Starting /dee2/code/volunteer_pipeline.sh SRR11389811 current disk space = 1544716894208 free memory = 1601769276 SRR11389811 SRAfilesize 4479152d3fc7f728edd7d09e6eb36895 SRR11389811.sra SRR11389811.sra file validated SRR11389811 is paired end SRR11389811 is conventional basespace SRR11389811 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389811_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.15 32.0 32.0 32.0 32.0 32.0 2 31.05425 32.0 32.0 32.0 32.0 32.0 3 31.164 32.0 32.0 32.0 32.0 32.0 4 31.179 32.0 32.0 32.0 32.0 32.0 5 31.121 32.0 32.0 32.0 32.0 32.0 6 34.36725 36.0 36.0 36.0 32.0 36.0 7 34.38925 36.0 36.0 36.0 32.0 36.0 8 34.423 36.0 36.0 36.0 32.0 36.0 9 34.37 36.0 36.0 36.0 32.0 36.0 10-11 34.299875 36.0 36.0 36.0 32.0 36.0 12-13 34.516875 36.0 36.0 36.0 32.0 36.0 14-15 34.2995 36.0 36.0 36.0 32.0 36.0 16-17 34.232124999999996 36.0 36.0 36.0 32.0 36.0 18-19 34.211124999999996 36.0 36.0 36.0 32.0 36.0 20-21 34.33025 36.0 36.0 36.0 32.0 36.0 22-23 34.043 36.0 36.0 36.0 32.0 36.0 24-25 34.091875 36.0 36.0 36.0 32.0 36.0 26-27 33.977125 36.0 36.0 36.0 32.0 36.0 28-29 33.866125 36.0 36.0 36.0 32.0 36.0 30-31 33.872749999999996 36.0 36.0 36.0 32.0 36.0 32-33 33.773375 36.0 36.0 36.0 32.0 36.0 34-35 33.8175 36.0 36.0 36.0 32.0 36.0 36-37 34.04269211451532 36.0 36.0 36.0 32.0 36.0 38-39 33.80508592988973 36.0 36.0 36.0 32.0 36.0 40-41 33.660585898596224 36.0 36.0 36.0 27.0 36.0 42-43 33.48661001034324 36.0 36.0 36.0 24.0 36.0 44-45 33.25848203066097 36.0 36.0 36.0 17.5 36.0 46-47 33.575270168384016 36.0 36.0 36.0 27.0 36.0 48-49 33.47700427243026 36.0 36.0 36.0 24.0 36.0 50-51 33.49861031794846 36.0 36.0 36.0 24.0 36.0 52-53 33.35026745377928 36.0 36.0 36.0 21.0 36.0 54-55 33.072237603825826 36.0 34.0 36.0 20.5 36.0 56-57 32.716461112509435 36.0 32.0 36.0 14.0 36.0 58-59 32.864423700613585 36.0 34.0 36.0 14.0 36.0 60-61 32.820738494397816 36.0 34.0 36.0 14.0 36.0 62-63 32.40732434107251 36.0 32.0 36.0 14.0 36.0 64-65 32.52378076929051 36.0 32.0 36.0 14.0 36.0 66-67 32.53251404891047 36.0 32.0 36.0 14.0 36.0 68-69 32.27072342472988 36.0 32.0 36.0 14.0 36.0 70-71 32.39065631565431 36.0 32.0 36.0 14.0 36.0 72-73 31.95184220255115 36.0 32.0 36.0 14.0 36.0 74-75 31.835883914629626 36.0 32.0 36.0 14.0 36.0 76 30.60891089108911 36.0 27.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 3.0 22 2.0 23 3.0 24 8.0 25 36.0 26 47.0 27 70.0 28 118.0 29 141.0 30 191.0 31 277.0 32 360.0 33 553.0 34 953.0 35 1219.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.189854344550476 10.99949773982923 11.526870919136112 35.28377699648418 2 22.476142641888497 17.353088900050224 34.27925665494726 25.891511803114014 3 23.480662983425415 18.33249623304872 27.24761426418885 30.939226519337016 4 27.222501255650428 25.389251632345555 19.161225514816675 28.227021597187342 5 29.6082370668006 29.6082370668006 21.52184831742843 19.261677548970365 6 26.32771205638057 30.002516989680345 23.886232066448528 19.78353888749056 7 16.07232546459066 27.021597187343044 35.45956805625314 21.44650929181316 8 19.337016574585636 27.14716223003516 28.754394776494223 24.761426418884984 9 24.083375188347564 21.87343043696635 30.210949271722754 23.832245102963334 10-11 24.171270718232044 30.826217980914112 22.413360120542443 22.5891511803114 12-13 22.30035158211954 25.464590657960823 24.246609743847316 27.988448016072326 14-15 21.936212958312407 27.134605725765947 24.962330487192368 25.96685082872928 16-17 24.723756906077348 24.824208940231042 23.80713209442491 26.644902059266702 18-19 