Starting /dee2/code/volunteer_pipeline.sh SRR11389808 current disk space = 1544807452672 free memory = 1602354944 SRR11389808 SRAfilesize 1417d1a18b3b8e1f9c0ca83d5b590e39 SRR11389808.sra SRR11389808.sra file validated SRR11389808 is paired end SRR11389808 is conventional basespace SRR11389808 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389808_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.12575 32.0 32.0 32.0 32.0 32.0 2 30.99275 32.0 32.0 32.0 32.0 32.0 3 30.9965 32.0 32.0 32.0 32.0 32.0 4 31.0635 32.0 32.0 32.0 32.0 32.0 5 31.128 32.0 32.0 32.0 32.0 32.0 6 34.125 36.0 36.0 36.0 32.0 36.0 7 34.26 36.0 36.0 36.0 32.0 36.0 8 34.13925 36.0 36.0 36.0 32.0 36.0 9 34.28125 36.0 36.0 36.0 32.0 36.0 10-11 34.19025 36.0 36.0 36.0 32.0 36.0 12-13 34.325375 36.0 36.0 36.0 32.0 36.0 14-15 34.2945 36.0 36.0 36.0 32.0 36.0 16-17 34.2385 36.0 36.0 36.0 32.0 36.0 18-19 34.20325 36.0 36.0 36.0 32.0 36.0 20-21 34.17 36.0 36.0 36.0 32.0 36.0 22-23 33.92925 36.0 36.0 36.0 32.0 36.0 24-25 33.993625 36.0 36.0 36.0 32.0 36.0 26-27 33.841125000000005 36.0 36.0 36.0 32.0 36.0 28-29 33.777625 36.0 36.0 36.0 32.0 36.0 30-31 33.840125 36.0 36.0 36.0 32.0 36.0 32-33 33.61825 36.0 36.0 36.0 29.5 36.0 34-35 33.674499999999995 36.0 36.0 36.0 32.0 36.0 36-37 33.830819507290094 36.0 36.0 36.0 32.0 36.0 38-39 33.805178481649065 36.0 36.0 36.0 32.0 36.0 40-41 33.80203619909502 36.0 36.0 36.0 27.0 36.0 42-43 33.570010055304174 36.0 36.0 36.0 27.0 36.0 44-45 33.40422322775264 36.0 36.0 36.0 24.0 36.0 46-47 33.28783308195073 36.0 36.0 36.0 21.0 36.0 48-49 33.253929931191834 36.0 36.0 36.0 17.5 36.0 50-51 33.32700528036209 36.0 36.0 36.0 21.0 36.0 52-53 33.25094292180035 36.0 36.0 36.0 21.0 36.0 54-55 33.01295271629779 36.0 32.0 36.0 21.0 36.0 56-57 32.78584004024145 36.0 32.0 36.0 14.0 36.0 58-59 32.774522132796776 36.0 34.0 36.0 14.0 36.0 60-61 32.84756526580869 36.0 34.0 36.0 14.0 36.0 62-63 32.53643868519354 36.0 32.0 36.0 14.0 36.0 64-65 32.51423528934278 36.0 32.0 36.0 14.0 36.0 66-67 32.35222978080121 36.0 32.0 36.0 14.0 36.0 68-69 32.341693975296195 36.0 32.0 36.0 14.0 36.0 70-71 32.219254302336765 36.0 32.0 36.0 14.0 36.0 72-73 32.148975988566704 36.0 32.0 36.0 14.0 36.0 74-75 32.06055806541144 36.0 32.0 36.0 14.0 36.0 76 30.879252336448598 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 2.0 23 10.0 24 15.0 25 24.0 26 52.0 27 64.0 28 111.0 29 142.0 30 185.0 31 288.0 32 369.0 33 592.0 34 1053.0 35 1069.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.42232277526395 12.594268476621417 11.789844142785318 35.193564605329314 2 25.38964303670186 14.077425842131724 34.01206636500754 26.520864756158876 3 24.258421317244846 20.613373554550023 23.353443941679235 31.77476118652589 4 28.934137757667173 27.677224736048267 19.1553544494721 24.233283056812468 5 25.49019607843137 31.096028154851684 22.146807440925087 21.266968325791854 6 24.05863027546121 30.78089461713419 25.17058377558757 19.989891331817034 7 17.295123177476118 25.49019607843137 36.82755153343389 20.38712921065862 8 19.180492709904478 24.233283056812468 30.542986425339368 26.043237807943694 9 21.61890397184515 21.74459527400704 31.77476118652589 24.86173956762192 10-11 22.385620915032682 31.88788335847159 22.90095525389643 22.825540472599297 12-13 23.868778280542987 24.145299145299145 25.816993464052292 26.168929110105584 14-15 22.54901960784314 26.407742584213175 26.269482151835096 24.773755656108598 16-17 