Starting /dee2/code/volunteer_pipeline.sh SRR11389813 current disk space = 1544674779136 free memory = 1600731532 SRR11389813 SRAfilesize 2aa04bb731d81ec791b2e7a253475410 SRR11389813.sra SRR11389813.sra file validated SRR11389813 is paired end SRR11389813 is conventional basespace SRR11389813 read1 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389813_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.047 32.0 32.0 32.0 32.0 32.0 2 31.03225 32.0 32.0 32.0 32.0 32.0 3 31.1135 32.0 32.0 32.0 32.0 32.0 4 31.27075 32.0 32.0 32.0 32.0 32.0 5 31.24125 32.0 32.0 32.0 32.0 32.0 6 33.9435 36.0 36.0 36.0 32.0 36.0 7 34.02025 36.0 36.0 36.0 32.0 36.0 8 33.98475 36.0 36.0 36.0 32.0 36.0 9 33.995 36.0 36.0 36.0 32.0 36.0 10-11 34.027 36.0 36.0 36.0 32.0 36.0 12-13 34.142875000000004 36.0 36.0 36.0 32.0 36.0 14-15 33.958625 36.0 36.0 36.0 32.0 36.0 16-17 34.06125 36.0 36.0 36.0 32.0 36.0 18-19 34.034875 36.0 36.0 36.0 32.0 36.0 20-21 33.93475 36.0 36.0 36.0 32.0 36.0 22-23 33.73075 36.0 36.0 36.0 32.0 36.0 24-25 33.7845 36.0 36.0 36.0 32.0 36.0 26-27 33.74575 36.0 36.0 36.0 32.0 36.0 28-29 33.736625000000004 36.0 36.0 36.0 32.0 36.0 30-31 33.553125 36.0 36.0 36.0 29.5 36.0 32-33 33.59375 36.0 36.0 36.0 26.5 36.0 34-35 33.622875 36.0 36.0 36.0 29.5 36.0 36-37 33.31855914196778 36.0 36.0 36.0 24.0 36.0 38-39 33.360192629457075 36.0 36.0 36.0 21.0 36.0 40-41 33.39165973616244 36.0 36.0 36.0 24.0 36.0 42-43 33.18690582920226 36.0 36.0 36.0 21.0 36.0 44-45 33.116855391946714 36.0 36.0 36.0 17.5 36.0 46-47 33.25380012603711 36.0 36.0 36.0 21.0 36.0 48-49 33.10039225282561 36.0 36.0 36.0 21.0 36.0 50-51 33.15657063116083 36.0 36.0 36.0 21.0 36.0 52-53 33.02680530736822 36.0 36.0 36.0 14.0 36.0 54-55 33.00618594720645 36.0 36.0 36.0 14.0 36.0 56-57 32.94737766595756 36.0 36.0 36.0 14.0 36.0 58-59 32.7164546214382 36.0 34.0 36.0 14.0 36.0 60-61 32.61458617192639 36.0 36.0 36.0 14.0 36.0 62-63 32.622219830202575 36.0 36.0 36.0 14.0 36.0 64-65 32.80782028242038 36.0 36.0 36.0 14.0 36.0 66-67 32.830199853029946 36.0 36.0 36.0 14.0 36.0 68-69 32.5163856674567 36.0 32.0 36.0 14.0 36.0 70-71 32.576062597626674 36.0 32.0 36.0 14.0 36.0 72-73 32.497935302868086 36.0 34.0 36.0 14.0 36.0 74-75 32.44987986209509 36.0 32.0 36.0 14.0 36.0 76 32.17909300538048 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 3.0 24 6.0 25 27.0 26 45.0 27 45.0 28 84.0 29 165.0 30 240.0 31 356.0 32 440.0 33 735.0 34 1061.0 35 792.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.6591647911978 10.327581895473868 11.852963240810203 41.16029007251813 2 21.555388847211805 15.003750937734434 34.508627156789196 28.93223305826457 3 23.63090772693173 17.60440110027507 23.58089522380595 35.183795948987246 4 28.60715178794699 25.131282820705174 19.529882470617654 26.731682920730183 5 28.582145536384097 26.806701675418854 22.48062015503876 22.13053263315829 6 22.58064516129032 30.682670667666915 25.95648912228057 20.78019504876219 7 19.529882470617654 25.006251562890725 33.58339584896224 21.880470117529384 8 20.605151287821954 24.456114028507127 29.9074768692173 25.03125781445361 9 21.655413853463365 20.830207551887973 31.90797699424856 25.6064016004001 10-11 