21.747865394274235 24.271722752385735 26.443997990959318 27.536413862380716 20-21 25.05022601707684 24.723756906077348 25.816172777498746 24.40984429934706 22-23 22.278035916112017 28.858470425718952 24.337561220645483 24.525932437523544 24-25 22.049221496735306 23.54344550477147 26.381215469613263 28.02611752887996 26-27 21.838503076729875 24.91523295240487 23.722215245510487 29.524048725354767 28-29 25.825901268684838 26.88104509483733 23.389021479713605 23.904032156764227 30-31 22.99384654024865 24.22453849051865 26.38452844405375 26.397086525178953 32-33 22.01708113539312 26.425521225822656 25.42074855563929 26.136649083144935 34-35 22.406430545089172 24.453654860587793 26.07385079125848 27.066063803064555 36-37 24.79276563677468 26.50087917608641 23.825671941723183 24.880683245415725 38-39 24.839884465653647 26.685922391058646 24.124073841517017 24.35011930177069 40-41 22.170581585227985 23.6904911443286 26.93129003893983 27.20763723150358 42-43 21.723834652594547 26.32240231184822 27.01344389998744 24.940319135569794 44-45 22.995727569741142 24.17692887660216 25.835637094747423 26.991706458909277 46-47 24.780095501382256 23.799949736114602 24.214626790650918 27.20532797185222 48-49 22.681578286001507 26.614727318421714 25.885900980145767 24.817793415431012 50-51 24.786324786324787 23.114630467571644 27.287581699346404 24.811463046757165 52-53 24.17305999245378 22.676392906552636 23.795748962394665 29.35479813859892 54-55 24.087591240875913 25.069217216209417 26.16410772715832 24.679083815756357 56-57 22.476717845456832 23.647118046816008 26.591995972816513 27.284168134910647 58-59 23.38577721837634 23.57457520453115 25.563247325361864 27.47640025173065 60-61 24.291650925576125 23.334592620576753 26.936154136758596 25.437602317088526 62-63 23.556843962692213 23.834131585581044 26.304512225863373 26.304512225863373 64-65 25.11668979437366 23.060426390816197 27.551406585088937 24.271477229721206 66-67 23.456634263350587 27.00416614063881 24.35298573412448 25.186213861886124 68-69 22.95247724974722 27.831142568250762 23.938321536905967 25.278058645096056 70-71 23.42228405210573 28.49373972429493 23.346401922347287 24.737574301252057 72-73 23.388839455955257 27.405618405999743 23.770179229693657 25.43536290835134 74-75 23.2671260640454 25.604648020537763 24.780435076341035 26.347790839075802 76 26.923076923076923 0.0 35.41507996953541 37.66184310738766 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 20.0 1 10.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 8.5 19 15.0 20 12.0 21 10.5 22 15.0 23 13.5 24 8.0 25 8.0 26 11.5 27 14.0 28 22.5 29 32.5 30 34.0 31 42.5 32 54.5 33 59.0 34 61.0 35 75.0 36 99.5 37 115.0 38 125.0 39 137.5 40 149.5 41 158.0 42 174.0 43 189.0 44 203.0 45 268.0 46 307.0 47 239.5 48 173.5 49 151.5 50 136.5 51 130.0 52 132.0 53 126.0 54 116.0 55 119.0 56 117.5 57 115.0 58 115.5 59 110.0 60 102.5 61 98.0 62 92.5 63 80.5 64 74.0 65 72.0 66 64.5 67 66.5 68 69.0 69 63.5 70 58.5 71 51.5 72 45.5 73 40.0 74 31.0 75 28.0 76 27.0 77 23.0 78 16.0 79 9.0 80 9.0 81 9.5 82 6.0 83 2.0 84 1.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.44999999999999996 3 0.44999999999999996 4 0.44999999999999996 5 0.44999999999999996 6 0.675 7 0.44999999999999996 8 0.44999999999999996 9 0.44999999999999996 10-11 0.44999999999999996 12-13 0.44999999999999996 14-15 0.44999999999999996 16-17 0.44999999999999996 18-19 0.44999999999999996 20-21 0.44999999999999996 22-23 0.46249999999999997 24-25 0.44999999999999996 26-27 0.46249999999999997 28-29 0.4875 30-31 0.46249999999999997 32-33 0.475 34-35 0.475 36-37 0.025113008538422906 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.012591286829513975 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 18.0 36 0.0 37 0.0 38 1.0 39 0.0 40 1.0 41 0.0 42 1.