24.258421317244846 25.188536953242835 25.23881347410759 25.314228255404725 18-19 22.80040221216692 25.13826043237808 25.84213172448467 26.21920563097034 20-21 24.007038712921066 25.226244343891402 25.38964303670186 25.37707390648567 22-23 23.66767219708396 25.703871292106584 25.36450477626948 25.26395173453997 24-25 23.001508295625943 26.48315736551031 24.937154348919055 25.578179989944694 26-27 22.58429793658782 26.144942123804732 24.786109713135378 26.484650226472066 28-29 24.383802816901408 25.452716297786722 25.490442655935613 24.673038229376257 30-31 22.296277665995976 26.043762575452718 26.1443661971831 25.51559356136821 32-33 23.80593262946204 25.188536953242835 24.98743086978381 26.018099547511316 34-35 23.0517848164907 26.86023127199598 25.188536953242835 24.899446958270488 36-37 24.182595573440643 25.503018108651908 25.47786720321932 24.83651911468813 38-39 23.55455002513826 25.62845651080945 25.427350427350426 25.38964303670186 40-41 23.453996983408747 25.892408245349426 25.50276520864756 25.150829562594268 42-43 23.65510306686777 25.1131221719457 26.35746606334842 24.87430869783811 44-45 22.67471091000503 25.351935646053292 25.213675213675213 26.759678230266466 46-47 24.34640522875817 24.57264957264957 25.087983911513323 25.992961287078938 48-49 22.979258328095536 24.751728472658705 25.619107479572595 26.64990571967316 50-51 23.384460648730197 25.194870505406087 25.433744028161932 25.986924817701784 52-53 23.874779984913253 24.352527030424945 25.056575308021124 26.716117676640682 54-55 24.09456740442656 25.51559356136821 25.113179074446677 25.27665995975855 56-57 23.72987927565392 25.138329979879277 25.213782696177063 25.918008048289735 58-59 23.52867203219316 24.93712273641851 25.138329979879277 26.395875251509054 60-61 24.059393481817036 24.990562476406193 26.135648672455012 24.81439536932176 62-63 23.335431088735053 24.48080553807426 25.663939584644428 26.519823788546255 64-65 24.200453286325864 24.13749685217829 25.71140770586754 25.950642155628305 66-67 23.41899722852104 24.313429075333836 25.346434870244394 26.92113882590073 68-69 23.59465591126796 25.321401562893875 25.19536173430804 25.888580791530124 70-71 23.720050441361916 25.09457755359395 25.712484237074403 25.472887767969738 72-73 24.32192648922687 25.34854245880862 24.752851711026615 25.576679340937897 74-75 24.69911741107248 22.037978069002406 25.514843541053757 27.748060978871358 76 28.186915887850468 0.0 35.96261682242991 35.85046728971963 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 28.0 1 14.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 8.0 19 16.5 20 17.0 21 19.0 22 24.5 23 19.5 24 11.5 25 12.5 26 17.0 27 24.0 28 25.5 29 25.0 30 30.5 31 39.0 32 46.5 33 48.5 34 63.0 35 85.5 36 99.5 37 117.5 38 126.5 39 138.0 40 151.5 41 153.0 42 168.5 43 198.5 44 217.0 45 205.5 46 195.5 47 187.5 48 177.0 49 164.5 50 140.0 51 122.0 52 109.5 53 112.5 54 120.5 55 115.0 56 109.0 57 121.0 58 134.5 59 135.5 60 125.0 61 109.5 62 107.5 63 100.0 64 92.5 65 86.0 66 66.5 67 53.5 68 49.5 69 47.5 70 45.0 71 41.5 72 47.5 73 44.0 74 28.0 75 23.0 76 22.0 77 21.5 78 17.0 79 11.5 80 7.0 81 4.0 82 3.5 83 1.5 84 1.5 85 2.0 86 2.0 87 1.5 88 1.0 89 1.5 90 2.0 91 1.