Starting /dee2/code/volunteer_pipeline.sh SRR11389809 current disk space = 1544781213696 free memory = 1603299736 SRR11389809 SRAfilesize 2fc13fc6d06c78557b70984a9209a9f3 SRR11389809.sra SRR11389809.sra file validated SRR11389809 is paired end SRR11389809 is conventional basespace SRR11389809 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389809_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.00975 32.0 32.0 32.0 32.0 32.0 2 30.944 32.0 32.0 32.0 32.0 32.0 3 30.96575 32.0 32.0 32.0 32.0 32.0 4 31.0725 32.0 32.0 32.0 32.0 32.0 5 31.08575 32.0 32.0 32.0 32.0 32.0 6 34.2135 36.0 36.0 36.0 32.0 36.0 7 34.1795 36.0 36.0 36.0 32.0 36.0 8 34.20375 36.0 36.0 36.0 32.0 36.0 9 34.13925 36.0 36.0 36.0 32.0 36.0 10-11 34.028 36.0 36.0 36.0 32.0 36.0 12-13 34.15275 36.0 36.0 36.0 32.0 36.0 14-15 34.170625 36.0 36.0 36.0 32.0 36.0 16-17 34.0705 36.0 36.0 36.0 32.0 36.0 18-19 34.047625 36.0 36.0 36.0 32.0 36.0 20-21 33.9875 36.0 36.0 36.0 32.0 36.0 22-23 33.885000000000005 36.0 36.0 36.0 32.0 36.0 24-25 33.853625 36.0 36.0 36.0 32.0 36.0 26-27 33.666 36.0 36.0 36.0 32.0 36.0 28-29 33.652249999999995 36.0 36.0 36.0 32.0 36.0 30-31 33.63975 36.0 36.0 36.0 32.0 36.0 32-33 33.494625 36.0 36.0 36.0 29.5 36.0 34-35 33.586625 36.0 36.0 36.0 32.0 36.0 36-37 33.86533246975077 36.0 36.0 36.0 32.0 36.0 38-39 33.706431273644384 36.0 36.0 36.0 29.5 36.0 40-41 33.63404791929382 36.0 36.0 36.0 26.5 36.0 42-43 33.58802017654477 36.0 36.0 36.0 26.5 36.0 44-45 33.40807061790668 36.0 36.0 36.0 24.0 36.0 46-47 33.25561160151324 36.0 36.0 36.0 21.0 36.0 48-49 33.451324085750315 36.0 36.0 36.0 24.0 36.0 50-51 33.276418663303915 36.0 36.0 36.0 21.0 36.0 52-53 33.097477931904166 36.0 36.0 36.0 17.5 36.0 54-55 33.015006305170246 36.0 34.0 36.0 21.0 36.0 56-57 32.80554854981085 36.0 32.0 36.0 17.5 36.0 58-59 32.87061790668348 36.0 34.0 36.0 17.5 36.0 60-61 32.902522068095834 36.0 34.0 36.0 14.0 36.0 62-63 32.35170239596469 36.0 32.0 36.0 14.0 36.0 64-65 32.55119798234553 36.0 32.0 36.0 14.0 36.0 66-67 32.24451450189155 36.0 32.0 36.0 14.0 36.0 68-69 32.20347914857233 36.0 32.0 36.0 14.0 36.0 70-71 32.07130237253912 36.0 32.0 36.0 14.0 36.0 72-73 32.07870029913687 36.0 32.0 36.0 14.0 36.0 74-75 31.84175557371008 36.0 32.0 36.0 14.0 36.0 76 30.448402497245684 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 34.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 4.0 22 6.0 23 3.0 24 14.0 25 28.0 26 41.0 27 82.0 28 100.0 29 125.0 30 219.0 31 291.0 32 382.0 33 601.0 34 1019.0 35 1051.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.333837619768026 13.867876954109933 11.67423096318709 38.12405446293495 2 24.76046394351992 14.069591527987896 36.964195663136664 24.205748865355524 3 24.155320221886033 21.3565305093293 21.50781643973777 32.9803328290469 4 27.93746848209783 28.113968734241052 19.591527987897127 24.357034795763994 5 24.8613212304589 32.02218860312658 23.22239031770045 19.89409984871407 6 22.300884955752213 31.88369152970923 25.360303413400757 20.4551201011378 7 17.650025214321737 23.903177004538577 37.518910741301056 20.927887039838627 8 18.784669692385275 23.17196167423096 31.820474029248615 26.22289460413515 9 21.02874432677761 20.600100857286936 33.05597579425113 25.315179021684315 10-11 21.64649520927887 31.215330307614725 22.680282400403428 24.457892082702976 12-13 24.00403429147756 23.53756933938477 26.34896621280888 26.109430156328795 14-15 23.00806858295512 