24.143535883970994 29.382345586396596 21.9679919979995 24.50612653163291 12-13 24.643660915228807 22.780695173793447 24.543635908977244 28.032008002000502 14-15 23.118279569892472 24.968742185546386 25.76894223555889 26.144036009002253 16-17 25.04376094023506 24.056014003500874 24.731182795698924 26.16904226056514 18-19 22.99324831207802 23.818454613653415 26.081520380095025 27.106776694173547 20-21 23.78094523630908 23.843460865216304 26.131532883220803 26.244061015253813 22-23 24.081020255063766 26.16904226056514 24.193548387096776 25.55638909727432 24-25 23.068267066766694 24.60615153788447 25.71892973243311 26.60665166291573 26-27 23.25581395348837 25.068767191797946 24.74368592148037 26.93173293323331 28-29 25.018754688672168 24.18104526131533 25.156289072268066 25.64391097774444 30-31 24.193548387096776 24.318579644911228 24.493623405851466 26.994248562140534 32-33 22.118029507376843 25.418854713678417 25.55638909727432 26.906726681670417 34-35 24.5311327831958 24.568642160540136 25.98149537384346 24.918729682420604 36-37 23.22701688555347 24.878048780487806 25.603502188868042 26.29143214509068 38-39 22.945076942324533 24.533967221318655 25.634930564243714 26.886025272113102 40-41 23.720115158342722 24.396044561271747 24.50869946175992 27.37514081862561 42-43 23.841142570784264 24.843397644700577 26.43447757454272 24.880982209972437 44-45 23.617901466716813 24.18202331703648 25.69888429234048 26.501190923906233 46-47 25.71822857859741 24.84004516371848 23.710952201731274 25.730774055952825 48-49 23.491027732463294 25.360772995357006 25.373321621282468 25.774877650897228 50-51 24.196383726770467 24.32194876946258 24.937217478653942 26.544450025113008 52-53 24.13532888944787 23.858634134071185 24.323984404477425 27.682052572003524 54-55 24.940168787000882 24.071041692908427 24.751228114372086 26.23756140571861 56-57 23.65930599369085 23.74763406940063 25.589905362776026 27.003154574132495 58-59 23.890223852282787 24.88933856076894 24.016694068546858 27.203743518401417 60-61 24.980988593155892 23.73891001267427 25.006337135614704 26.273764258555133 62-63 24.020356234096692 25.076335877862594 24.185750636132315 26.717557251908396 64-65 25.976512637222367 23.666070972683176 25.12126627521062 25.236150114883838 66-67 24.334016393442624 25.384221311475407 24.18032786885246 26.10143442622951 68-69 24.595427690726947 25.77703570511174 22.96429488826098 26.663241715900334 70-71 24.090791849368067 26.06396698478205 23.716791333505288 26.128449832344597 72-73 24.486612945152068 24.889524304652976 24.395632960748635 26.228229789446324 74-75 24.764542936288088 23.393351800554015 25.581717451523545 26.26038781163435 76 27.248270561106843 0.0 32.62874711760185 40.12298232129131 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 2.0 21 2.5 22 2.0 23 3.5 24 5.0 25 4.5 26 7.5 27 11.5 28 15.5 29 18.0 30 21.0 31 28.0 32 36.0 33 41.5 34 52.5 35 72.0 36 92.0 37 106.0 38 115.5 39 140.5 40 157.5 41 170.0 42 193.5 43 212.5 44 245.0 45 230.5 46 199.0 47 200.5 48 193.0 49 175.5 50 167.0 51 167.5 52 156.0 53 143.0 54 134.5 55 140.5 56 133.5 57 110.0 58 96.0 59 105.0 60 114.0 61 95.5 62 81.0 63 82.0 64 84.0 65 74.0 66 76.0 67 79.5 68 68.5 69 57.0 70 53.5 71 56.5 72 51.5 73 42.5 74 36.5 75 32.0 76 27.5 77 22.0 78 16.5 79 14.0 80 10.5 81 8.0 82 7.5 83 7.0 84 4.5 85 2.