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.5499999999999999 3 0.5499999999999999 4 0.5499999999999999 5 0.5499999999999999 6 1.075 7 0.5499999999999999 8 0.5499999999999999 9 0.5499999999999999 10-11 0.5499999999999999 12-13 0.5499999999999999 14-15 0.5499999999999999 16-17 0.5499999999999999 18-19 0.5499999999999999 20-21 0.5499999999999999 22-23 0.5499999999999999 24-25 0.5499999999999999 26-27 0.65 28-29 0.6 30-31 0.6 32-33 0.5499999999999999 34-35 0.5499999999999999 36-37 0.050276520864756154 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.05030813734121495 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 22.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 1.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 1.0 61 2.0 62 1.0 63 0.0 64 2.0 65 1.0 66 0.0 67 2.0 68 0.0 69 1.0 70 2.0 71 11.0 72 16.0 73 62.0 74 272.0 75 928.0 76 2675.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.475 #Duplication Level Percentage of deduplicated Percentage of total 1 96.77163270706536 91.425 2 2.0640381053188674 3.9 3 0.7144747287642234 2.025 4 0.26462026991267534 1.0 5 0.07938608097380259 0.375 6 0.02646202699126753 0.15 7 0.0 0.0 8 0.0 0.0 9 0.02646202699126753 0.22499999999999998 >10 0.05292405398253506 0.8999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 22 0.5499999999999999 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 14 0.35000000000000003 No Hit GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 9 0.22499999999999998 No Hit CTTATTTTTTCTCTTTTTATTTTGTTTCTTTTTATTTAGACCTTCTTCATATTTAGTTTTATCTATTAATCGAT 6 0.15 No Hit CCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATTT 5 0.125 No Hit ATTAATCGATAGTATCTACCGGCGCGAACTCGAATTTGATCGCCTTCCAT 5 0.125 No Hit CAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11389808 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389808_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.69375 32.0 32.0 32.0 32.0 32.0 2 30.3265 32.0 32.0 32.0 32.0 32.0 3 30.13025 32.0 32.0 32.0 21.0 32.0 4 30.105 32.0 32.0 32.0 21.0 32.0 5 30.14375 32.0 32.0 32.0 21.0 32.0 6 33.2895 36.0 36.0 36.0 21.0 36.0 7 33.47775 36.0 36.0 36.0 21.0 36.0 8 33.29025 36.0 36.0 36.0 21.0 36.0 9 33.166 36.0 36.0 36.0 21.0 36.0 10-11 33.17274999999999 36.0 36.0 36.0 21.0 36.0 12-13 33.247375000000005 36.0 36.0 36.0 21.0 36.0 14-15 33.076 36.0 36.0 36.0 21.0 36.0 16-17 33.092625 36.0 36.0 36.0 21.0 36.0 18-19 32.938625 36.0 36.0 36.0 14.0 36.0 20-21 32.836375000000004 36.0 36.0 36.0 14.0 36.0 22-23 32.815749999999994 36.0 36.0 36.0 14.0 36.0 24-25 32.810625 36.0 36.0 36.0 14.0 36.0 26-27 32.65125 36.0 36.0 36.0 14.0 36.0 28-29 32.557500000000005 36.0 36.0 36.0 14.0 36.0 30-31 32.5235 36.0 36.0 36.0 14.0 36.0 32-33 32.59162499999999 36.0 36.0 36.0 14.0 36.0 34-35 32.709125 36.0 36.0 36.0 14.0 36.0 36-37 32.88416939752962 36.0 36.0 36.0 14.0 36.0 38-39 32.783085455003786 36.0 36.0 36.0 14.0 36.0 40-41 32.7695991933451 36.0 36.0 36.0 14.0 36.0 42-43 32.83135870935216 36.0 36.0 36.0 14.0 36.0 44-45 32.61078900932695 36.0 36.0 36.0 14.0 36.0 46-47 32.361482228384176 36.0 34.0 36.0 14.0 36.0 48-49 32.569006679030394 36.0 34.0 36.0 14.0 36.0 50-51 32.33560262228946 36.0 32.0 36.0 14.0 36.0 52-53 32.180660615229456 36.0 32.0 36.0 14.0 36.0 54-55 32.23051702395965 36.0 32.0 36.0 14.0 36.0 56-57 32.023707440100885 36.0 32.0 36.0 14.0 36.0 58-59 31.78638083228247 36.0 32.0 36.0 14.0 36.0 60-61 31.83833543505675 36.0 32.0 36.0 14.0 36.0 62-63 31.860686297774862 36.0 32.0 36.0 14.0 36.0 64-65 31.521640831524834 36.0 32.0 36.0 14.0 36.0 66-67 31.52159090909091 36.0 32.0 36.0 14.0 36.0 68-69 31.438984335522992 36.0 32.0 36.0 14.0 36.0 70-71 31.378556443796125 36.0 32.0 36.0 14.0 36.0 72-73 31.16423016382223 36.0 32.0 36.0 14.0 36.0 74-75 31.071470954414302 36.0 32.0 36.0 14.0 36.0 76 29.87815918521313 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 33.