25.718608169440245 25.542107917297024 25.731215330307617 16-17 23.323247604639434 25.668179525970753 25.100857286938982 25.90771558245083 18-19 23.29803328290469 25.95814422592032 25.529500756429652 25.214321734745337 20-21 23.05849722642461 25.630358043368634 25.592536560766515 25.718608169440245 22-23 23.43966712898752 25.028369688563863 25.406632202748707 26.12533097969991 24-25 23.966212808875444 26.336359051941503 24.10489157841654 25.592536560766515 26-27 23.64140713655277 25.11663094187366 25.494893456058502 25.747068465515067 28-29 23.530895334174023 25.245901639344265 25.69987389659521 25.523329129886505 30-31 23.187492119530955 25.73445971504224 25.419240953221532 25.65880721220527 32-33 23.127364438839848 26.746532156368225 24.615384615384617 25.510718789407317 34-35 23.707440100882724 25.69987389659521 25.561160151324085 25.031525851197983 36-37 24.50189155107188 25.422446406052963 24.047919293820932 26.027742749054223 38-39 23.833543505674655 25.72509457755359 25.11979823455233 25.321563682219423 40-41 23.745271122320304 24.539722572509458 26.10340479192938 25.611601513240856 42-43 24.71626733921816 24.854981084489282 24.993694829760404 25.435056746532158 44-45 23.00126103404792 25.75031525851198 25.258511979823457 25.989911727616644 46-47 24.615384615384617 24.88020176544767 25.27112232030265 25.23329129886507 48-49 22.976040353089534 25.170239596469106 25.901639344262296 25.952080706179064 50-51 22.18158890290038 25.19546027742749 26.48171500630517 26.141235813366958 52-53 24.1109709962169 24.03530895334174 24.615384615384617 27.238335435056747 54-55 23.278688524590162 24.489281210592686 25.548549810844897 26.68348045397226 56-57 23.139974779319044 25.346784363177804 25.435056746532158 26.078184110970998 58-59 23.619167717528374 24.72887767969735 25.636822194199244 26.01513240857503 60-61 24.527112232030266 24.186633039092058 24.930643127364437 26.35561160151324 62-63 23.278688524590162 24.72887767969735 26.26733921815889 25.72509457755359 64-65 24.274905422446405 24.653215636822196 25.23329129886507 25.83858764186633 66-67 24.12358133669609 23.87137452711223 24.867591424968474 27.137452711223204 68-69 23.804718052226566 23.792102939321307 25.003153778226316 27.40002523022581 70-71 23.233215547703182 24.495204442200908 25.315497223624433 26.95608278647148 72-73 24.746450304259636 23.66886409736308 24.822515212981745 26.76217038539554 74-75 24.565856265028053 22.12129308041678 25.40742719743521 27.90542345711996 76 28.204186558942347 0.0 34.55747337495409 37.23834006610357 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 37.0 1 18.5 2 0.0 3 0.0 4 0.5 5 1.0 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 9.0 19 15.5 20 12.5 21 13.5 22 18.5 23 16.0 24 11.5 25 12.5 26 17.5 27 24.5 28 21.0 29 17.5 30 27.0 31 39.0 32 43.5 33 49.5 34 56.5 35 69.5 36 87.5 37 96.5 38 122.0 39 150.5 40 160.5 41 175.0 42 190.5 43 198.0 44 195.5 45 186.0 46 186.0 47 193.5 48 183.5 49 165.5 50 150.5 51 126.0 52 110.0 53 112.0 54 117.5 55 119.5 56 113.0 57 132.0 58 159.0 59 144.5 60 132.0 61 125.0 62 112.0 63 102.5 64 80.0 65 66.5 66 70.0 67 69.5 68 61.0 69 56.0 70 49.5 71 38.5 72 36.0 73 34.0 74 28.0 75 22.5 76 18.0 77 15.5 78 13.0 79 10.5 80 10.5 81 8.5 82 5.0 83 4.0 84 3.5 85 3.0 86 1.5 87 0.0 88 0.0 89 1.0 90 1.