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 2.0 36 1.0 37 0.0 38 1.0 39 1.0 40 1.0 41 2.0 42 2.0 43 1.0 44 1.0 45 2.0 46 1.0 47 0.0 48 1.0 49 1.0 50 2.0 51 3.0 52 5.0 53 1.0 54 5.0 55 1.0 56 7.0 57 3.0 58 5.0 59 4.0 60 4.0 61 8.0 62 10.0 63 4.0 64 8.0 65 5.0 66 8.0 67 4.0 68 6.0 69 9.0 70 8.0 71 14.0 72 24.0 73 71.0 74 308.0 75 854.0 76 2602.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.28988080142024 97.875 2 0.6086735987826528 1.2 3 0.050722799898554397 0.15 4 0.025361399949277198 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025361399949277198 0.675 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA 27 0.675 TruSeq Adapter, Index 27 (97% over 39bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCTTGA 15 0.00197438 70.76923 60 GCTTGAA 15 0.00197438 70.76923 61 CTGCTTG 15 0.00197438 70.76923 59 TTGAAAA 15 0.00197438 70.76923 63 CTTGAAA 15 0.00197438 70.76923 62 ACACGTC 15 0.0021872367 69.00001 13 CACATTA 15 0.0021872367 69.00001 31 CAGTCAC 15 0.0021872367 69.00001 27 GTCACAT 15 0.0021872367 69.00001 29 ACGTCTG 15 0.0021872367 69.00001 15 TTACTCG 15 0.0021872367 69.00001 35 GTCTGAA 15 0.0021872367 69.00001 17 ATTACTC 15 0.0021872367 69.00001 34 ACATTAC 15 0.0021872367 69.00001 32 CATTACT 15 0.0021872367 69.00001 33 CTGAACT 15 0.0021872367 69.00001 19 TCTGAAC 15 0.0021872367 69.00001 18 TCGTATG 15 0.0021872367 69.00001 45 GCACACG 15 0.0021872367 69.00001 11 AGTCACA 15 0.0021872367 69.00001 28 >>END_MODULE SRR11389813 read2 length is 35-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11389813_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.78875 32.0 32.0 32.0 32.0 32.0 2 30.4185 32.0 32.0 32.0 32.0 32.0 3 30.06075 32.0 32.0 32.0 21.0 32.0 4 30.06925 32.0 32.0 32.0 21.0 32.0 5 30.2715 32.0 32.0 32.0 21.0 32.0 6 33.348 36.0 36.0 36.0 21.0 36.0 7 33.4685 36.0 36.0 36.0 21.0 36.0 8 33.25825 36.0 36.0 36.0 21.0 36.0 9 33.2515 36.0 36.0 36.0 21.0 36.0 10-11 33.188500000000005 36.0 36.0 36.0 21.0 36.0 12-13 33.3435 36.0 36.0 36.0 21.0 36.0 14-15 33.181875000000005 36.0 36.0 36.0 21.0 36.0 16-17 33.20275 36.0 36.0 36.0 17.5 36.0 18-19 33.296 36.0 36.0 36.0 21.0 36.0 20-21 33.111125 36.0 36.0 36.0 21.0 36.0 22-23 33.2395 36.0 36.0 36.0 21.0 36.0 24-25 33.039625 36.0 36.0 36.0 21.0 36.0 26-27 32.973625 36.0 36.0 36.0 17.5 36.0 28-29 32.801874999999995 36.0 36.0 36.0 14.0 36.0 30-31 32.947375 36.0 36.0 36.0 14.0 36.0 32-33 32.72775 36.0 36.0 36.0 14.0 36.0 34-35 32.781 36.0 36.0 36.0 14.0 36.0 36-37 32.79501569780043 36.0 36.0 36.0 14.0 36.0 38-39 32.72736391821775 36.0 36.0 36.0 14.0 36.0 40-41 32.67225613887429 36.0 36.0 36.0 14.0 36.0 42-43 32.8385562703147 36.0 36.0 36.0 14.0 36.0 44-45 32.533541555212494 36.0 36.0 36.0 14.0 36.0 46-47 32.60612617429295 36.0 36.0 36.0 14.0 36.0 48-49 32.45887516293822 36.0 34.0 36.0 14.0 36.0 50-51 32.577116397131164 36.0 36.0 36.0 14.0 36.0 52-53 32.39928908631846 36.0 34.0 36.0 14.0 36.0 54-55 32.589901086649235 36.0 34.0 36.0 14.0 36.0 56-57 32.6427249465559 36.0 34.0 36.0 14.0 36.0 58-59 32.2740431139415 