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 2.0 12 0.0 13 1.0 14 3.0 15 6.0 16 18.0 17 16.0 18 13.0 19 9.0 20 11.0 21 10.0 22 14.0 23 39.0 24 33.0 25 47.0 26 61.0 27 96.0 28 131.0 29 170.0 30 218.0 31 318.0 32 464.0 33 645.0 34 938.0 35 702.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.0 19.596469104665825 10.163934426229508 30.23959646910467 2 31.651954602774275 22.295081967213115 27.994955863808325 18.05800756620429 3 25.964204688681626 26.871691454499626 21.678850516763298 25.485253340055458 4 29.115200403327453 31.88807663221578 16.990168893370306 22.006554071086462 5 27.804386186034787 32.291404083690445 18.7295185278548 21.174691202419964 6 24.50214267708596 34.25762540962944 20.267204436601965 20.97302747668263 7 25.23317368288379 16.359969750441138 34.28283337534661 24.124023191328458 8 25.548549810844897 20.88272383354351 23.682219419924337 29.88650693568726 9 24.81070166582534 21.93336698637052 25.769813225643613 27.486118122160523 10-11 27.916087451029952 27.03146720586377 19.9039555162391 25.14848982686718 12-13 28.138801261829656 20.65615141955836 22.902208201892744 28.30283911671924 14-15 26.73505572441743 24.05015197568389 23.898176291793312 25.31661600810537 16-17 28.538899430740038 23.883617963314357 22.087286527514234 25.49019607843137 18-19 27.496198682209833 24.12569690826153 23.327420172326406 25.05068423720223 20-21 27.449238578680202 24.885786802030456 23.14720812182741 24.517766497461928 22-23 28.169727675744145 24.35718809373021 23.014566181127297 24.458518049398354 24-25 27.452471482889734 24.283903675538657 22.927756653992397 25.335868187579212 26-27 27.347611202635914 25.053858826511217 22.41794449372703 25.180585477125838 28-29 26.677660789039702 25.041227958898897 23.03691488012178 25.244196371939616 30-31 27.22665653110351 25.85835550487774 22.336247307741036 24.578740656277713 32-33 25.821179454660747 24.12175015852885 23.880786303107165 26.176284083703234 34-35 27.772848269742678 23.89402966155406 23.437698060590694 24.895424008112563 36-37 26.915793460421668 24.100492362075496 23.26726423431385 25.71644994318899 38-39 26.836051068132978 25.243332069270636 23.182909872329667 24.737706990266716 40-41 27.270424319189363 25.38315389487017 22.67257758074731 24.67384420519316 42-43 27.88874841972187 24.943109987357776 22.5031605562579 24.664981036662454 44-45 26.901693201920647 25.15794794035886 23.224665150366437 24.715693707354056 46-47 27.240506329113924 25.544303797468356 22.936708860759495 24.27848101265823 48-49 26.055625790139064 24.58912768647282 24.5385587863464 24.816687737041722 50-51 26.491737101047054 24.864387536268453 23.501955342500317 25.141920020184184 52-53 27.10493046776233 25.423514538558788 22.085967130214918 25.38558786346397 54-55 27.38982194721556 25.154691248895062 23.033211264048493 24.42227553984089 56-57 26.77692210579472 25.362959222320413 23.38088625173589 24.47923242014897 58-59 26.76091895985862 25.044180762433726 23.12547336531179 25.06942691239586 60-61 26.62042875157629 25.05674653215637 23.203026481715007 25.11979823455233 62-63 26.76678445229682 24.936900555275113 22.753659767794044 25.542655224634025 64-65 27.42200328407225 23.973727422003286 23.405330301882028 25.198938992042443 66-67 27.192317412180945 