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.8500000000000001 3 0.8500000000000001 4 0.8500000000000001 5 0.8500000000000001 6 1.125 7 0.8500000000000001 8 0.8500000000000001 9 0.8500000000000001 10-11 0.8500000000000001 12-13 0.8500000000000001 14-15 0.8500000000000001 16-17 0.8500000000000001 18-19 0.8500000000000001 20-21 0.8500000000000001 22-23 0.8625 24-25 0.8500000000000001 26-27 0.8625 28-29 0.8750000000000001 30-31 0.8625 32-33 0.8750000000000001 34-35 0.8750000000000001 36-37 0.012608750472828143 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 34.0 36 1.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 1.0 68 1.0 69 1.0 70 0.0 71 11.0 72 14.0 73 70.0 74 248.0 75 896.0 76 2723.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.15 #Duplication Level Percentage of deduplicated Percentage of total 1 96.62772172065853 90.975 2 2.257036643653744 4.25 3 0.6372809346787042 1.7999999999999998 4 0.2655337227827934 1.0 5 0.10621348911311736 0.5 6 0.05310674455655868 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05310674455655868 1.175 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 34 0.8500000000000001 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 13 0.325 No Hit CCGGAGTTTATATTACATGCCCCTCTCCCAACGATAGTTGTAGTACTCTT 6 0.15 No Hit CAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACTGGTATAACACCTGGCATGG 6 0.15 No Hit GTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTA 5 0.125 No Hit CCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATTT 5 0.125 No Hit GTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCT 5 0.125 No Hit ATTTTTTCTCTTTTTATTTTGTTTCTTTTTATTTAGACCTTCTTCATATT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAGCCC 20 0.006620985 52.17188 51 >>END_MODULE SRR11389809 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389809_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.67525 32.0 32.0 32.0 32.0 32.0 2 30.393 32.0 32.0 32.0 32.0 32.0 3 30.27575 32.0 32.0 32.0 32.0 32.0 4 30.26875 32.0 32.0 32.0 32.0 32.0 5 30.3585 32.0 32.0 32.0 32.0 32.0 6 33.6305 36.0 36.0 36.0 32.0 36.0 7 33.6735 36.0 36.0 36.0 32.0 36.0 8 33.3135 36.0 36.0 36.0 21.0 36.0 9 33.3975 36.0 36.0 36.0 21.0 36.0 10-11 33.37050000000001 36.0 36.0 36.0 21.0 36.0 12-13 33.482375000000005 36.0 36.0 36.0 21.0 36.0 14-15 33.229875 36.0 36.0 36.0 21.0 36.0 16-17 33.299875 36.0 36.0 36.0 21.0 36.0 18-19 33.162 36.0 36.0 36.0 21.0 36.0 20-21 32.92225 36.0 36.0 36.0 17.5 36.0 22-23 33.0065 36.0 36.0 36.0 17.5 36.0 24-25 33.019375 36.0 36.0 36.0 14.0 36.0 26-27 32.761125 36.0 36.0 36.0 14.0 36.0 28-29 32.78275 36.0 36.0 36.0 14.0 36.0 30-31 32.794125 36.0 36.0 36.0 14.0 36.0 32-33 32.970625 36.0 36.0 36.0 17.5 36.0 34-35 32.899625 36.0 36.0 36.0 14.0 36.0 36-37 33.04503409183789 36.0 36.0 36.0 14.0 36.0 38-39 33.02889225334343 36.0 36.0 36.0 14.0 36.0 40-41 33.016780217007316 36.0 36.0 36.0 14.0 36.0 42-43 32.946631339894026 36.0 36.0 36.0 14.0 36.0 44-45 32.80393641180923 36.0 36.0 36.0 14.0 36.0 46-47 32.59071410547565 36.0 34.0 36.0 14.0 36.0 48-49 32.82134746404239 36.0 36.0 36.0 14.0 36.0 50-51 32.40764572293717 36.0 32.0 36.0 14.0 36.0 52-53 32.364370426444616 36.0 32.0 36.0 14.0 36.0 54-55 32.40701488771133 36.0 32.0 36.0 14.0 36.0 56-57 32.180292707544794 36.0 32.0 36.0 14.0 36.0 58-59 32.046303305576586 36.0 32.0 36.0 14.0 36.0 60-61 31.919253091092607 36.0 32.0 36.0 14.0 36.0 62-63 31.84393136512743 36.0 32.0 36.0 14.0 36.0 64-65 31.88695432752965 36.0 32.0 36.0 14.0 36.0 66-67 31.72508200857936 36.0 32.0 36.0 14.0 36.0 68-69 31.492107999754925 36.0 32.0 36.0 14.0 36.0 70-71 31.590868706023574 36.0 32.0 36.0 14.0 36.0 72-73 31.46602288578252 36.0 32.0 36.0 14.0 36.0 74-75 31.21275777833418 36.0 32.0 36.0 14.0 36.0 76 29.964180206794683 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 36.