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 2.0 51 1.0 52 1.0 53 2.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 0.0 60 2.0 61 2.0 62 2.0 63 2.0 64 1.0 65 1.0 66 3.0 67 2.0 68 2.0 69 1.0 70 1.0 71 6.0 72 27.0 73 47.0 74 345.0 75 902.0 76 2626.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.25 #Duplication Level Percentage of deduplicated Percentage of total 1 96.88346883468834 89.375 2 2.2493224932249323 4.15 3 0.5691056910569106 1.575 4 0.08130081300813008 0.3 5 0.05420054200542006 0.25 6 0.0 0.0 7 0.02710027100271003 0.17500000000000002 8 0.0 0.0 9 0.02710027100271003 0.22499999999999998 >10 0.08130081300813008 1.7500000000000002 >50 0.02710027100271003 2.1999999999999997 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 88 2.1999999999999997 TruSeq Adapter, Index 19 (97% over 38bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTAT 34 0.8500000000000001 TruSeq Adapter, Index 19 (97% over 38bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 18 0.44999999999999996 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAA 18 0.44999999999999996 TruSeq Adapter, Index 19 (97% over 38bp) GTCAATTAGAAGAATAAAGAAGAATTACTGCATTTCGTAACTTATTTTTT 9 0.22499999999999998 No Hit GCCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATT 7 0.17500000000000002 No Hit CCGAGTTTAATTGCAGTCAATTAGAAGAATAAAGAAGAATTACTGCATTT 5 0.125 No Hit CTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.05 0.0 0.0 0.0 0.0 60 0.05 0.0 0.0 0.0 0.0 61 0.05 0.0 0.0 0.0 0.0 62 0.05 0.0 0.0 0.0 0.0 63 0.05 0.0 0.0 0.0 0.0 64 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACGTC 25 2.4491346E-6 69.55 13 GTATGCC 20 7.231228E-5 69.55 47 GTCACCT 20 7.231228E-5 69.55 29 CAGTCAC 20 7.231228E-5 69.55 27 ACGTCTG 25 2.4491346E-6 69.55 15 TGCCGTC 20 7.231228E-5 69.55 50 CCAGTCA 20 7.231228E-5 69.55 26 AGCTATC 15 0.0021194206 69.55 38 CACGTCT 25 2.4491346E-6 69.55 14 TATGCCG 20 7.231228E-5 69.55 48 GAAAAAA 20 7.231228E-5 69.55 65 CTCCAGT 20 7.231228E-5 69.55 24 TTCTGCT 20 7.231228E-5 69.55 57 GATCGGA 25 2.4491346E-6 69.55 1 CCGTCTT 20 7.231228E-5 69.55 52 ACTCCAG 25 2.4491346E-6 69.55 23 GTCTGAA 25 2.4491346E-6 69.55 17 TCCAGTC 20 7.231228E-5 69.55 25 TCGGAAG 25 2.4491346E-6 69.55 3 GCTATCT 15 0.0021194206 69.55 39 >>END_MODULE SRR11389811 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389811_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.38325 32.0 32.0 32.0 27.0 32.0 2 29.79975 32.0 32.0 32.0 14.0 32.0 3 29.602 32.0 32.0 32.0 14.0 32.0 4 29.73025 32.0 32.0 32.0 21.0 32.0 5 29.611 32.0 32.0 32.0 21.0 32.0 6 32.5645 36.0 36.0 36.0 14.0 36.0 7 32.88175 36.0 36.0 36.0 21.0 36.0 8 32.26175 36.0 32.0 36.0 14.0 36.0 9 32.304 36.0 32.0 36.0 14.0 36.0 10-11 32.13225 36.0 32.0 36.0 14.0 36.0 12-13 32.206 36.0 32.0 36.0 14.0 36.0 14-15 31.883625000000002 36.0 32.0 36.0 14.0 36.0 16-17 31.962125 36.0 32.0 36.0 14.0 36.0 18-19 31.733125 36.0 32.0 36.0 14.0 36.0 20-21 31.57725 36.0 32.0 36.0 14.0 36.0 22-23 31.757625 36.0 32.0 36.0 14.0 36.0 24-25 31.524375 36.0 32.0 36.0 14.0 36.0 26-27 31.267625 36.0 32.0 36.0 14.0 36.0 28-29 31.376125000000002 36.0 32.0 36.0 14.0 36.0 30-31 31.402749999999997 36.0 32.0 36.0 14.0 36.0 32-33 31.161125 36.0 32.0 36.0 14.0 36.0 34-35 31.097375 36.0 32.0 36.0 14.0 36.0 36-37 31.40464824120603 36.0 32.0 