24.98104624715694 23.591104371998988 24.23553196866313 68-69 26.402223345123797 25.631632137443155 23.43355229914098 24.532592218292066 70-71 26.52751423149905 24.971537001897534 23.542061986084757 24.95888678051866 72-73 27.05732484076433 24.40764331210191 23.75796178343949 24.777070063694268 74-75 26.293800539083556 23.072776280323453 24.582210242587603 26.051212938005392 76 29.27197284043757 0.0 32.96869105997737 37.75933609958506 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 37.0 1 18.5 2 0.5 3 1.5 4 2.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.5 12 2.0 13 1.0 14 0.0 15 0.5 16 1.0 17 1.0 18 8.5 19 12.5 20 7.0 21 7.5 22 12.0 23 13.5 24 10.5 25 10.0 26 11.5 27 11.5 28 12.0 29 15.0 30 26.5 31 38.0 32 37.5 33 33.0 34 43.0 35 75.0 36 95.5 37 95.5 38 102.5 39 104.5 40 109.5 41 128.5 42 143.5 43 159.5 44 161.0 45 153.5 46 158.0 47 165.5 48 153.0 49 143.0 50 151.0 51 145.0 52 130.0 53 131.5 54 142.5 55 131.0 56 125.5 57 124.0 58 123.5 59 136.0 60 139.5 61 150.5 62 159.0 63 135.5 64 114.0 65 102.0 66 91.0 67 91.0 68 75.5 69 68.0 70 76.5 71 76.5 72 70.5 73 50.5 74 44.5 75 49.0 76 42.0 77 27.5 78 13.0 79 10.5 80 11.0 81 10.0 82 8.5 83 7.0 84 4.5 85 3.5 86 4.0 87 4.0 88 2.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 1.5 99 3.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8750000000000001 2 0.8750000000000001 3 0.8250000000000001 4 0.8250000000000001 5 0.8250000000000001 6 0.8250000000000001 7 0.8250000000000001 8 0.8750000000000001 9 0.95 10-11 1.0875 12-13 0.9375 14-15 1.3 16-17 1.1875 18-19 1.35 20-21 1.5 22-23 1.3125 24-25 1.375 26-27 1.3625 28-29 1.4625000000000001 30-31 1.3375 32-33 1.4375 34-35 1.3875 36-37 0.16385177716158306 38-39 0.2898916057474162 40-41 0.49155533148474917 42-43 0.3024955886059995 44-45 0.25207965717166625 46-47 0.4285354171918326 48-49 0.28992814824152274 50-51 0.06303580433686333 52-53 0.27735753908219873 54-55 0.13871374527112232 56-57 0.11349306431273644 58-59 0.1008827238335435 60-61 0.0 62-63 0.012618296529968456 64-65 0.07572889057175312 66-67 0.07575757575757576 68-69 0.0 70-71 0.02529404325281396 72-73 0.19071837253655435 74-75 0.1748957352347639 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 33.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 1.0 49 0.0 50 0.0 51 0.0 52 0.0 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 2.0 62 1.0 63 0.0 64 1.0 65 1.0 66 0.0 67 2.0 68 0.0 69 1.0 70 7.0 71 7.0 72 21.0 73 71.0 74 269.0 75 931.0 76 2651.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.575 #Duplication Level Percentage of deduplicated Percentage of total 1 96.56357388316151 91.325 2 2.5112344699973566 4.75 3 0.63441712926249 1.7999999999999998 4 0.10573618821041501 0.4 5 0.07930214115781126 0.375 6 0.05286809410520751 0.3 7 0.0 0.0 8 0.0 0.0 9 0.026434047052603753 0.22499999999999998 >10 0.026434047052603753 0.8250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 33 0.8250000000000001 No Hit GGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACA 9 0.22499999999999998 No Hit CTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTG 6 0.15 No Hit GATTAATAGATAAAACTAAATATGAAGAAGGTCTAAATAAAAAGAAACAA 6 0.15 No Hit AGGCGATCAAATTCGAGTTCGCGCCGGTAGATACTATCGATTAATAGATA 5 0.125 No Hit GGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTG 5 0.125 No Hit GGCAGGTACTGGACAATGTGGAAGCTGCCCATGTTCGGGTGCACCGACGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1374155 spots for SRR11389808.sra