36.0 32.0 36.0 14.0 36.0 60-61 32.43812010081303 36.0 32.0 36.0 14.0 36.0 62-63 31.838842199135364 36.0 32.0 36.0 14.0 36.0 64-65 32.10407727171403 36.0 32.0 36.0 14.0 36.0 66-67 31.850651490269943 36.0 32.0 36.0 14.0 36.0 68-69 31.874146742394565 36.0 32.0 36.0 14.0 36.0 70-71 31.933455243500397 36.0 32.0 36.0 14.0 36.0 72-73 31.719440702100975 36.0 32.0 36.0 14.0 36.0 74-75 31.805817631921208 36.0 32.0 36.0 14.0 36.0 76 31.658814291323125 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 10.0 16 31.0 17 24.0 18 10.0 19 12.0 20 7.0 21 7.0 22 16.0 23 14.0 24 17.0 25 46.0 26 56.0 27 82.0 28 131.0 29 185.0 30 191.0 31 313.0 32 429.0 33 624.0 34 1013.0 35 775.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.127845884413304 17.38804103077308 11.533650237678259 33.950462847135356 2 29.29697272954716 22.441831373530146 27.89592194145609 20.365273955466602 3 27.47060295221416 26.79509632224168 20.94070552914686 24.7935951963973 4 29.772329246935204 32.44933700275207 16.637478108581437 21.1408556417313 5 29.647235426569928 30.447835876907682 19.83987990993245 20.06504878658994 6 24.680851063829788 33.29161451814768 21.777221526908637 20.250312891113893 7 22.878598247809762 17.246558197747184 34.84355444305381 25.03128911138924 8 24.430538172715895 21.35168961201502 25.857321652065078 28.360450563204004 9 25.00625782227785 21.70212765957447 26.90863579474343 26.382978723404253 10-11 27.616424636955433 27.566349524286434 20.393089634451677 24.42413620430646 12-13 27.75551102204409 21.743486973947896 23.309118236472944 27.191883767535067 14-15 25.895765472312704 24.32974191931847 24.54272112252568 25.231771485843147 16-17 27.707524727682486 23.563290346813574 23.450607236759737 25.278577688744207 18-19 26.956303993990232 24.502316263928883 24.039063478152 24.502316263928883 20-21 26.027054108216436 24.724448897795593 24.135771543086175 25.112725450901802 22-23 28.313705838135807 24.517664745677774 22.751190177900277 24.417439238286143 24-25 27.265898848272407 24.937406109163746 23.197295943915876 24.59939909864797 26-27 26.192562914736445 25.954676349067235 23.701014147990485 24.151746588205835 28-29 25.920360631104433 26.245930378161788 23.6038066616579 24.229902329075884 30-31 26.60573431826718 24.552397646175034 24.07662451483661 24.76524352072117 32-33 26.993865030674847 24.151746588205835 24.352072117190435 24.502316263928883 34-35 26.480530862651808 24.37711280831351 23.801176912482784 25.341179416551896 36-37 25.59799624295554 24.157795867251096 24.40826549780839 25.835942391984972 38-39 26.396893009270862 24.99373590578802 24.455023803558003 24.154347281383114 40-41 27.09612733425241 24.89033713497932 23.17332999122697 24.840205539541298 42-43 27.22027094831912 23.482187656798796 24.13447064726543 25.163070747616658 44-45 26.534454625329484 24.526170453119118 24.789757750721726 24.149617170829675 46-47 26.545226130653266 25.23869346733668 23.831658291457288 24.384422110552766 48-49 26.288012063332495 24.3151545614476 24.66700175923599 24.729831615983915 50-51 26.216522067144478 24.65736200176034 24.330441342889475 24.795674588205706 52-53 27.439869034126684 24.77018007807581 23.347185493010954 