36.0 14.0 36.0 38-39 31.401939706069932 36.0 32.0 36.0 14.0 36.0 40-41 31.302865022514506 36.0 32.0 36.0 14.0 36.0 42-43 31.096536893320604 36.0 32.0 36.0 14.0 36.0 44-45 30.968820719135024 36.0 32.0 36.0 14.0 36.0 46-47 30.825748051294944 36.0 32.0 36.0 14.0 36.0 48-49 30.881569021875787 36.0 32.0 36.0 14.0 36.0 50-51 30.79114218074684 36.0 32.0 36.0 14.0 36.0 52-53 30.751725157647538 36.0 32.0 36.0 14.0 36.0 54-55 30.82401812688822 36.0 32.0 36.0 14.0 36.0 56-57 30.481933056705422 36.0 27.0 36.0 14.0 36.0 58-59 30.320788458830933 36.0 27.0 36.0 14.0 36.0 60-61 30.332366827032487 36.0 27.0 36.0 14.0 36.0 62-63 30.43377608511907 36.0 27.0 36.0 14.0 36.0 64-65 30.246848946588145 36.0 27.0 36.0 14.0 36.0 66-67 30.230574605034423 36.0 27.0 36.0 14.0 36.0 68-69 29.96233243217118 36.0 27.0 36.0 14.0 36.0 70-71 29.967963906447874 36.0 27.0 36.0 14.0 36.0 72-73 29.875942037590885 36.0 27.0 36.0 14.0 36.0 74-75 29.94676888324021 36.0 27.0 36.0 14.0 36.0 76 28.67017543859649 32.0 21.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 3.0 15 9.0 16 54.0 17 57.0 18 64.0 19 49.0 20 30.0 21 25.0 22 30.0 23 35.0 24 52.0 25 85.0 26 88.0 27 126.0 28 165.0 29 201.0 30 289.0 31 374.0 32 442.0 33 591.0 34 740.0 35 468.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.385311871227366 17.47987927565392 10.940643863179075 28.194164989939637 2 34.09605230072919 21.247171234598945 24.842846366607997 19.813930098063867 3 31.096028154851684 25.74157868275515 19.934640522875817 23.227752639517345 4 34.74874371859297 29.773869346733665 15.7035175879397 19.77386934673367 5 32.71356783919598 32.23618090452261 16.758793969849243 18.291457286432163 6 27.487437185929647 31.733668341708544 20.603015075376884 20.175879396984925 7 27.28643216080402 16.733668341708544 32.11055276381909 23.869346733668344 8 29.63056044232219 20.507665242523245 23.649158079919577 26.212616235234982 9 29.552313883299796 20.372233400402415 24.87424547283702 25.201207243460765 10-11 31.469588213071404 26.30651051504848 19.128573227553204 23.09532804432691 12-13 31.55181086519115 20.372233400402415 22.472334004024145 25.603621730382294 14-15 30.464411913175166 22.930338213023727 23.220595658758203 23.384654215042907 16-17 32.40040342914776 22.16338880484115 21.986888552697934 23.44931921331316 18-19 31.130764371446617 22.08464939987366 22.830069488313327 23.954516740366394 20-21 30.485338725985844 23.53387259858443 22.24469160768453 23.736097067745195 22-23 31.46606106484986 23.113802674741358 21.915215745647238 23.504920514761544 24-25 30.727456428391008 23.187673654963376 22.189946956302094 23.89492296034352 26-27 30.556607345702385 23.627413858386976 22.12545752871387 23.690521267196768 28-29 28.185035389282103 25.808897876643073 22.295247724974722 23.7108190091001 30-31 28.951684117572853 24.801311971742145 21.83676043900593 24.41024347167907 32-33 27.546120798584788 24.76623704826889 24.652514531210514 23.03512762193581 34-35 28.439671509791538 24.371446620341125 23.903979785217942 23.2849020846494 36-37 29.54202315047811 24.421238047307497 21.59033719174635 24.44640161046804 38-39 29.224952741020793 24.499054820415882 22.15500945179584 24.120982986767487 40-41 28.143939393939394 25.63131313131313 23.5479797979798 22.676767676767675 42-43 30.19415027735754 23.184568835098336 22.78113968734241 23.840141200201714 44-45 29.886649874055415 23.035264483627206 23.274559193954662 23.803526448362717 46-47 27.740633278667843 24.35978302005803 24.044405197426517 23.85517850384761 48-49 27.98084194605495 23.670279808419462 