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 2.0 12 0.0 13 0.0 14 2.0 15 5.0 16 8.0 17 8.0 18 6.0 19 10.0 20 14.0 21 14.0 22 16.0 23 18.0 24 30.0 25 54.0 26 69.0 27 87.0 28 121.0 29 189.0 30 232.0 31 288.0 32 396.0 33 620.0 34 1030.0 35 743.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.651515151515156 19.62121212121212 10.252525252525253 32.474747474747474 2 30.89348813730439 21.60524987380111 28.874305906108027 18.62695608278647 3 24.394550958627647 27.04339051463169 22.805247225025226 25.756811301715437 4 29.313824419778 31.609485368314832 17.633703329969727 21.442986881937436 5 29.212916246215944 31.93743693239152 18.491422805247225 20.358224016145307 6 22.27547931382442 35.21695257315843 21.367305751765894 21.14026236125126 7 23.536831483350152 16.95257315842583 34.056508577194755 25.45408678102926 8 25.39762686190356 20.701842968947233 24.312042413531938 29.588487755617273 9 25.555555555555554 21.515151515151516 25.808080808080806 27.121212121212125 10-11 27.652041977493997 27.904918447338474 18.915159944367176 25.527879630800353 12-13 27.864089933055453 20.967538208917517 24.036882657572313 27.131489200454716 14-15 26.455696202531648 24.835443037974684 23.265822784810126 25.44303797468355 16-17 26.518218623481783 23.304655870445345 23.836032388663966 26.34109311740891 18-19 26.808564550867857 24.10997086025592 23.362473077410364 25.718991511465855 20-21 27.165504121750157 24.14711477488903 23.284717818642996 25.402663284717818 22-23 27.21631205673759 24.55673758865248 23.796859169199593 24.430091185410337 24-25 26.73593512417638 24.873289406994424 22.529143436391283 25.861632032437914 26-27 27.111561352412313 24.756236545523617 23.603900215271622 24.528301886792452 28-29 26.946487446107025 24.955617550088764 23.3578493532843 24.74004565051991 30-31 27.111561352412313 24.78156261871597 22.818791946308725 25.288084082563 32-33 26.600735387346262 24.838341574743247 23.646506910105238 24.91441612780525 34-35 27.094157901406668 24.35686224813078 23.520466354074262 25.02851349638829 36-37 27.047522750252778 23.824570273003033 23.281092012133467 25.846814964610722 38-39 26.47356438148242 24.588919807740954 23.488489754616747 25.44902605615988 40-41 26.313790046853235 24.23705204508041 23.097378751424593 26.351779156641765 42-43 27.339403136064742 24.0642387455741 23.394031360647446 25.202326757713706 44-45 26.39029322548028 24.330131445904954 23.14206268958544 26.13751263902932 46-47 26.88512145748988 24.519230769230766 23.228744939271255 25.366902834008098 48-49 25.95776962953597 24.200278164116828 24.94626375015805 24.895688456189152 50-51 25.88665909377761 25.04101981572637 23.324498296099964 25.747822794396065 52-53 26.662452591656134 24.917825537294565 22.90771175726928 25.512010113780025 54-55 26.87302590018951 24.11876184459886 23.727100442198356 25.28111181301327 56-57 26.222053808260704 24.40318302387268 23.733737526840976 25.64102564102564 58-59 26.704545454545453 24.52020202020202 23.762626262626263 25.012626262626263 60-61 27.003154574132495 24.64353312302839 23.053627760252365 25.299684542586753 62-63 27.906096175691026 23.99343682948378 23.602170894863058 