, 24094512], [24094513, 25433096], [25433097, 26771693]] SRR11389807 file size 5023928 SRR11389807 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389807 SRR11389807_1.fastq SRR11389807_2.fastq Input file: SRR11389807_1.fastq Paired file: SRR11389807_2.fastq trimmed: SRR11389807-trimmed-pair1.fastq, SRR11389807-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:03:32 2024 >> started Sat Dec 7 07:03:54 2024 >> done (22.229s) 26771693 read pairs processed; of these: 1455 ( 0.01%) short read pairs filtered out after trimming by size control 1735291 ( 6.48%) empty read pairs filtered out after trimming by size control 25034947 (93.51%) read pairs available; of these: 63634 ( 0.25%) trimmed read pairs available after processing 24971313 (99.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3190 0.01% 19 51 0.00% 20 4530 0.02% 21 50 0.00% 22 5261 0.02% 23 47 0.00% 24 5790 0.02% 25 46 0.00% 26 6356 0.03% 27 52 0.00% 28 5822 0.02% 29 43 0.00% 30 3917 0.02% 31 29 0.00% 32 2795 0.01% 33 30 0.00% 34 2141 0.01% 35 495 0.00% 36 5135 0.02% 37 599 0.00% 38 2782 0.01% 39 694 0.00% 40 1614 0.01% 41 1066 0.00% 42 1419 0.01% 43 1460 0.01% 44 1833 0.01% 45 1713 0.01% 46 1941 0.01% 47 2161 0.01% 48 2406 0.01% 49 2587 0.01% 50 3119 0.01% 51 3439 0.01% 52 3517 0.01% 53 4046 0.02% 54 4557 0.02% 55 5422 0.02% 56 6776 0.03% 57 6992 0.03% 58 7236 0.03% 59 7442 0.03% 60 8010 0.03% 61 8711 0.03% 62 9696 0.04% 63 10449 0.04% 64 11538 0.05% 65 12304 0.05% 66 13408 0.05% 67 14891 0.06% 68 14994 0.06% 69 16614 0.07% 70 18485 0.07% 71 22597 0.09% 72 47313 0.19% 73 233376 0.93% 74 1680496 6.71% 75 10884882 43.48% 76 11906582 47.56% 25034947 reads passed initial QC criterion=sequence-density sequence-density=0.99 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=29 prefix-density=0.94 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.04 sequence-density-rank=34 fanout-score=11.47 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=3.8 sequence=TACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=15 prefix-density=0.90 prefix-fanout=2.4 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=9.05 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.1 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC SRR11389807 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:04:20 Started mapping on | Dec 07 07:04:21 Finished on | Dec 07 07:06:30 Mapping speed, Million of reads per hour | 698.65 Number of input reads | 25034947 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 21307242 Uniquely mapped reads % | 85.11% Average mapped length | 150.22 Number of splices: Total | 8684273 Number of splices: Annotated (sjdb) | 8299632 Number of splices: GT/AG | 8573950 Number of splices: GC/AG | 97781 Number of splices: AT/AC | 1989 Number of splices: Non-canonical | 10553 Mismatch rate per base, % | 0.63% Deletion rate per base | 0.01% Deletion average length | 1.70 Insertion rate per base | 0.00% Insertion average length | 1.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2527335 % of reads mapped to multiple loci | 10.10% Number of reads mapped to too many loci | 73817 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.46% % of reads unmapped: other | 1.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1200370 1200370 1200370 N_multimapping 2527335 2527335 2527335 N_noFeature 616531 20723825 805841 N_ambiguous 570606 2590 192312 UnstrandedReadsAssigned:20120105 PositiveStrandReadsAssigned:580827 NegativeStrandReadsAssigned:20309089 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389807 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389807-trimmed-pair1.fastq SRR11389807-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,034,947 reads, 22,801,504 reads pseudoaligned [quant] estimated average fragment length: 189.984 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52973 SRR11389807.ke.tsv 35125 SRR11389807.se.tsv 88098 total ==> SRR11389807.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 747.095 0 0 PNS24247 1044 855.016 20.9001 1.41837 PNS24249 1928 1739.02 84.0697 2.80513 PNS24246 1044 855.016 20.9001 1.41837 PNS24248 1044 855.016 20.9001 1.41837 PNS24244 1471 1282.02 31.2301 1.4135 PNS24243 293 119.914 0 0 KQK14069 1603 1414.02 158.381 6.49929 KQK14071 474 287.263 4.57272 0.923659 ==> SRR11389807.se.tsv <== BRADI_1g14170v3 183 BRADI_1g53295v3 12 BRADI_1g59795v3 295 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 210 BRADI_1g74790v3 141 BRADI_1g09890v3 0 BRADI_1g77505v3 158 BRADI_1g48960v3 0 SRR11389807 completed mapping pipeline successfully