24.149231157045627 24.19964708847996 50-51 27.42828384499245 24.949672873678914 22.93658782083543 24.685455460493205 52-53 28.3984867591425 25.649432534678436 22.005044136191675 23.94703656998739 54-55 30.38820267204437 24.32568691706579 22.283841693975294 23.002268716914546 56-57 30.37177063642092 23.226212980466286 22.64650283553875 23.75551354757404 58-59 31.337451153409805 22.96735156939367 21.68158325980083 24.01361401739569 60-61 31.565020161290324 23.22328629032258 22.202620967741936 23.009072580645164 62-63 30.91964173079349 23.93086918127917 21.83676043900593 23.312728648921407 64-65 30.572041924485415 22.742770551837353 23.146861977522416 23.538325546154816 66-67 30.295753286147626 23.407482305358947 22.408998988877656 23.88776541961577 68-69 27.661188369152974 24.892541087231354 24.29835651074589 23.147914032869785 70-71 26.193189011267247 26.09191036840106 24.243575136093177 23.471325484238513 72-73 25.856142584341185 25.98345003182686 23.69191597708466 24.468491406747294 74-75 26.368293340523053 24.85845241304934 24.696683742248585 24.076570504179024 76 30.25341130604289 0.0 33.45029239766082 36.2962962962963 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 22.0 1 11.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.5 16 2.0 17 1.5 18 3.0 19 4.5 20 3.5 21 3.5 22 5.5 23 9.0 24 10.5 25 9.0 26 14.5 27 19.5 28 21.5 29 24.0 30 24.5 31 25.0 32 31.5 33 38.5 34 43.0 35 57.0 36 73.0 37 93.0 38 105.5 39 122.0 40 137.0 41 149.5 42 161.0 43 151.5 44 157.0 45 166.0 46 164.5 47 172.5 48 168.0 49 152.0 50 137.5 51 130.5 52 134.5 53 134.0 54 133.5 55 119.0 56 107.5 57 115.5 58 116.5 59 115.0 60 113.0 61 122.0 62 136.0 63 124.5 64 97.0 65 86.5 66 94.0 67 92.5 68 73.5 69 68.0 70 79.5 71 78.0 72 66.5 73 58.0 74 46.5 75 40.5 76 41.0 77 37.0 78 32.5 79 29.5 80 25.0 81 17.5 82 15.0 83 14.0 84 13.5 85 17.0 86 19.0 87 16.0 88 11.5 89 9.5 90 9.0 91 6.0 92 3.5 93 3.0 94 2.0 95 2.5 96 4.0 97 3.5 98 2.0 99 7.0 100 13.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.575 3 0.5499999999999999 4 0.5 5 0.5 6 0.5 7 0.5 8 0.525 9 0.6 10-11 0.7374999999999999 12-13 0.6 14-15 0.95 16-17 0.8500000000000001 18-19 1.0625 20-21 1.0999999999999999 22-23 0.9249999999999999 24-25 1.0250000000000001 26-27 0.9625 28-29 1.0999999999999999 30-31 0.9125 32-33 1.075 34-35 1.0625 36-37 0.1507537688442211 38-39 0.3015454202789295 40-41 0.4649993716224708 42-43 0.2891263356379635 44-45 0.17601206939904449 46-47 0.3394518481267287 48-49 0.2514458134272064 50-51 0.05030181086519115 52-53 0.2139172014596703 54-55 0.12588116817724068 56-57 0.10071761299257208 58-59 0.08816120906801007 60-61 0.012599218848431397 62-63 0.03783102143757881 64-65 0.05048592704783542 66-67 0.06315523556902868 68-69 0.0 70-71 0.025313251487153528 72-73 0.11444557477110885 74-75 0.10772959870724481 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 20.0 36 0.0 37 0.0 38 1.0 39 0.0 40 1.0 41 0.0 42 1.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 2.0 51 1.0 52 1.0 53 1.0 54 0.0 55 0.0 56 1.0 57 0.0 58 2.0 59 0.0 60 1.0 61 2.0 62 2.0 63 2.0 64 1.0 65 1.0 66 3.0 67 1.0 68 2.0 69 1.0 70 5.0 71 5.0 72 22.0 73 74.0 74 268.0 75 1014.0 76 2565.