24.44276539478655 54-55 27.07781561357044 25.26169756589734 23.54647496531719 24.114011855215033 56-57 26.670878079595706 25.369551484523058 23.436512950094755 24.52305748578648 58-59 28.09927820691402 24.12308471571483 23.13536786121312 24.642269216158034 60-61 27.22659223547323 24.752600862725195 23.21745749809693 24.803349403704644 62-63 27.239138743789017 24.665562492037203 23.60810294305007 24.487195821123713 64-65 27.477304692494563 24.01227464518604 24.30635468610152 24.204065976217876 66-67 26.452854393842205 24.862091084028222 23.65618986529827 25.028864656831303 68-69 26.340836012861736 24.463022508038584 24.42443729903537 24.771704180064308 70-71 26.383143743536714 25.32316442605998 23.75904860392968 24.53464322647363 72-73 26.016684045881128 26.068821689259646 23.149113660062564 24.765380604796665 74-75 26.646290636287855 23.089747151986664 24.35398721867185 25.909974993053623 76 30.412573673870334 0.0 34.73477406679764 34.852652259332025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 2.0 2 0.5 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 2.0 20 3.0 21 3.0 22 3.0 23 2.5 24 4.5 25 9.0 26 9.0 27 8.5 28 11.5 29 13.5 30 15.0 31 25.5 32 35.0 33 36.0 34 49.5 35 80.5 36 91.5 37 82.5 38 107.0 39 145.5 40 158.5 41 172.5 42 190.0 43 197.5 44 194.0 45 184.0 46 184.5 47 188.5 48 174.0 49 165.5 50 170.5 51 168.0 52 158.5 53 138.5 54 117.0 55 128.5 56 134.5 57 120.0 58 118.0 59 114.0 60 117.0 61 108.5 62 98.0 63 96.0 64 91.5 65 83.0 66 76.5 67 79.0 68 74.0 69 72.5 70 71.5 71 65.5 72 64.0 73 55.5 74 48.0 75 49.5 76 44.5 77 31.5 78 20.0 79 14.0 80 9.5 81 8.5 82 7.5 83 5.0 84 4.0 85 2.0 86 1.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.5 92 1.0 93 0.5 94 0.5 95 0.5 96 0.0 97 1.0 98 1.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.075 4 0.075 5 0.075 6 0.125 7 0.125 8 0.125 9 0.125 10-11 0.15 12-13 0.2 14-15 0.22499999999999998 16-17 0.1625 18-19 0.1625 20-21 0.2 22-23 0.22499999999999998 24-25 0.15 26-27 0.1625 28-29 0.17500000000000002 30-31 0.1625 32-33 0.1625 34-35 0.1625 36-37 0.07508447002878238 38-39 0.08762047815746651 40-41 0.07514088916718849 42-43 0.0752068187515668 44-45 0.07525398218989088 46-47 0.08786243253420359 48-49 0.08788449466415568 50-51 0.08793969849246232 52-53 0.07550018875047187 54-55 0.07561436672967864 56-57 0.07574801161469512 58-59 0.07592053650512463 60-61 0.07606490872210953 62-63 0.07638446849140675 64-65 0.07665772326561901 66-67 0.07691321625432636 68-69 0.051420491065689675 70-71 0.05167958656330749 72-73 0.05211047420531526 74-75 0.05554012774229381 76 0.07852375343541422 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 4.0 36 1.0 37 0.0 38 1.0 39 1.0 40 1.0 41 2.0 42 2.0 43 1.0 44 1.0 45 2.0 46 1.0 47 0.0 48 1.0 49 1.0 50 2.0 51 3.0 52 5.0 53 1.0 54 5.0 55 1.0 56 7.0 57 3.0 58 5.0 59 3.0 60 4.0 61 9.0 62 11.0 63 4.0 64 9.0 65 5.0 66 7.0 67 4.0 68 7.0 69 11.0 70 10.0 71 14.0 72 26.0 73 85.0 74 278.0 75 915.0 76 2547.