24.498296099962136 64-65 26.950265084574603 23.83236556425145 23.630396364554407 25.58697298661954 66-67 26.297184698901653 24.50448175735387 23.797500315616716 25.400833228127762 68-69 26.813880126182966 24.706624605678236 23.50788643533123 24.971608832807572 70-71 27.189988623435724 23.47364429275692 23.208191126279864 26.128175957527493 72-73 26.31578947368421 24.701245868293924 23.862191711161962 25.120772946859905 74-75 26.79148706896552 21.92887931034483 24.838362068965516 26.44127155172414 76 29.98522895125554 0.0 33.75184638109306 36.262924667651404 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 40.0 1 20.0 2 0.0 3 0.0 4 0.5 5 1.0 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 5.0 19 7.5 20 5.0 21 5.5 22 8.0 23 8.0 24 12.0 25 12.5 26 12.0 27 16.0 28 18.0 29 17.5 30 24.5 31 31.0 32 33.5 33 38.5 34 43.0 35 60.5 36 79.5 37 86.5 38 91.5 39 106.0 40 120.0 41 144.5 42 168.5 43 174.5 44 178.0 45 161.5 46 149.5 47 165.0 48 167.5 49 150.5 50 146.0 51 143.0 52 125.5 53 117.0 54 119.0 55 129.5 56 131.0 57 138.5 58 162.5 59 154.0 60 146.5 61 145.0 62 128.0 63 113.5 64 103.5 65 92.5 66 90.0 67 96.5 68 89.5 69 79.5 70 79.5 71 81.0 72 68.0 73 51.5 74 44.5 75 37.5 76 30.5 77 28.5 78 21.5 79 13.5 80 11.0 81 8.0 82 6.0 83 5.0 84 4.0 85 2.5 86 2.0 87 2.0 88 2.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.5 94 1.0 95 1.0 96 1.0 97 0.5 98 1.0 99 1.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0 2 0.95 3 0.8999999999999999 4 0.8999999999999999 5 0.8999999999999999 6 0.8999999999999999 7 0.8999999999999999 8 0.975 9 1.0 10-11 1.1375 12-13 1.0375 14-15 1.25 16-17 1.2 18-19 1.3375 20-21 1.4375 22-23 1.3 24-25 1.35 26-27 1.2874999999999999 28-29 1.425 30-31 1.2874999999999999 32-33 1.4125 34-35 1.3625 36-37 0.18922669357890753 38-39 0.25233409033560433 40-41 0.3658844309866263 42-43 0.22710068130204392 44-45 0.17663386323492303 46-47 0.27756749936916475 48-49 0.21448397678526368 50-51 0.03785011355034065 52-53 0.20186727226848347 54-55 0.13878374968458237 56-57 0.11355034065102196 58-59 0.0757002271006813 60-61 0.012616704516780217 62-63 0.03785011355034065 64-65 0.05046681806712087 66-67 0.06308352258390108 68-69 0.0 70-71 0.05053695514845231 72-73 0.1142857142857143 74-75 0.1076426264800861 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 36.0 36 1.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 2.0 70 5.0 71 6.0 72 23.0 73 77.0 74 266.0 75 875.0 76 2708.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.925 #Duplication Level Percentage of deduplicated Percentage of total 1 96.83961021859363 91.925 2 2.4229654990782197 4.6 3 0.5267316302343955 1.5 4 0.07900974453515934 0.3 5 0.05267316302343956 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.07900974453515934 1.425 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 36 0.8999999999999999 No Hit GGAACTTTAGGACATCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTGTACA 11 0.27499999999999997 No Hit GGGAACGCGAAATCACTTTAGGTTTTGTTGATTTATTGCGCGACGATTTT 10 0.25 No Hit CCTGAACTAGCCGCAGCTTGTGAAGTATGGAAGGCGATCAAATTCGAGTT 5 0.125 No Hit GGGAAATGCACCTGGTGCAGCAGCTAATCGAGTGGCTTTAGAAGCCTGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 57 0.05 0.0 0.0 0.0 0.0 58 0.05 0.0 0.0 0.0 0.0 59 0.05 0.0 0.0 0.0 0.0 60 0.05 0.0 0.0 0.0 0.0 61 0.05 0.0 0.0 0.0 0.0 62 0.05 0.0 0.0 0.0 0.0 63 0.05 0.0 0.0 0.0 0.0 64 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1110040 spots for