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.65 #Duplication Level Percentage of deduplicated Percentage of total 1 97.82721158820486 94.55 2 1.758923952405587 3.4000000000000004 3 0.23279875840662181 0.675 4 0.0775995861355406 0.3 5 0.05173305742369374 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05173305742369374 0.8250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 20 0.5 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit CTGTATTACAATTTGGTGGAGGAACTTTAGGACATCCTTGGGGAAATGCA 5 0.125 No Hit CAAATTCGAGTTCGCGCCGGTAGATACTATCGATTAATAGATAAAACTAAATATGAAGAAGGTCTAAATAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.025 0.0 0.0 0.0 0.0 58 0.025 0.0 0.0 0.0 0.0 59 0.025 0.0 0.0 0.0 0.0 60 0.025 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1578194 spots for SRR11389811.sra Written 1578194 spots for SRR11389811.sra Read 1578194 spots for SRR11389811.sra Written 1578194 spots for SRR11389811.sra Read 1578194 spots for SRR11389811.sra Written 1578194 spots for SRR11389811.sra Read 1578194 spots for SRR11389811.sra Written 1578194 spots for SRR11389811.sra Read 1578194 spots for SRR11389811.sra Written 1578194 spots for SRR11389811.sra Read 1578194 spots for SRR11389811.sra Written 1578194 spots for SRR11389811.sra Read 1578194 spots for SRR11389811.sra Written 1578194 spots for SRR11389811.sra Read 1578194 spots for SRR11389811.sra Written 1578194 spots for SRR11389811.sra Read 1578194 spots for SRR11389811.sra Written 1578194 spots for SRR11389811.sra Read 1578194 spots for SRR11389811.sra Written 1578194 spots for SRR11389811.sra Read 1578197 spots for SRR11389811.sra Written 1578197 spots for SRR11389811.sra Read 1578194 spots for SRR11389811.sra Written 1578194 spots for SRR11389811.sra Read 1578194 spots for SRR11389811.sra Written 1578194 spots for SRR11389811.sra Read 1578194 spots for SRR11389811.sra Written 1578194 spots for SRR11389811.sra Read 1578194 spots for SRR11389811.sra Written 1578194 spots for SRR11389811.sra Read 1578194 spots for SRR11389811.sra Written 1578194 spots for SRR11389811.sra Read 1578194 spots for SRR11389811.sra Written 1578194 spots for SRR11389811.sra Read 1578194 spots for SRR11389811.sra Written 1578194 spots for SRR11389811.sra Read 1578194 spots for SRR11389811.sra Written 1578194 spots for SRR11389811.sra Read 1578194 spots for SRR11389811.sra Written 1578194 spots for SRR11389811.sra SRR ids: ['SRR11389811.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_799hc8o5 SRR11389811.sra spots: 31563883 blocks: [[1, 1578194], [1578195, 3156388], [3156389, 4734582], [4734583, 6312776], [6312777, 7890970], [7890971, 9469164], [9469165, 11047358], [11047359, 12625552], [12625553, 14203746], [14203747, 15781940], [15781941, 17360134], [17360135, 18938328], [18938329, 20516522], [20516523, 22094716], [22094717, 23672910], [23672911, 25251104], [25251105, 26829298], [26829299, 28407492], [28407493, 29985686], [29985687, 31563883]] SRR11389811 file size 5999269 SRR11389811 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389811 SRR11389811_1.fastq SRR11389811_2.fastq Input file: SRR11389811_1.fastq Paired file: SRR11389811_2.fastq trimmed: SRR11389811-trimmed-pair1.fastq, SRR11389811-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:08:17 2024 >> started Sat Dec 7 07:08:42 2024 >> done (25.126s) 31563883 read pairs processed; of these: 726 ( 0.00%) short read pairs filtered out after trimming by size control 1855725 ( 5.88%) empty read pairs filtered out after trimming by size control 29707432 (94.12%) read pairs available; of these: 29768 ( 0.10%) trimmed read pairs available after processing 29677664 (99.