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 741565 spots for SRR11389813.sra Written 741565 spots for SRR11389813.sra Read 741565 spots for SRR11389813.sra Written 741565 spots for SRR11389813.sra Read 741565 spots for SRR11389813.sra Written 741565 spots for SRR11389813.sra Read 741565 spots for SRR11389813.sra Written 741565 spots for SRR11389813.sra Read 741565 spots for SRR11389813.sra Written 741565 spots for SRR11389813.sra Read 741565 spots for SRR11389813.sra Written 741565 spots for SRR11389813.sra Read 741565 spots for SRR11389813.sra Written 741565 spots for SRR11389813.sra Read 741565 spots for SRR11389813.sra Written 741565 spots for SRR11389813.sra Read 741565 spots for SRR11389813.sra Written 741565 spots for SRR11389813.sra Read 741571 spots for SRR11389813.sra Written 741571 spots for SRR11389813.sra Read 741565 spots for SRR11389813.sra Written 741565 spots for SRR11389813.sra Read 741565 spots for SRR11389813.sra Written 741565 spots for SRR11389813.sra Read 741565 spots for SRR11389813.sra Written 741565 spots for SRR11389813.sra Read 741565 spots for SRR11389813.sra Written 741565 spots for SRR11389813.sra Read 741565 spots for SRR11389813.sra Written 741565 spots for SRR11389813.sra Read 741565 spots for SRR11389813.sra Written 741565 spots for SRR11389813.sra Read 741565 spots for SRR11389813.sra Written 741565 spots for SRR11389813.sra Read 741565 spots for SRR11389813.sra Written 741565 spots for SRR11389813.sra Read 741565 spots for SRR11389813.sra Written 741565 spots for SRR11389813.sra Read 741565 spots for SRR11389813.sra Written 741565 spots for SRR11389813.sra SRR ids: ['SRR11389813.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ja46y0s2 SRR11389813.sra spots: 14831306 blocks: [[1, 741565], [741566, 1483130], [1483131, 2224695], [2224696, 2966260], [2966261, 3707825], [3707826, 4449390], [4449391, 5190955], [5190956, 5932520], [5932521, 6674085], [6674086, 7415650], [7415651, 8157215], [8157216, 8898780], [8898781, 9640345], [9640346, 10381910], [10381911, 11123475], [11123476, 11865040], [11865041, 12606605], [12606606, 13348170], [13348171, 14089735], [14089736, 14831306]] SRR11389813 file size 2801659 SRR11389813 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11389813 SRR11389813_1.fastq SRR11389813_2.fastq Input file: SRR11389813_1.fastq Paired file: SRR11389813_2.fastq trimmed: SRR11389813-trimmed-pair1.fastq, SRR11389813-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:09:02 2024 >> started Sat Dec 7 07:09:15 2024 >> done (12.744s) 14831306 read pairs processed; of these: 651 ( 0.00%) short read pairs filtered out after trimming by size control 257961 ( 1.74%) empty read pairs filtered out after trimming by size control 14572694 (98.26%) read pairs available; of these: 15561 ( 0.11%) trimmed read pairs available after processing 14557133 (99.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 5 0.00% 21 6 0.00% 22 9 0.00% 23 10 0.00% 24 7 0.00% 25 5 0.00% 26 7 0.00% 27 13 0.00% 28 14 0.00% 29 18 0.00% 30 16 0.00% 31 18 0.00% 32 18 0.00% 33 25 0.00% 34 24 0.00% 35 1749 0.01% 36 1814 0.01% 37 2171 0.01% 38 2476 0.02% 39 2998 0.02% 40 3593 0.02% 41 4186 0.03% 42 4672 0.03% 43 5067 0.03% 44 5469 0.04% 45 5903 0.04% 46 6356 0.04% 47 6810 0.05% 48 7445 0.05% 49 8289 0.06% 50 8898 0.06% 51 9923 0.07% 52 10813 0.07% 53 12188 0.08% 54 12766 0.09% 55 13910 0.10% 56 15065 0.10% 57 15686 0.11% 