SRR11389809.sra Written 1110040 spots for SRR11389809.sra Read 1110040 spots for SRR11389809.sra Written 1110040 spots for SRR11389809.sra Read 1110040 spots for SRR11389809.sra Written 1110040 spots for SRR11389809.sra Read 1110040 spots for SRR11389809.sra Written 1110040 spots for SRR11389809.sra Read 1110040 spots for SRR11389809.sra Written 1110040 spots for SRR11389809.sra Read 1110040 spots for SRR11389809.sra Written 1110040 spots for SRR11389809.sra Read 1110040 spots for SRR11389809.sra Written 1110040 spots for SRR11389809.sra Read 1110040 spots for SRR11389809.sra Written 1110040 spots for SRR11389809.sra Read 1110040 spots for SRR11389809.sra Written 1110040 spots for SRR11389809.sra Read 1110040 spots for SRR11389809.sra Written 1110040 spots for SRR11389809.sra Read 1110040 spots for SRR11389809.sra Written 1110040 spots for SRR11389809.sra Read 1110040 spots for SRR11389809.sra Written 1110040 spots for SRR11389809.sra Read 1110040 spots for SRR11389809.sra Written 1110040 spots for SRR11389809.sra Read 1110045 spots for SRR11389809.sra Written 1110045 spots for SRR11389809.sra Read 1110040 spots for SRR11389809.sra Written 1110040 spots for SRR11389809.sra Read 1110040 spots for SRR11389809.sra Written 1110040 spots for SRR11389809.sra Read 1110040 spots for SRR11389809.sra Written 1110040 spots for SRR11389809.sra Read 1110040 spots for SRR11389809.sra Written 1110040 spots for SRR11389809.sra Read 1110040 spots for SRR11389809.sra Written 1110040 spots for SRR11389809.sra Read 1110040 spots for SRR11389809.sra Written 1110040 spots for SRR11389809.sra SRR ids: ['SRR11389809.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tmx_m5g4 SRR11389809.sra spots: 22200805 blocks: [[1, 1110040], [1110041, 2220080], [2220081, 3330120], [3330121, 4440160], [4440161, 5550200], [5550201, 6660240], [6660241, 7770280], [7770281, 8880320], [8880321, 9990360], [9990361, 11100400], [11100401, 12210440], [12210441, 13320480], [13320481, 14430520], [14430521, 15540560], [15540561, 16650600], [16650601, 17760640], [17760641, 18870680], [18870681, 19980720], [19980721, 21090760], [21090761, 22200805]] SRR11389809 file size 4210334 SRR11389809 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389809 SRR11389809_1.fastq SRR11389809_2.fastq Input file: SRR11389809_1.fastq Paired file: SRR11389809_2.fastq trimmed: SRR11389809-trimmed-pair1.fastq, SRR11389809-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:06:22 2024 >> started Sat Dec 7 07:06:39 2024 >> done (17.370s) 22200805 read pairs processed; of these: 568 ( 0.00%) short read pairs filtered out after trimming by size control 276989 ( 1.25%) empty read pairs filtered out after trimming by size control 21923248 (98.75%) read pairs available; of these: 27249 ( 0.12%) trimmed read pairs available after processing 21895999 (99.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 758 0.00% 19 21 0.00% 20 1164 0.01% 21 18 0.00% 22 1369 0.01% 23 32 0.00% 24 1592 0.01% 25 30 0.00% 26 1806 0.01% 27 26 0.00% 28 1770 0.01% 29 31 0.00% 30 1360 0.01% 31 28 0.00% 32 1134 0.01% 33 10 0.00% 34 944 0.00% 35 74 0.00% 36 2349 0.01% 37 66 0.00% 38 1386 0.01% 39 82 0.00% 40 734 0.00% 41 107 0.00% 42 381 0.00% 43 123 0.00% 44 254 0.00% 45 130 0.00% 46 194 0.00% 47 163 0.00% 48 235 0.00% 49 190 0.00% 50 275 0.00% 51 285 0.00% 52 312 0.00% 53 304 0.00% 54 363 0.00% 55 446 0.00% 56 1219 0.01% 57 993 0.00% 58 