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 227 0.00% 19 14 0.00% 20 295 0.00% 21 8 0.00% 22 356 0.00% 23 13 0.00% 24 488 0.00% 25 12 0.00% 26 539 0.00% 27 11 0.00% 28 500 0.00% 29 9 0.00% 30 323 0.00% 31 12 0.00% 32 193 0.00% 33 6 0.00% 34 157 0.00% 35 337 0.00% 36 907 0.00% 37 443 0.00% 38 712 0.00% 39 613 0.00% 40 836 0.00% 41 894 0.00% 42 1113 0.00% 43 1222 0.00% 44 1519 0.01% 45 1546 0.01% 46 1794 0.01% 47 1912 0.01% 48 2132 0.01% 49 2493 0.01% 50 2776 0.01% 51 3026 0.01% 52 3520 0.01% 53 3879 0.01% 54 4285 0.01% 55 5088 0.02% 56 5662 0.02% 57 6397 0.02% 58 6891 0.02% 59 7657 0.03% 60 8092 0.03% 61 8661 0.03% 62 10159 0.03% 63 11027 0.04% 64 12404 0.04% 65 13304 0.04% 66 14788 0.05% 67 16380 0.06% 68 16989 0.06% 69 18940 0.06% 70 20920 0.07% 71 25528 0.09% 72 53733 0.18% 73 280683 0.94% 74 2067225 6.96% 75 13143422 44.24% 76 13914360 46.84% 29707432 reads passed initial QC criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=20 prefix-density=0.89 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.19 sequence-density-rank=20 fanout-score=4.19 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=2.0 sequence=ACCTGAAGCTATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=15 prefix-density=0.82 prefix-fanout=2.3 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.04 sequence-density-rank=26 fanout-score=25.70 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=1.1 sequence=CGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCACTC SRR11389811 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:09:41 Started mapping on | Dec 07 07:09:41 Finished on | Dec 07 07:11:30 Mapping speed, Million of reads per hour | 981.16 Number of input reads | 29707432 Average input read length | 150 UNIQUE READS: Uniquely mapped reads number | 24437898 Uniquely mapped reads % | 82.26% Average mapped length | 150.15 Number of splices: Total | 9630204 Number of splices: Annotated (sjdb) | 9171806 Number of splices: GT/AG | 9502282 Number of splices: GC/AG | 112503 Number of splices: AT/AC | 2416 Number of splices: Non-canonical | 13003 Mismatch rate per base, % | 0.72% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.01% Insertion average length | 1.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3344817 % of reads mapped to multiple loci | 11.26% Number of reads mapped to too many loci | 123583 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.59% % of reads unmapped: other | 1.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1924717 1924717 1924717 N_multimapping 3344817 3344817 3344817 N_noFeature 814562 23733637 1039171 N_ambiguous 783242 4917 340781 UnstrandedReadsAssigned:22840094 PositiveStrandReadsAssigned:699344 NegativeStrandReadsAssigned:23057946 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389811 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389811-trimmed-pair1.fastq SRR11389811-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,707,432 reads, 26,594,618 reads pseudoaligned [quant] estimated average fragment length: 183.162 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,244 rounds 52973 SRR11389811.ke.tsv 35125 SRR11389811.se.tsv 88098 total ==> SRR11389811.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 753.915 0 0 PNS24247 1044 861.838 27.3702 1.6043 PNS24249 1928 1745.84 103.312 2.98938 PNS24246 1044 861.838 27.3702 1.6043 PNS24248 1044 861.838 27.3702 1.6043 PNS24244 1471 1288.84 42.5773 1.66883 PNS24243 293 124.738 0 0 KQK14069 1603 1420.84 193.867 6.89275 KQK14071 474 293.801 0 0 ==> SRR11389811.se.tsv <== BRADI_1g14170v3 196 BRADI_1g53295v3 22 BRADI_1g59795v3 237 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 337 BRADI_1g74790v3 479 BRADI_1g09890v3 1 BRADI_1g77505v3 247 BRADI_1g48960v3 0 SRR11389811 completed mapping pipeline successfully