Written 1374155 spots for SRR11389808.sra Read 1374155 spots for SRR11389808.sra Written 1374155 spots for SRR11389808.sra Read 1374155 spots for SRR11389808.sra Written 1374155 spots for SRR11389808.sra Read 1374155 spots for SRR11389808.sra Written 1374155 spots for SRR11389808.sra Read 1374155 spots for SRR11389808.sra Written 1374155 spots for SRR11389808.sra Read 1374155 spots for SRR11389808.sra Written 1374155 spots for SRR11389808.sra Read 1374155 spots for SRR11389808.sra Written 1374155 spots for SRR11389808.sra Read 1374155 spots for SRR11389808.sra Written 1374155 spots for SRR11389808.sra Read 1374155 spots for SRR11389808.sra Written 1374155 spots for SRR11389808.sra Read 1374155 spots for SRR11389808.sra Written 1374155 spots for SRR11389808.sra Read 1374155 spots for SRR11389808.sra Written 1374155 spots for SRR11389808.sra Read 1374155 spots for SRR11389808.sra Written 1374155 spots for SRR11389808.sra Read 1374155 spots for SRR11389808.sra Written 1374155 spots for SRR11389808.sra Read 1374155 spots for SRR11389808.sra Written 1374155 spots for SRR11389808.sra Read 1374155 spots for SRR11389808.sra Written 1374155 spots for SRR11389808.sra Read 1374155 spots for SRR11389808.sra Written 1374155 spots for SRR11389808.sra Read 1374155 spots for SRR11389808.sra Written 1374155 spots for SRR11389808.sra Read 1374161 spots for SRR11389808.sra Written 1374161 spots for SRR11389808.sra Read 1374155 spots for SRR11389808.sra Written 1374155 spots for SRR11389808.sra Read 1374155 spots for SRR11389808.sra Written 1374155 spots for SRR11389808.sra SRR ids: ['SRR11389808.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9kel9isk SRR11389808.sra spots: 27483106 blocks: [[1, 1374155], [1374156, 2748310], [2748311, 4122465], [4122466, 5496620], [5496621, 6870775], [6870776, 8244930], [8244931, 9619085], [9619086, 10993240], [10993241, 12367395], [12367396, 13741550], [13741551, 15115705], [15115706, 16489860], [16489861, 17864015], [17864016, 19238170], [19238171, 20612325], [20612326, 21986480], [21986481, 23360635], [23360636, 24734790], [24734791, 26108945], [26108946, 27483106]] SRR11389808 file size 5219843 SRR11389808 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389808 SRR11389808_1.fastq SRR11389808_2.fastq Input file: SRR11389808_1.fastq Paired file: SRR11389808_2.fastq trimmed: SRR11389808-trimmed-pair1.fastq, SRR11389808-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:05:22 2024 >> started Sat Dec 7 07:05:45 2024 >> done (22.860s) 27483106 read pairs processed; of these: 721 ( 0.00%) short read pairs filtered out after trimming by size control 470164 ( 1.71%) empty read pairs filtered out after trimming by size control 27012221 (98.29%) read pairs available; of these: 34581 ( 0.13%) trimmed read pairs available after processing 26977640 (99.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 871 0.00% 19 24 0.00% 20 1248 0.00% 21 32 0.00% 22 1479 0.01% 23 29 0.00% 24 1655 0.01% 25 38 0.00% 26 1799 0.01% 27 31 0.00% 28 1696 0.01% 29 31 0.00% 30 1287 0.00% 31 29 0.00% 32 935 0.00% 33 16 0.00% 34 904 0.00% 35 151 0.00% 36 2078 0.01% 37 172 0.00% 38 1115 0.00% 39 250 0.00% 40 655 0.00% 41 334 0.00% 42 461 0.00% 43 408 0.00% 44 542 0.00% 45 558 0.00% 46 599 0.00% 47 622 0.00% 48 793 0.00% 49 850 0.00% 50 922 0.00% 51 1091 0.00% 52 1206 0.00% 53 1378 0.01% 54 1555 0.01% 55 1878 0.01% 56 2661 0.01% 57 2852 0.01% 58 2984 0.01% 59 3049 0.01% 