58 16973 0.12% 59 17978 0.12% 60 19323 0.13% 61 20429 0.14% 62 21839 0.15% 63 23491 0.16% 64 25239 0.17% 65 26533 0.18% 66 28153 0.19% 67 30208 0.21% 68 30339 0.21% 69 31304 0.21% 70 33534 0.23% 71 39513 0.27% 72 49011 0.34% 73 155586 1.07% 74 1050751 7.21% 75 6313823 43.33% 76 6470221 44.40% 14572694 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=27 prefix-density=0.24 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=127.33 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=19.2 sequence=CGGCGGCGGCGA criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=32 prefix-density=0.17 prefix-fanout=2.0 sequence=GACGCCTATGTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=152.67 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=18.5 sequence=GCCGCCGCCACCCT SRR11389813 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:10:05 Started mapping on | Dec 07 07:10:05 Finished on | Dec 07 07:11:24 Mapping speed, Million of reads per hour | 664.07 Number of input reads | 14572694 Average input read length | 149 UNIQUE READS: Uniquely mapped reads number | 12578997 Uniquely mapped reads % | 86.32% Average mapped length | 149.08 Number of splices: Total | 5417254 Number of splices: Annotated (sjdb) | 5118820 Number of splices: GT/AG | 5337646 Number of splices: GC/AG | 68568 Number of splices: AT/AC | 2438 Number of splices: Non-canonical | 8602 Mismatch rate per base, % | 0.90% Deletion rate per base | 0.01% Deletion average length | 1.64 Insertion rate per base | 0.01% Insertion average length | 1.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1082495 % of reads mapped to multiple loci | 7.43% Number of reads mapped to too many loci | 84353 % of reads mapped to too many loci | 0.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.49% % of reads unmapped: other | 2.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 911202 911202 911202 N_multimapping 1082495 1082495 1082495 N_noFeature 559094 12093514 792643 N_ambiguous 326045 2487 78755 UnstrandedReadsAssigned:11693858 PositiveStrandReadsAssigned:482996 NegativeStrandReadsAssigned:11707599 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR11389813 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11389813-trimmed-pair1.fastq SRR11389813-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,572,694 reads, 12,503,280 reads pseudoaligned [quant] estimated average fragment length: 156.321 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52973 SRR11389813.ke.tsv 35125 SRR11389813.se.tsv 88098 total ==> SRR11389813.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 780.783 0 0 PNS24247 1044 888.679 25.1464 3.30734 PNS24249 1928 1772.68 119.067 7.85075 PNS24246 1044 888.679 25.1464 3.30734 PNS24248 1044 888.679 25.1464 3.30734 PNS24244 1471 1315.68 60.4935 5.37412 PNS24243 293 146.809 0 0 KQK14069 1603 1447.68 3928.67 317.191 KQK14071 474 320.116 133.479 48.7367 ==> SRR11389813.se.tsv <== BRADI_1g14170v3 4201 BRADI_1g53295v3 41 BRADI_1g59795v3 370 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 147 BRADI_1g74790v3 144 BRADI_1g09890v3 0 BRADI_1g77505v3 249 BRADI_1g48960v3 0 SRR11389813 completed mapping pipeline successfully