945 0.00% 59 704 0.00% 60 906 0.00% 61 820 0.00% 62 929 0.00% 63 1107 0.01% 64 1113 0.01% 65 1285 0.01% 66 1462 0.01% 67 1737 0.01% 68 1857 0.01% 69 2181 0.01% 70 2866 0.01% 71 4525 0.02% 72 27456 0.13% 73 198522 0.91% 74 1490170 6.80% 75 9808041 44.74% 76 10353864 47.23% 21923248 reads passed initial QC criterion=sequence-density sequence-density=1.08 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=27 prefix-density=1.02 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=10.50 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=1.6 sequence=GGAGAGAGAAATGAACAAGTGAGCAGAAGAACAAAGATGCCCGGATTCATCTCACAAATAACCGAGGGATATTACACAAACACCATCTTTAGTGTACAACACCAACTCCTCATCTCTGACTTTCACATGCAACATCTATCAGTCCTGACTCCTGACTCAATCTCGACACATGCAGCAGCATCCATCATCAACAATGACGTCGTCGGCCAAGCGCCTCAGCATAGAGCAGGCGCTGGAGCTTGCTAACTAAGCTCACTTGCCGG criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=16 prefix-density=0.88 prefix-fanout=2.4 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=6.87 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.5 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC SRR11389809 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:07:21 Started mapping on | Dec 07 07:07:21 Finished on | Dec 07 07:08:34 Mapping speed, Million of reads per hour | 1081.15 Number of input reads | 21923248 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 18014382 Uniquely mapped reads % | 82.17% Average mapped length | 150.37 Number of splices: Total | 6663329 Number of splices: Annotated (sjdb) | 6353255 Number of splices: GT/AG | 6576716 Number of splices: GC/AG | 75403 Number of splices: AT/AC | 1502 Number of splices: Non-canonical | 9708 Mismatch rate per base, % | 0.67% Deletion rate per base | 0.01% Deletion average length | 1.64 Insertion rate per base | 0.01% Insertion average length | 1.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2887241 % of reads mapped to multiple loci | 13.17% Number of reads mapped to too many loci | 86236 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.80% % of reads unmapped: other | 1.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1021625 1021625 1021625 N_multimapping 2887241 2887241 2887241 N_noFeature 609599 17484436 761903 N_ambiguous 627407 3753 280785 UnstrandedReadsAssigned:16777376 PositiveStrandReadsAssigned:526193 NegativeStrandReadsAssigned:16971694 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389809 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389809-trimmed-pair1.fastq SRR11389809-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,923,248 reads, 19,803,117 reads pseudoaligned [quant] estimated average fragment length: 202.445 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52973 SRR11389809.ke.tsv 35125 SRR11389809.se.tsv 88098 total ==> SRR11389809.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 734.632 0 0 PNS24247 1044 842.555 21.0174 1.61802 PNS24249 1928 1726.56 58.7721 2.20797 PNS24246 1044 842.555 21.0174 1.61802 PNS24248 1044 842.555 21.0174 1.61802 PNS24244 1471 1269.56 29.1756 1.49064 PNS24243 293 107.74 0 0 KQK14069 1603 1401.56 1093.74 50.6183 KQK14071 474 274.748 27.9367 6.59542 ==> SRR11389809.se.tsv <== BRADI_1g14170v3 1177 BRADI_1g53295v3 20 BRADI_1g59795v3 534 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 251 BRADI_1g74790v3 173 BRADI_1g09890v3 0 BRADI_1g77505v3 159 BRADI_1g48960v3 0 SRR11389809 completed mapping pipeline successfully