60 3260 0.01% 61 3368 0.01% 62 3905 0.01% 63 4588 0.02% 64 5083 0.02% 65 5566 0.02% 66 6356 0.02% 67 7090 0.03% 68 7225 0.03% 69 8101 0.03% 70 9683 0.04% 71 13129 0.05% 72 40839 0.15% 73 248985 0.92% 74 1864028 6.90% 75 12158972 45.01% 76 12580775 46.57% 27012221 reads passed initial QC criterion=sequence-density sequence-density=1.22 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=21 prefix-density=1.16 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=36.85 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.6 sequence=GTTCTCCTTCTAATGCAAACAGCACGCATTCAAGAGGAGAGAGAAATGAACAAGTGAGCAGAAGAACAAAGATGCCCGGATTCATCTCACAAATAACCGAGGGATATTACACAAACACCATCTTTAGTGTACAACACCAACTCCTCATCTCTGACTTTCACATGCAACATCTATCAGTCCTGACTCCTGACTCAATCTCGACACATGCAGCAGCATCCATCATCAACAATGACGTCGTCGGCCAAGCGCCTCAGCATAGAGCAGGCGCTGGAGCTTGCTAACTAAGCTCACTTGCCGG criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=18 prefix-density=0.83 prefix-fanout=2.5 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=9.11 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=2.4 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC SRR11389808 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:06:31 Started mapping on | Dec 07 07:06:34 Finished on | Dec 07 07:08:10 Mapping speed, Million of reads per hour | 1012.96 Number of input reads | 27012221 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 21801440 Uniquely mapped reads % | 80.71% Average mapped length | 150.29 Number of splices: Total | 7198340 Number of splices: Annotated (sjdb) | 6837965 Number of splices: GT/AG | 7103334 Number of splices: GC/AG | 81406 Number of splices: AT/AC | 1526 Number of splices: Non-canonical | 12074 Mismatch rate per base, % | 0.67% Deletion rate per base | 0.01% Deletion average length | 1.64 Insertion rate per base | 0.01% Insertion average length | 1.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3651293 % of reads mapped to multiple loci | 13.52% Number of reads mapped to too many loci | 147933 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.29% % of reads unmapped: other | 1.94% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1559488 1559488 1559488 N_multimapping 3651293 3651293 3651293 N_noFeature 775234 21149305 972949 N_ambiguous 768717 4078 357467 UnstrandedReadsAssigned:20257489 PositiveStrandReadsAssigned:648057 NegativeStrandReadsAssigned:20471024 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389808 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389808-trimmed-pair1.fastq SRR11389808-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,012,221 reads, 24,046,060 reads pseudoaligned [quant] estimated average fragment length: 191.39 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52973 SRR11389808.ke.tsv 35125 SRR11389808.se.tsv 88098 total ==> SRR11389808.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 745.699 0 0 PNS24247 1044 853.61 8.05367 0.513515 PNS24249 1928 1737.61 76.0442 2.38195 PNS24246 1044 853.61 8.05367 0.513515 PNS24248 1044 853.61 8.05367 0.513515 PNS24244 1471 1280.61 78.7948 3.34888 PNS24243 293 117.314 0 0 KQK14069 1603 1412.61 592.529 22.83 KQK14071 474 285.426 34.1434 6.51076 ==> SRR11389808.se.tsv <== BRADI_1g14170v3 661 BRADI_1g53295v3 19 BRADI_1g59795v3 684 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 382 BRADI_1g74790v3 114 BRADI_1g09890v3 1 BRADI_1g77505v3 205 BRADI_1g48960v3 0 SRR11389808 completed mapping pipeline successfully